Application of bifunctional methylenetetrahydrofolate dehydrogenase encoding gene folD in L-amino acid synthesis

Abstract

The present invention discloses the application of a bifunctional methylenetetrahydrofolate dehydrogenase encoding gene folD in L-amino acid synthesis. Specifically disclosed are a protein having an amino acid sequence of SEQ ID No.5 and a gene encoding the protein. The present invention constructs a genetically engineered bacterium containing a point mutation (T-A), a folD gene overexpressed on the genome and a plasmid, or a folD T107A The engineered bacteria with the folD gene and the engineered bacteria without the folD gene in the genome were fermented and showed that the folD gene and folD T107A The gene is involved in the biosynthesis of L-amino acids. Point mutation (T-A) in the folD gene coding region or overexpression of the folD gene or folD in the production bacteria T107A Genes can help improve the yield and conversion rate of L-amino acids, and can cultivate high-yield and high-quality strains that are suitable for industrial production, which is of great significance to the industrial production of L-amino acids.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to application of a bifunctional methylenetetrahydrofolate dehydrogenase encoding gene folD in L-amino acid synthesis. Background Art

[0002] Amino acids are a general term for a class of organic compounds containing amino and carboxyl groups. They are the basic structure of protein macromolecules. Almost all life activities are related to them. They are essential substances for the human body, and some are directly used as drugs. Although there are more than 300 kinds of amino acids in nature, there are only 20 kinds of amino acids that make up human proteins, and all of them are L-amino acids (except glycine). In recent years, L-amino acids have played an increasingly extensive role in food industry, medicine, agriculture, animal husbandry, human health, health care, and cosmetics industries. my country is a major producer and consumer of amino acids. Whether in terms of total industrial output or annual output value, it ranks among the top in the world and plays an important role in the development of my country's national economy. However, there are still problems such as backward main production technology indicators, high energy consumption, high production costs, and low fermentation yield and conversion rate. Traditional amino acid production methods include extraction, chemical synthesis, enzyme method, and microbial fermentation method. Extraction and chemical synthesis methods are difficult to achieve large-scale industrial production due to limited raw material sources, high production costs, and environmental pollution. Microbial fermentation is the most important method for producing L-amino acids, with advantages such as low raw material cost, mild reaction conditions, and easy large-scale production. Currently, there are more than 20 methods of producing amino acids by fermentation in the world. Microbial fermentation is to cultivate microorganisms in a culture medium with sugars and ammonium salts as the main raw materials to accumulate specific amino acids. An important reason for the establishment of these methods is the use of strains with high amino acid biosynthesis ability.

[0003] Excellent production strains are the guarantee for improving the yield and quality of amino acids. With the development of recombinant DNA technology and the acquisition of relevant microbial genome information, genetic engineering breeding technology based on metabolic engineering principles has gradually become the mainstream. Purposeful transformation of the metabolic pathways and metabolic networks of microorganisms, artificial changes in the metabolic regulation mechanism of strains, so that the metabolic flow in the microorganisms proceeds in the required direction, excessive accumulation of amino acids, significant increase in amino acid production, and reduction of costs are of great significance to accelerating the process of L-amino acid industrialization.

[0004] Methylenetetrahydrofolate dehydrogenase (MTHFD), also known as methylenetetrahydrofolate cyclohydrolase, is a bifunctional enzyme (encoded by the folD gene) with dual activities of methylenetetrahydrofolate dehydrogenase and cyclohydrolase, which plays a vital role in folic acid metabolism. Currently, there is no research on the function of MTHFD in L-amino acid production. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to increase the production of L-amino acids in microorganisms by genetic modification of genes. The technical problem to be solved is not limited to the described technical subject matter, and those skilled in the art can clearly understand other technical subjects not mentioned herein through the following description.

[0006] In order to solve the above technical problems, the present invention first provides a protein named folD L36Q , the protein folD L36Q Can be any of the following:

[0007] A1) a protein whose amino acid sequence is SEQ ID No. 5;

[0008] A2) a protein having more than 80% identity with the protein shown in A1) and having the same function as the protein shown in A1) obtained by replacing and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No.5;

[0009] A3) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

[0010] The tags include, but are not limited to, GST (glutathione sulfhydryltransferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0011] The present invention also provides a nucleic acid molecule named folD T107A , the nucleic acid molecule folD T107A Can be any of the following:

[0012] B1) encodes the protein folD L36Q nucleic acid molecules;

[0013] B2) the coding sequence is the DNA molecule shown in SEQ ID No.4;

[0014] B3) The nucleotide sequence is the DNA molecule shown in SEQ ID No.4.

[0015] The DNA molecule shown in SEQ ID No.4 is the mutant folD T107A Gene.

[0016] The DNA molecule shown in SEQ ID No.4 (folD T107A Gene) encodes the mutant protein folD shown in SEQ ID No.5 L36Q .

[0017] The folD T107A In the nucleotide sequence of the gene (SEQ ID No. 4), the 107th adenine (A) is mutated to thymine (T), and the protein folD L36Q The 36th glutamine (Q) in the amino acid sequence (SEQ ID No. 5) is mutated from leucine (L).

[0018] The present invention also provides a biomaterial, which may be any of the following:

[0019] C1) contains the nucleic acid molecule folD T107A expression cassette;

[0020] C2) contains the nucleic acid molecule folD T107A or a recombinant vector containing the expression cassette described in C1);

[0021] C3) contains the nucleic acid molecule folD T107A A recombinant microorganism comprising the expression cassette described in C1), or a recombinant microorganism comprising the recombinant vector described in C2);

[0022] C4) a recombinant cell containing the nucleic acid molecule of claim 2, or a recombinant cell containing the expression cassette of C1), or a recombinant cell containing the recombinant vector of C2).

[0023] The present invention also provides the use of any one of D1) to D10) in constructing a genetically engineered bacterium producing L-amino acids, and / or in preparing L-amino acids, and / or in regulating the yield of L-amino acids in microorganisms, wherein D1) to D10) are:

[0024] D1) The protein folD L36Q ;

[0025] D2) the nucleic acid molecule folDT107A ;

[0026] D3) the biological material;

[0027] D4) a protein whose amino acid sequence is SEQ ID No. 2;

[0028] D5) a DNA molecule encoding the protein shown in SEQ ID No. 2;

[0029] D6) a DNA molecule having a nucleotide sequence or coding sequence of SEQ ID No. 1;

[0030] D7) an expression cassette containing the DNA molecule described in D5) or D6);

[0031] D8) a recombinant vector containing the DNA molecule described in D5) or D6), or a recombinant vector containing the expression cassette described in D7);

[0032] D9) a recombinant microorganism containing the DNA molecule described in D5) or D6), or a recombinant microorganism containing the expression cassette described in D7), or a recombinant microorganism containing the recombinant vector described in D8);

[0033] D10) A recombinant cell containing the DNA molecule described in D5) or D6), or a recombinant cell containing the expression cassette described in D7), or a recombinant cell containing the recombinant vector described in D8).

[0034] The DNA molecule shown in SEQ ID No. 1 is also the folD gene of the present invention.

[0035] The DNA molecule (folD gene) shown in SEQ ID No.1 encodes the protein pfolD shown in SEQ ID No.2.

[0036] Furthermore, the present invention also provides the use of the recombinant bacterium W3110-pET28(a)-L36Q (W3110-folD mutant 2) in the fermentation production of L-threonine, L-tryptophan, L-arginine and / or L-valine.

[0037] The present invention also provides the use of the recombinant bacteria YPThr-folD-001, YPThr-folD-002, YPThr-folD-003, YPThr-folD-004, YPThr-folD-005 and / or YPThr-folD-006 in producing L-threonine by fermentation.

[0038] The present invention also provides the use of the recombinant bacteria YPtrp-folD-001, YPtrp-folD-002, YPtrp-folD-003, YPtrp-folD-004, YPtrp-folD-005 and / or YPtrp-folD-006 in producing L-tryptophan by fermentation.

[0039] The present invention also provides the use of the recombinant bacteria YPR-folD-001, YPR-folD-002, YPR-folD-003, YPR-folD-004, YPR-folD-005 and / or YPR-folD-006 in producing L-arginine by fermentation.

[0040] The present invention also provides the use of the recombinant bacteria YPV-folD-001, YPV-folD-002, YPV-folD-003, YPV-folD-004, YPV-folD-005 and / or YPV-folD-006 in the production of L-valine by fermentation.

[0041] Herein, identity refers to the identity of an amino acid sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST 2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively and performing a search to calculate the identity of an amino acid sequence, the value (%) of identity can then be obtained.

[0042] Herein, the 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0043] The regulation of the production of L-amino acids in microorganisms described herein may be to increase (upregulate) or decrease (downregulate) the accumulation of L-amino acids in microorganisms (ie, to promote or inhibit the biosynthesis of L-amino acids).

[0044] The present invention also provides a method for increasing the yield of L-amino acids in microorganisms, which method may include any of the following:

[0045] E1) increasing the nucleic acid molecule folD in the target microorganismT107A The expression amount or content of the target microorganism is obtained by obtaining a microorganism having a higher L-amino acid production than the target microorganism;

[0046] E2) increasing the expression level or content of the DNA molecule of D5) or D6) in the target microorganism to obtain a microorganism having a higher L-amino acid production than the target microorganism;

[0047] E3) mutating the DNA molecule whose nucleotide sequence is SEQ ID No.1 in the target microorganism to obtain a microorganism with a higher L-amino acid production than the target microorganism, wherein the mutation may be a mutation of the leucine residue at position 36 of the amino acid sequence encoded by the DNA molecule shown in SEQ ID No.1 to another amino acid residue.

[0048] In the above method, E1) can be achieved by any of the following methods: (1) increasing folD in the target microorganism T107A The copy number of a gene (e.g., single or multiple copies of folD T107A Gene introduction into target microorganisms); (2) enhancing folD expression through expression regulatory sequences T107A Gene expression (such as modification of folD T107A gene expression regulatory sequences).

[0049] Said E2) can be achieved by any of the following methods: (1) increasing the copy number of the folD gene in the target microorganism (such as introducing a single copy or multiple copies of the folD gene into the target microorganism); (2) enhancing the expression of the folD gene through an expression regulatory sequence (such as modifying the expression regulatory sequence of the folD gene).

[0050] The expression control sequence can be a promoter, enhancer or silencer sequence.

[0051] In the above method, the mutation may be to mutate the leucine residue (L) at position 36 of the amino acid sequence encoded by the DNA molecule shown in SEQ ID No. 1 into a glutamine residue (Q).

[0052] In the above method, the mutation may be a mutation of the nucleotide T at position 107 in the DNA molecule shown in SEQ ID No. 1 to A.

[0053] Furthermore, the mutation can be performed by gene editing technology or site-directed mutagenesis.

[0054] Furthermore, the mutation may be a point mutation, ie, a mutation of a single nucleotide.

[0055] The point mutation described herein may be a single base substitution, a single base insertion or a single base deletion, and specifically may be a single base substitution. The single base substitution may be an allele substitution.

[0056] The vector described herein refers to a vector that can carry exogenous DNA or target gene into host cells for amplification and expression. The vector can be a cloning vector or an expression vector, including but not limited to: plasmid, phage (such as lambda phage or M13 filamentous phage, etc.), cosmid (i.e., cosmid) or viral vector. Specifically, it can be vector pET28 (a), pGRB cloning vector and / or pREDCas9 plasmid.

[0057] The microorganism described herein may be yeast, bacteria, algae or fungi. Among them, the bacteria may be from Escherichia sp., Erwinia sp., Agrobacterium sp., Flavobacterium sp., Alcaligenes sp., Pseudomonas sp., Bacillus sp., Brevibacterium sp., Corynebacterium sp., Aerobacter sp., Enterobacteria sp., Micrococcus sp., Serratia sp., Salmonella sp., Streptomyces sp., Providencia sp., etc., but are not limited thereto.

[0058] Further, the bacterium may be Escherichia coli, Corynebacterium glutamicum, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Brevibacterium ammoniagenes, Corynebacterium crenatum or Pantoea.

[0059] In one or more embodiments of the present invention, the microorganism is Escherichia coli, specifically Escherichia coli DH5α, Escherichia coli W3110, Escherichia coli CGMCC25404, Escherichia coli CGMCC25403, Escherichia coli CGMCC25402 and / or Escherichia coli CGMCC22721.

[0060] The cell described herein can be a plant cell or an animal cell. The cell can be any biological cell that can synthesize the target amino acid.

[0061] The recombinant vector described herein may be pET28(a)-folD, the recombinant vector pET28(a)-L36Q, the recombinant vector pGRB-sgRNA-1 and / or pGRB-sgRNA-2.

[0062] The recombinant vector pET28(a)-folD is a recombinant expression vector obtained by connecting a wild-type folD gene fragment (SEQ ID No. 3) with a homologous arm of the vector pET28(a) with the vector pET28(a) by homologous recombination. The recombinant vector pET28(a)-folD contains the folD gene shown in SEQ ID No. 1.

[0063] The recombinant vector pET28(a)-L36Q is a recombinant expression vector obtained by connecting a mutant folD gene fragment (i.e., position 143 of SEQ ID No. 3 is mutated to A) with a homologous arm of the vector pET28(a) with the vector pET28(a) by homologous recombination. The recombinant vector pET28(a)-L36Q contains the folD gene fragment shown in SEQ ID No. 4. T107A Gene.

[0064] The recombinant vector pGRB-sgRNA-1 contains the folD gene editing target (5'-cacaaatatagacctgaag-3'). After being introduced into the recipient bacteria, the guide RNA is transcribed to form a complex with the Cas9 protein (expressed by the pREDCas9 plasmid), and the folD gene target is recognized through base complementary pairing and PAM sequence. The Cas9 protein will cause the DNA double strands upstream and downstream of the folD gene to break. On this basis, a repair template (donor DNA molecule, which is the DNA molecule shown in SEQ ID No. 11 in the present invention) is introduced into the recipient bacteria. The recipient bacteria will use its own DNA damage repair response mechanism according to the provided template to introduce site-directed mutations during the repair process to achieve point mutations in the folD gene, that is, the 107th thymine (T) in the nucleotide sequence of the folD gene (SEQ ID No. 1) is mutated to adenine (A).

[0065] The recombinant vector pGRB-sgRNA-2 contains the pseudogene yaiT editing target (5'-ggcaactatgtaaactatag-3'). After being introduced into the recipient bacteria, the guide RNA is transcribed to form a complex with the Cas9 protein (expressed by the pREDCas9 plasmid), and the yaiT gene target is recognized through base complementary pairing and PAM sequence. The Cas9 protein will cause the DNA double strands upstream and downstream of the yaiT gene to break. On this basis, a repair template (donor DNA molecule, in the present invention, the DNA molecule shown in SEQ ID No. 12 or SEQ ID No. 13) is introduced into the recipient bacteria. The recipient bacteria will use its own DNA damage repair response mechanism according to the provided template to introduce the insertion of DNA fragments during the repair process to achieve gene replacement, that is, replace part of the coding region of the yaiT gene with the folD gene or folD T107A Gene.

[0066] The recombinant microorganism described herein refers to a microorganism whose function has changed by manipulating and modifying the genes of the target microorganism. For example, a recombinant microorganism obtained by introducing an exogenous target gene or a recombinant vector into the target microorganism, or a recombinant microorganism obtained by directly editing the endogenous genes of the target microorganism. The recombinant microorganism described in the present invention may be a recombinant microorganism with improved L-amino acid production obtained by manipulating and modifying the genes of the target microorganism. In one or more embodiments of the present invention, the recombinant microorganism is a recombinant bacterium DH5α / pET28(a)-folD, a recombinant bacterium W3110-pET28(a)-L36Q, a recombinant bacterium YPThr-folD-001, YPTrp-folD-001, YPR-folD-001, YPV-folD-001, YPThr-folD-002, YPTrp-folD-002, YPR-folD-002, YPV-fo lD-002, YPThr-folD-003, YPTrp-folD-003, YPR-folD-003, YPV-folD-003, YPThr-folD-005, YPTrp-folD -005, YPR-folD-005, YPV-folD-005, YPThr-folD-006, YPTrp-folD-006, YPR-folD-006 and / or YPV-folD-006.

[0067] The recombinant bacterium DH5α / pET28(a)-folD is obtained by introducing the recombinant vector pET28(a)-folD into Escherichia coli DH5α. The recombinant bacterium DH5α / pET28(a)-folD contains the folD gene shown in SEQ ID No.1.

[0068] The recombinant bacterium W3110-pET28(a)-L36Q is obtained by introducing the recombinant vector pET28(a)-L36Q into Escherichia coli W3110. The recombinant bacterium W3110-pET28(a)-L36Q contains folD shown in SEQ ID No.4 T107A Gene.

[0069] The recombinant bacteria YPThr-folD-001, YPTrp-folD-001, YPR-folD-001 and YPV-folD-001 all contain the folD shown in SEQ ID No.4 T107A Gene.

[0070] The recombinant bacteria YPThr-folD-002, YPTrp-folD-002, YPR-folD-002 and YPV-folD-002 contain double copies of the folD gene shown in SEQ ID No. 1; specifically, the recombinant bacteria YPThr-folD-002, YPTrp-folD-002, YPR-folD-002 and YPV-folD-002 are obtained by replacing part of the coding region of the yaiT gene on the genome of Escherichia coli L-threonine producing bacteria CGMCC25404, L-tryptophan producing bacteria CGMCC25403, L-arginine producing bacteria CGMCC25402 and L-valine producing bacteria CGMCC22721 with the folD gene and its promoter, while keeping other nucleotides in the genome unchanged. The recombinant bacteria containing double copies of the folD gene can significantly and stably increase the expression level of the folD gene.

[0071] The recombinant bacteria YPThr-folD-003, YPTrp-folD-003, YPR-folD-003 and YPV-folD-003 contain the mutated folD shown in SEQ ID No.4 T107A Specifically, the recombinant bacteria YPThr-folD-003, YPTrp-folD-003, YPR-folD-003 and YPV-folD-003 are obtained by replacing part of the coding region of the yaiT gene on the genome of Escherichia coli L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402 and L-valine-producing bacteria CGMCC22721 with a mutant folD T107A The mutant folD was introduced into the recombinant bacterium. T107A The recombinant strain of the gene overexpressed folD T107A Genetically engineered strains (recombinant bacteria).

[0072] The recombinant bacteria YPThr-folD-005, YPTrp-folD-005, YPR-folD-005 and YPV-folD-005 contain the folD gene shown in SEQID No.1, and are engineered bacteria that overexpress the wild-type folD gene on the plasmid, that is, the exogenous gene folD is overexpressed outside the chromosome by the plasmid pET28(a)-folD.

[0073] The recombinant bacteria YPThr-folD-006, YPTrp-folD-006, YPR-folD-006 and YPV-folD-006 contain the mutant folD shown in SEQ ID No.4 T107A Gene, for overexpression of mutant folD on plasmid T107A Genetically engineered bacteria, i.e., plasmid pET28(a)-L36Q carrying the exogenous gene folD T107A Overexpressed extrachromosomally.

[0074] Among the above-mentioned recombinant bacteria, the recombinant bacteria W3110-pET28(a)-L36Q, recombinant bacteria YPThr-folD-001, YPTrp-folD-001, YPR-folD-001, YPV-folD-001, YPThr-folD-003, YPTrp-folD-003, YPR-folD-003, YPV-folD-003, YPThr-folD-006, YPTrp-folD-006, YPR-folD-006 and YPV-folD-006 are all within the scope of protection of the present invention.

[0075] Among the above-mentioned recombinant bacteria, the use of recombinant bacteria DH5α / pET28(a)-folD, YPThr-folD-002, YPTrp-folD-002, YPR-folD-002, YPV-folD-002, YPThr-folD-005, YPTrp-folD-005, YPR-folD-005, and YPV-folD-005 in the preparation of L-amino acids is also within the scope of protection of the present invention.

[0076] The present invention also provides a method for constructing the recombinant microorganism, which may include at least any one of the following:

[0077] F1) the nucleic acid molecule folD T107A introducing a target microorganism to obtain the recombinant microorganism;

[0078] F2) introducing the DNA molecule described in D5) or D6) into a target microorganism to obtain the recombinant microorganism;

[0079] F3) mutating the leucine residue at position 36 of the protein shown in SEQ ID No. 2 in the target microorganism to a glutamine residue to obtain the recombinant microorganism;

[0080] F4) editing the DNA molecule shown in SEQ ID No. 1 in the target microorganism using gene editing means so that the target microorganism contains the DNA molecule shown in SEQ ID No. 4.

[0081] The introduction can be by chemical conversion (e.g. Ca 2+ The vector carrying the DNA molecule of the present invention can be transformed into the host bacteria by any known transformation method such as induced transformation method, polyethylene glycol-mediated transformation method or metal cation-mediated transformation method or electroporation transformation method; or the DNA molecule of the present invention can be transduced into the host bacteria by phage transduction method. The introduced DNA molecule can be a single copy or multiple copies. The introduction can be to integrate the foreign gene into the host chromosome or to express it outside the chromosome by a plasmid.

[0082] The present invention also provides a method for preparing L-amino acids, which may include producing L-amino acids using any of the recombinant microorganisms described herein.

[0083] In the above method, the method can be a fermentation method for preparing L-amino acids, and the recombinant microorganism can be a recombinant bacterium W3110-pET28(a)-L36Q, a recombinant bacterium YPThr-folD-001, YPTrp-folD-001, YPR-folD-001, YPV-folD-001, YPThr-folD-002, YPTrp-folD-002, YPR-folD-002, YPV-folD-002, YPThr-folD-003, YPTrp-folD-003, YPR-folD-003, YPV-folD-003, YPThr-folD-005, YPTrp-folD-005 , YPR-folD-005, YPV-folD-005, YPThr-folD-006, YPTrp-folD-006, YPR-folD-006 and / or YPV-folD-006. Among them, the recombinant bacteria YPThr-folD-001, YPThr-folD-002, YPThr-folD-003, YPThr-folD-005 and YPThr-folD-006 can be used for the fermentation production of L-threonine; the recombinant bacteria YPtrp-folD-001, YPtrp-folD-002, YPtrp-folD-003, YPtrp-folD-005 and YPtrp-folD-006 can be used for the fermentation production of L-threonine. The recombinant bacteria YPR-folD-001, YPR-folD-002, YPR-folD-003, YPR-folD-005 and YPR-folD-006 can be used for the production of L-arginine by fermentation; the recombinant bacteria YPV-folD-001, YPV-folD-002, YPV-folD-003, YPV-folD-005 and YPV-folD-006 can be used for the production of L-valine by fermentation.

[0084] Herein, the L-amino acid may be L-threonine, L-tryptophan, L-arginine, L-valine, L-lysine, L-glutamic acid, L-glycine, L-alanine, L-leucine, L-isoleucine, L-methionine, L-proline, L-serine, L-tyrosine, L-cysteine, L-phenylalanine, L-asparagine, L-glutamine, L-aspartic acid and / or L-histidine.

[0085] Herein, the L-amino acid may be L-threonine, L-tryptophan, L-arginine and / or L-valine.

[0086] Herein, the microorganism (target microorganism) may be a bacterium.

[0087] Furthermore, the bacteria may be from the genus Escherichia sp.

[0088] Furthermore, the bacteria may be Escherichia coli.

[0089] Specifically, the Escherichia coli may be Escherichia coli W3110, Escherichia coli CGMCC25404, Escherichia coli CGMCC25403, Escherichia coli CGMCC25402 or Escherichia coli CGMCC22721.

[0090] The present invention also provides a method for preparing L-threonine acid, which may include the following steps:

[0091] M1) culturing the recombinant bacteria W3110-pET28(a)-L36Q, the recombinant bacteria YPThr-folD-001, YPThr-folD-002, YPThr-folD-003, YPThr-folD-005 and / or YPThr-folD-006 in a culture medium;

[0092] M2) collecting the L-threonine acid from the recombinant bacterial cells and / or culture medium.

[0093] The present invention also provides a method for preparing L-chromobase acid, which may include the following steps:

[0094] N1) culturing the recombinant bacteria W3110-pET28(a)-L36Q, the recombinant bacteria YPtrp-folD-001, YPtrp-folD-002, YPtrp-folD-003, YPtrp-folD-005 and / or YPtrp-folD-006 in a culture medium;

[0095] N2) collecting the L-chromobase acid from the recombinant bacterial cells and / or culture medium.

[0096] The present invention also provides a method for preparing L-arginine acid, which may include the following steps:

[0097] P1) culturing the recombinant bacteria W3110-pET28(a)-L36Q, the recombinant bacteria YPR-folD-001, YPR-folD-002, YPR-folD-003, YPR-folD-005 and / or YPR-folD-006 in a culture medium;

[0098] P2) collecting the L-spermid from the recombinant bacterial cells and / or culture medium.

[0099] The present invention also provides a method for preparing L-valine acid, which may include the following steps:

[0100] Q1) culturing the recombinant bacteria W3110-pET28(a)-L36Q, the recombinant bacteria YPV-folD-001, YPV-folD-002, YPV-folD-003, YPV-folD-005 and YPV-folD-006 in a culture medium;

[0101] Q2) collecting the L-valine acid from the recombinant bacterial cells and / or culture medium.

[0102] The culture can be carried out according to conventional methods in the art, including but not limited to well plate culture, shake flask culture, batch culture, continuous culture and batch feeding culture, etc., and various culture conditions such as temperature, time and pH value of the culture medium can be appropriately adjusted according to actual conditions.

[0103] The present invention also provides a method for producing amino acids, the method comprising: T107A Gene) is introduced into a biological cell capable of synthesizing a target amino acid to obtain a recombinant biological cell; and the recombinant biological cell is cultured to obtain the target amino acid.

[0104] In the above method, the biological cell can be a yeast, bacterium, algae, fungus, plant cell or animal cell that can synthesize the target amino acid. The biological cell can be any biological cell that can synthesize the target amino acid. The bacterium can be Escherichia coli, Corynebacterium glutamicum, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Brevibacterium ammoniagenes, Corynebacterium crenatum or Pantoea.

[0105] Using the folD gene or its variant (such as folD T107A Recombinant microorganisms or recombinant cells constructed with the gene (gene) can be used to produce a variety of products, including but not limited to lysine, glutamic acid, valine, glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, alpha-ketoglutaric acid, citrate, ornithine and / or citrulline.

[0106] The present invention first constructs a random mutation plasmid using a folD gene fragment containing random point mutations obtained by error-prone PCR amplification, further transforms Escherichia coli W3110 to obtain a folD gene mutant W3110 strain with different mutations, and uses HPLC to analyze the concentration (content) of L-amino acids after fermentation and culture of the obtained mutant strain, and screens out a W3110-folD mutant strain 2, which has better ability to produce L-threonine, L-arginine and L-valine than the wild-type W3110 strain and other mutant strains. The sequencing results of the folD gene in the W3110-folD mutant strain 2 show that the 107th thymine (T) in the nucleotide sequence (SEQ ID No. 1) of the folD gene is mutated to adenine (A), and accordingly, the 36th leucine (L) in the amino acid sequence (SEQ ID No. 2) of the protein encoded by it is mutated to glutamine (Q) (the mutated gene is named folD T107AGene). Subsequently, the excellent effect of the W3110-folD mutant 2 of the present invention was further verified by constructing a mutant in which the amino acid (L) at position 36 of SEQ ID No. 2 was replaced by different amino acids, indicating that the amino acid (L) at position 36 in the amino acid sequence (SEQ ID No. 2) of the protein pfolD encoded by the folD gene was mutated to glutamine (Q) to significantly increase the production of L-amino acids. In order to further study the folD gene and folD T107A In order to study the influence of genes on the production of L-amino acids such as L-threonine, L-tryptophan, L-valine and L-arginine in producing bacteria, the present invention respectively constructed: 1. folD gene mutant engineering strains with a point mutation (TA) introduced at position 107 of the folD gene coding region of four producing bacteria; 2. folD gene or folD gene overexpressed in the genome T107A 3. Engineered strains with folD gene missing from the genome; 4. Engineered strains with folD gene overexpressed or folD overexpressed on plasmids T107A The engineered strain was subjected to fermentation experiments, and the results showed that the folD gene and its variant folD T107A The gene is involved in the biosynthesis of L-amino acids. The accumulation of L-amino acids in microorganisms can be regulated by overexpressing or knocking out the folD gene, or by site-directed mutagenesis. Point mutation (TA) in the coding region of the folD gene or by overexpressing the folD gene or folD in the production bacteria T107A The folD gene is helpful to improve the production and conversion rate of L-amino acids, while knocking out or weakening the folD gene is not conducive to the accumulation of L-amino acids. T107A Gene) is used to construct genetically engineered bacteria that produce L-amino acids to promote the increase of L-amino acid production.

[0107] Depository Instructions

[0108] 1. Bacteria species: Escherichia coli

[0109] Latin name: Escherichia coli

[0110] Classification name: Escherichia coli

[0111] Strain ID: YP0158

[0112] Depository: China National Microbiological Culture Collection Administration General Microbiology Center

[0113] Abbreviation of depository unit: CGMCC

[0114] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0115] Date of deposit: July 25, 2022

[0116] CGMCC Registration Number: CGMCC No.25404

[0117] 2. Bacteria species: Escherichia coli

[0118] Latin name: Escherichia coli

[0119] Classification name: Escherichia coli

[0120] Strain ID: YP006D

[0121] Depository: China National Microbiological Culture Collection Administration General Microbiology Center

[0122] Abbreviation of depository unit: CGMCC

[0123] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0124] Date of deposit: July 25, 2022

[0125] CGMCC Registration Number: CGMCC No.25403

[0126] 3. Bacteria species: Escherichia coli

[0127] Latin name: Escherichia coli

[0128] Classification name: Escherichia coli

[0129] Strain ID: YP004-8

[0130] Depository: China National Microbiological Culture Collection Administration General Microbiology Center

[0131] Abbreviation of depository unit: CGMCC

[0132] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0133] Date of deposit: July 25, 2022

[0134] CGMCC Registration Number: CGMCC No.25402

[0135] 4. Bacteria species: Escherichia coli

[0136] Latin name: Escherichia coli

[0137] Classification name: Escherichia coli

[0138] Strain ID: YP045

[0139] Depository: China National Microbiological Culture Collection Administration General Microbiology Center

[0140] Abbreviation of depository unit: CGMCC

[0141] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0142] Date of deposit: June 15, 2021

[0143] CGMCC Registration Number: CGMCC No.22721 DETAILED DESCRIPTION

[0144] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0145] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0146] The Escherichia coli W3110 in the following examples is a strain of the American Type Culture Collection (ATCC), with the collection number being ATCC27325.

[0147] KAPA HiFi HotStart in the following examples is a high-fidelity hot-start DNA polymerase (product of KAPABIOSYSTEMS).

[0148] The pGRB cloning vector and pREDCas9 plasmid in the following examples are products of Addgene.

[0149] The L-threonine producing bacterium CGMCC25404 in the following examples is Escherichia coli YP0158CGMCC No.25404, also referred to as Escherichia coli CGMCC25404.

[0150] The L-tryptophan producing bacteria CGMCC25403 in the following examples is Escherichia coli YP006DCGMCC No.25403, also referred to as Escherichia coli CGMCC25403.

[0151] The L-arginine producing bacteria CGMCC25402 in the following examples is Escherichia coli YP004-8CGMCC No.25402, also referred to as Escherichia coli CGMCC25402.

[0152] The L-valine-producing bacterium CGMCC22721 in the following examples is Escherichia coli YP045CGMCC No.22721, also referred to as Escherichia coli CGMCC22721.

[0153] Example 1: Construction of bifunctional methylenetetrahydrofolate dehydrogenase folD gene mutant W3110 strain

[0154] 1. Construction of folD gene mutant expression plasmid with bifunctional methylenetetrahydrofolate dehydrogenase activity

[0155] For the convenience of research, the wild-type folD gene (nucleotide sequence as shown in SEQ ID No. 1) was first cloned into the expression vector pET28 (a). The Escherichia coli W3110 genome sequence published by NCBI was used as a template, and pET28-PF and pET28-PR were used as primers for PCR amplification. The amplified product obtained was a wild-type folD gene fragment with homology arms of the vector pET28 (a) (nucleotide sequence as shown in SEQ ID No. 3). After the amplification product was recovered, it was connected with the linearized expression vector pET28(a) (purchased from TaKaRa, containing kanamycin resistance) recovered by EcoR I / Hind III digestion using NEBuilder enzyme (purchased from NEB) at 50°C for 30 minutes. The ligation product was transformed into DH5α competent cells, spread on 2-YT agar plates containing kanamycin (50 mg / L) and cultured at 37°C to obtain pET28(a) transformants containing the folD gene and its promoter (the colonies grown on the plates containing kanamycin after transformation are transformants). The monoclonal colonies grown in the culture were identified by PCR using primers T7F, primers T7R and r Taq polymerase. The colonies containing a fragment of 1147 bp amplified by PCR were positive clones, i.e., positive transformants (recombinant bacteria) DH5α / pET28(a)-folD containing the folD gene (SEQ ID No. 1). After the plasmid was extracted, it was named pET28(a)-folD.

[0156] Plasmid pET28(a)-folD (recombinant vector pET28(a)-folD) is a recombinant expression vector obtained by connecting a wild-type folD gene fragment (SEQ ID No. 3) with a homologous arm of vector pET28(a) with vector pET28(a) by homologous recombination. The recombinant vector pET28(a)-folD contains the folD gene shown in SEQ ID No. 1.

[0157] The recombinant bacterium DH5α / pET28(a)-folD is obtained by introducing the recombinant vector pET28(a)-folD into Escherichia coli DH5α. The recombinant bacterium DH5α / pET28(a)-folD contains the folD gene shown in SEQ ID No.1.

[0158] In order to obtain a mutant of the gene folD encoding a bifunctional methylenetetrahydrofolate dehydrogenase, a folD mutant gene plasmid was prepared using a random mutagenesis kit (Agilent Technologies, USA). The specific method is as follows:

[0159] Using plasmid pET28(a)-folD as a template, pET28-PF and pET28-PR as primers, and a random mutagenesis kit for error-prone PCR amplification, the obtained amplification product was a 939 bp folD gene fragment containing a random point mutation, named DNA fragment 1 (DNA fragment 1 is a random point mutation in the folD gene coding region of the DNA molecule shown in SEQ ID No. 3).

[0160] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0161] PCR amplification program: pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 56°C for 15 s; extension at 72°C for 60 s; 30 cycles), over-extension at 72°C for 5 min.

[0162] The recovered DNA fragment 1 was connected with the linearized expression vector pET28 (a) (purchased from TaKaRa, containing kanamycin resistance) recovered by EcoR I / Hind III digestion using NEBuilder enzyme (purchased from NEB) at 50°C for 30 minutes, and the ligation product was transformed into DH5α competent cells, spread on 2-YT agar plates containing kanamycin (50 mg / L) and cultured at 37°C to obtain transformants containing the rmfolD gene. The rmfolD gene is a folD gene with random point mutations in the coding region (SEQ ID No. 1). The monoclonal colonies grown in the culture were identified by PCR using primers T7F, primers T7R and r Taq polymerase. The colonies containing a fragment of 1147 bp amplified by PCR were positive clones, i.e., positive transformants containing the rmfolD gene, DH5α / pET28 (a)-rmfolD, which were named pET28 (a)-rmfolD after plasmid extraction.

[0163] PCR amplification system: 2×Premix r Taq 12.5 μL, primers (10 pM) 1 μL each, supplemented with ddH2O to a total volume of 25 μL.

[0164] PCR amplification program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s; 56°C annealing for 30 s; 72°C extension for 90 s (30 cycles), 72°C over-extension for 10 min.

[0165] The primer sequences are as follows (synthesized by Shanghai Invitrogen):

[0166] Primer pET28-PF:

[0167] 5'- ACTGGTGGACAGCAAATGGGTCGCGGATCCGAATTC ATGGCAGCAAAGATTATTGAC-3' (the underlined nucleotide sequence is the pET28 (a) homology arm sequence),

[0168] Primer pET28-PR:

[0169] 5'- GGTGGTGGTGGTGGTGCTCGAGTGCGGCCGCAAGCT TTACTCATCCTGTGGATCATG-3' (the underlined nucleotide sequence is the pET28(a) homology arm sequence).

[0170] Primer T7F: 5'-CAGCAGCCATCATCATCATC-3',

[0171] Primer T7R: 5′-ATCCGGATATAGTTCCTCC-3′.

[0172] 2. Construction of folD mutant strain with bifunctional methylenetetrahydrofolate dehydrogenase activity

[0173] In order to identify the L-amino acid production performance of the mutant vector constructed in step 1, the folD random mutant plasmid (pET28(a)-rmfolD) constructed in step 1 was transformed into the Escherichia coli W3110 strain (transformation and identification were the same as step 1) to obtain the positive transformant W3110 / pET28(a)-rmfolD. The positive transformant W3110 / pET28(a)-rmfolD was subcultured three times on a 2-YT agar plate containing kanamycin (50 mg / L), and then inoculated into a 500-mL Erlenmeyer flask containing 30 mL of rich culture medium and fermented at 37°C for 24 h. The fermentation culture cells grew to an OD of 600 =0.2, isopropyl-β-D-thiogalactoside (IPTG) was added at a final concentration of 0.1 mM to induce overexpression of bifunctional methylenetetrahydrofolate dehydrogenase.

[0174] After the fermentation culture was completed, the concentration (content) of L-amino acids was analyzed by high performance liquid chromatography (HPLC), as shown in Table 1. The strains with superior L-amino acid production capacity compared with the W3110 control were selected as W3110-folD mutants, which are the general name for mutants obtained by transforming different folD random mutation plasmids (pET28(a)-rmfolD) into Escherichia coli W3110 strains.

[0175] Rich medium: the solvent is water, the solutes and their concentrations are glucose 30g / L, (NH4)2SO4 2g / L, H3PO40.5g / L, KCl 0.8g / L, MgSO4·7H2O 0.8g / L, FeSO4·7H2O 0.05g / L, MnSO4·H2O 0.05g / L, FM902 yeast powder 1.5g / L, corn syrup 5g / L, molasses 17g / L, betaine 0.5g / L, citric acid 2g / L, VH 20mg / L, VB11.5mg / L, VB3 1.5mg / L VB 12 1.5 g / L, sodium hydroxide was used to adjust pH to 7.0.

[0176] Table 1 Results of HPLC analysis of L-amino acids in the W3110-folD mutant

[0177]

[0178] As shown in Table 1, the E. coli W3110-folD mutant of the present invention has the ability to produce some L-amino acids, among which the W3110-folD mutant 2 has a better ability to produce L-threonine, L-arginine and L-valine. This indicates that the W3110-folD mutant 2 has the activity of synthesizing L-threonine, L-arginine and L-valine.

[0179] Plasmids were further extracted from W3110-folD mutant strain 2 to sequence the folD gene. The results showed that W3110-folD mutant strain 2 contained a folD gene mutant, which was a folD gene with a point mutation in the coding region (SEQ ID No. 1). The point mutation was to mutate the 107th thymine (T) in the nucleotide sequence of the folD gene (SEQ ID No. 1) to adenine (A), and the DNA molecule shown in SEQ ID No. 4 was obtained, which was named folD T107A Accordingly, the amino acid sequence encoded by the DNA molecule shown in SEQ ID No.4 is a mutant protein of SEQ ID No.5, in which the 36th glutamine (Q) in the amino acid sequence (SEQ ID No.5) of the mutant protein is mutated to leucine (L), and is named protein folD L36Q .

[0180] The plasmid extracted from W3110-folD mutant strain 2 was a mutant plasmid that produced a point mutation (TA) in the folD random mutation plasmid (pET28(a)-rmfolD) and was named the recombinant vector pET28(a)-L36Q.

[0181] The recombinant vector pET28(a)-L36Q is a recombinant expression vector obtained by connecting a mutant folD gene fragment with a homology arm of the vector pET28(a) (i.e., position 143 of SEQ ID No.3 is mutated to A, and other nucleotide sequences remain unchanged) with the vector pET28(a) by homologous recombination. The recombinant vector pET28(a)-L36Q contains the folD gene shown in SEQ ID No.4. T107A Gene.

[0182] W3110-folD mutant 2 is a recombinant bacterium W3110-pET28(a)-L36Q obtained by introducing the recombinant vector pET28(a)-L36Q into Escherichia coli W3110. W3110-folD mutant 2 (i.e., recombinant bacterium W3110-pET28(a)-L36Q) contains folD shown in SEQ ID No.4 T107A Gene.

[0183] The nucleotide sequence of the wild-type folD gene is SEQ ID No.1, and the amino acid sequence of the protein encoded by it (named pfolD) is SEQ ID No.2.

[0184] Mutant folD T107A The nucleotide sequence of the gene is SEQ ID No. 4, which encodes a mutant protein (named folD L36Q ) has an amino acid sequence of SEQ ID No. 5. Mutant folD T107A In the nucleotide sequence of the gene (SEQ ID No. 4), the 107th adenine (A) was mutated to thymine (T). L36Q The 36th glutamine (Q) in the amino acid sequence (SEQ ID No. 5) was mutated to leucine (L).

[0185] 3. Construction of folD mutant plasmid with bifunctional methylenetetrahydrofolate dehydrogenase activity

[0186] In steps 1 and 2, the wild-type Escherichia coli W3110 was used to obtain the W3110-folD mutant 2 by random mutation. In order to obtain more folD mutants to improve their L-amino acid production capacity, mutants in which the amino acid (L) at the above folD mutation position (the 36th position of SEQ ID No. 2) was replaced by different amino acids were constructed. Specifically, using the plasmid (pET28 (a) -L36Q) sequenced in step 2 as a template, 5 mutants in which the amino acid at the 36th position of the wild-type folD gene was replaced by different amino acids were constructed. The amino acids replaced by the mutants and the names of the primers used in each mutant are shown in Table 2.

[0187] Table 2 Amino acids substituted by folD mutants and primer names used in each mutant

[0188]

[0189] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0190] P-PR: 5'-CAGCACAACGGCCGGTCCTGGTGCCCGCAGTCCGGCTGCA-3',

[0191] P-PF: 5'-TGCAGCCGGACTGCGGGCACCAGGACCGGCCGTTGTGCTG-3',

[0192] R-PR: 5'-CAGCACAACGGCCCGTCCTGGTGCCCGCAGTCCGGCTGCA-3',

[0193] R-PF: 5'-TGCAGCCGGACTGCGGGCACCAGGACGGGCCGTTTGTGCTG-3',

[0194] S-PR: 5'-CAGCACAACGGCCGATCCTGGTGCCCGCAGTCCGGCTGCA-3',

[0195] S-PF: 5'-TGCAGCCGGACTGCGGGCACCAGGATCGGCCGTTGTGCTG-3',

[0196] W-PR: 5'-CAGCACAACGGCCCATCCTGGTGCCCGCAGTCCGGCTGCA-3',

[0197] W-PF: 5'-TGCAGCCGGACTGCGGGCACCAGGATGGGCCGTTTGTGCTG-3',

[0198] F-PR: 5'-CAGCACAACGGCGAATCCTGGTGCCCGCAGTCCGGCTGCA-3',

[0199] F-PF: 5'-TGCAGCCGGACTGCGGGCACCAGGATTCGCCGTTGTGCTG-3',

[0200] The plasmid pET28(a)-L36Q sequenced in step 2 was used as a template, and PCR amplification was performed using the primers in Table 2 and KAPA HiFiHotStart to obtain two Up DNA fragments of 156 bp and Down DNA fragments of 797 bp, respectively, with folD mutant bases. After the PCR reaction, a column DNA gel recovery kit was used to recover the Up DNA fragment and the Down DNA fragment by agarose gel electrophoresis. The two recovered DNA fragments were connected to the linearized expression vector pET28(a) recovered by EcoR I / Hind III digestion using NEBuilder enzyme (purchased from NEB) at 50°C for 30 minutes, and the ligation product was transformed into DH5α competent cells, and spread on 2-YT agar plates containing kanamycin (50 mg / L) and cultured at 37°C. The monoclonal colonies grown in culture were identified by PCR using primers T7F, primer T7R and r Taq polymerase. The colonies containing a fragment of 1147 bp amplified by PCR were positive clones, i.e., positive transformants containing the folD mutant gene. After plasmids were extracted, they were named as recombinant vectors pET28(a)-L36P, pET28(a)-L36R, pET28(a)-L36S, pET28(a)-L36W and pET28(a)-L36F, i.e., the folD mutant vectors in Table 2.

[0201] The recombinant vector pET28(a)-L36P contains folD shown in SEQ ID No.6 T107C Gene; recombinant vector pET28 (a) -L36R contains folD shown in SEQ ID No.7 T107G Gene; recombinant vector pET28 (a) -L36S contains folD shown in SEQ ID No.8 CT106-107TC Gene; recombinant vector pET28 (a) -L36W contains folD shown in SEQ ID No.9 CT106-107TG Gene; recombinant vector pET28 (a) -L36F contains folD shown in SEQ ID No.10 C106T / G108C Gene.

[0202] Mutant folD T107C In the nucleotide sequence of the gene (SEQ ID No. 6), the 107th cytosine (C) mutated to thymine (T). T107C The mutant protein encoded by the gene (named folD L36P ) is based on SEQ ID No. 2, with the leucine (L) at position 36 mutated to proline (P).

[0203] Mutant folD T107GIn the nucleotide sequence of the gene (SEQ ID No. 7), the 107th guanine (G) was mutated to thymine (T). T107G The mutant protein encoded by the gene (named folD L36R ) is based on SEQ ID No. 2, with the leucine (L) at position 36 mutated to arginine (R).

[0204] Mutant folD CT106-107TC In the nucleotide sequence of the gene (SEQ ID No. 8), the thymine cytosine (TC) at positions 106-107 was mutated from cytosine thymine (CT). CT106-107TC The mutant protein encoded by the gene (named folD L36S ) is based on SEQ ID No. 2, with the leucine (L) at position 36 mutated to serine (S).

[0205] Mutant folD CT106-107TG In the nucleotide sequence of the gene (SEQ ID No. 9), the thymine guanine (TG) at positions 106-107 was mutated from cytosine thymine (CT). CT106-107TG The mutant protein encoded by the gene (named folD L36W ) is based on SEQ ID No. 2, with the leucine (L) at position 36 mutated to tryptophan (W).

[0206] Mutant folD C106T / G108C In the nucleotide sequence of the gene (SEQ ID No. 10), the thymine (T) at position 106 mutated from cytosine (C), and the cytosine (C) at position 108 mutated from guanine (G). C106T / G108C The mutant protein encoded by the gene (named folD L36F ) is based on SEQ ID No. 2, with the leucine (L) at position 36 mutated to phenylalanine (F).

[0207] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0208] PCR amplification program: pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 56°C for 15 s; extension at 72°C for 60 s; 30 cycles), over-extension at 72°C for 5 min.

[0209] The amplification system for PCR identification was as follows: 2×Premix r Taq 12.5 μL, primers (10 pM) 1 μL each, supplemented with ddH2O, total volume 25 μL.

[0210] The amplification program for PCR identification was as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 90 s (30 cycles), and over-extension at 72°C for 10 min.

[0211] 4. Construction of folD gene mutant strain with bifunctional methylenetetrahydrofolate dehydrogenase activity

[0212] In order to identify the L-amino acid production performance of the mutant vector constructed in step 3, the plasmids constructed in step 3 (pET28(a)-L36P, pET28(a)-L36R, pET28(a)-L36S, pET28(a)-L36W and pET28(a)-L36F) were transformed into Escherichia coli W3110 strain (transformation and identification were the same as step 1), and the positive transformants were obtained, namely the W3110-folD mutant strain W3110-pET28(a)-L36P. )-L36P, W3110-pET28(a)-L36R, W3110-pET28(a)-L36S, W3110-pET28(a)-L36W and W3110-pET28(a)-L36F, the positive transformants were subcultured three times on 2-YT agar plates containing kanamycin (50 mg / L), and then inoculated into 500-mL Erlenmeyer flasks containing 30 mL of rich culture medium and fermented at 37°C for 24 h. The fermentation culture cells grew to OD 600 =0.2, IPTG was added at a final concentration of 0.1 mM to induce overexpression of bifunctional methylenetetrahydrofolate dehydrogenase.

[0213] After the fermentation culture was completed, the concentration (content) of L-amino acids was analyzed by high performance liquid chromatography (HPLC), as shown in Table 3. The mutant strain W3110-pET28(a)-L36Q had a stronger ability to produce L-threonine, L-arginine and L-valine than W3110-pET28(a)-L36P, W3110-pET28(a)-L36R, W3110-pET28(a)-L36S, W3110-pET28(a)-L36W and W3110-pET28(a)-L36F.

[0214] Table 3 Results of HPLC analysis of L-amino acids in W3110-folD mutant

[0215]

[0216] Example 2: Construction of a bifunctional methylenetetrahydrofolate dehydrogenase folD gene mutant engineered strain

[0217] Based on the Escherichia coli W3110 genome sequence published by NCBI, CRISPR / Cas9 gene editing technology was used to perform point mutations in the folD gene of the L-amino acid high-producing strain, in order to further study the folD gene and mutant folD in the high-producing strain. T107A Effects of genes on the production of L-amino acids such as L-threonine, L-tryptophan, L-valine and L-arginine.

[0218] A point mutation was introduced into the folD gene coding region (SEQ ID No. 1), wherein the thymine (T) at position 107 in the nucleotide sequence of the folD gene (SEQ ID No. 1) was mutated to adenine (A), thereby obtaining a DNA molecule shown in SEQ ID No. 4 (named folD T107A Gene). Accordingly, the DNA molecule shown in SEQ ID No.4 encodes the mutant protein folD of SEQ ID No.5. L36Q The 36th glutamine (Q) in the amino acid sequence of the mutant protein (SEQ ID No. 5) was mutated to leucine (L), and the protein was named folD L36Q .

[0219] 1. Construction of sgRNA plasmid

[0220] According to the Escherichia coli W3110 genome sequence published by NCBI, sgRNA target sequences were designed using CRISPRRGEN Tools (http: / / www.rgenome.net / cas-designer / ). After selecting the appropriate sgRNA target sequence, the linearized pGRB cloning vector end sequence was added to the 5' and 3' ends of the target sequence to form a complete sgRNA plasmid through recombination.

[0221] To amplify the DNA fragment containing the sgRNA target sequence, no template is required, only the PCR annealing process is required. The system and procedure are as follows. PCR reaction system: sgRNA-1F 10μL, sgRNA-1R 10μL; PCR reaction procedure: 95℃ denaturation for 5min, 50℃ annealing for 1min. After annealing, the target fragment (DNA fragment containing the sgRNA target sequence) was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100ng / μL.

[0222] pGRB plasmid was digested with Spe I to obtain linearized pGRB plasmid, and then dephosphorylated to prevent pGRB plasmid from self-ligation. Enzyme digestion system: 10×Buffer 5μL, Spe I 2.5μL, pGRB plasmid DNA 3000-5000ng, supplemented with ddH2O to 50μL. After 37℃ digestion for 3h, agarose gel electrophoresis was performed to cut the gel and then dephosphorylated. Dephosphorylation system: 10×Buffer 5μL, linearized pGRB plasmid DNA 1000-2000ng, CIAP (calf intestinal alkaline phosphatase) 2.5μL, supplemented with ddH2O to 50μL. After 37℃ treatment for 1h, the linearized pGRB plasmid was recovered using a DNA purification kit.

[0223] The DNA fragment containing the sgRNA target sequence was connected to the linearized pGRB plasmid by homologous recombination using the Gibson Assembly Kit (New England). Recombination system: 2.5 μL of NEB assembly enzyme, 2 μL of linearized pGRB plasmid, and 0.5 μL of DNA fragment containing the sgRNA target sequence. After assembling at 50°C for 30 minutes, the product was transformed into DH5α competent cells, the plasmid was extracted, and sequencing was performed using sequencing primers sgRNA-PF / sgRNA-PR. The constructed sgRNA plasmid was named pGRB-sgRNA-1.

[0224] The primers used in this experiment were designed as follows (synthesized by Shanghai Invitrogen). The underlined bases are the homology arm sequences of the pGRB cloning vector, and the bases in lowercase are the sgRNA target sequences:

[0225] Primer sgRNA-1F:

[0226] 5'- TGACAGCTAGCTCAGTCCTAGGTATAATACTAGT cacaaatatagacctgaag GTTTTAGAGCTA GAAATAGCAAGTTAAAATAAGG -3';

[0227] Primer sgRNA-1R:

[0228] 5'- CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC cttcaggtctatatttgtg CTAGTATTATAC CTAGGACTGAGCTAGCTGTCA -3';

[0229] Primer sgRNA-PF: 5′-GTCTCATGAGCGGATACATATTTG-3′;

[0230] Primer sgRNA-PR: 5′-ATGAGAAAGCGCCACGCT-3′.

[0231] 2. Mutant folDT107A Amplification of gene fragments

[0232] Using E. coli W3110 genomic DNA as a template, PCR amplification was performed with primers P1 / P2, P3 / P4 and KAPA HiFiHotStart to obtain two folD fragments with mutant bases of 860 bp and 740 bp, respectively. T107A DNA fragment (folD T107A Up and follow T107A After the PCR reaction was completed, agarose gel electrophoresis was used to recover folD T107A Up and follow T107A Using the two recovered DNA fragments as templates, primers P1 / P4 were used for overlap PCR amplification to obtain a point mutation integrated homology arm DNA fragment (i.e., mutant folD T107A Gene fragment)Up-folD T107A -Down (SEQ ID No.11) 1560bp. In the DNA fragment shown in SEQ ID No.11, positions 737-1560 are folD containing point mutations T107A Gene fragment (corresponding to positions 1-824 of SEQ ID No. 4).

[0233] DNA fragment Up-folD T107A -Down (SEQ ID No.11) contains a mutation site for introducing a nucleic acid modification at position 107 of the folD gene coding region (SEQ ID No.1) of the recipient bacteria, specifically mutating the thymine (T) at position 107 of SEQ ID No.1 to adenine (A), ultimately resulting in a mutation of the leucine (L) at position 36 of the encoded protein pfolD (SEQ ID No.2) to glutamine (Q).

[0234] The above PCR amplification and overlap PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTPMixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0235] The above PCR amplification and overlap PCR amplification procedures were: 95°C pre-denaturation for 5 min, (98°C denaturation for 20 s; 56°C annealing for 15 s; 72°C extension for 60 s; 30 cycles), and 72°C over-extension for 5 min.

[0236] The primers were designed as follows (synthesized by Shanghai Invitrogen), and the bases in lowercase bold font are the mutation positions:

[0237] P1:

[0238] P2:

[0239] P3:

[0240] P4: 5'-GTGTTTTCAATCAGCGTGGC-3'.

[0241] 3. Preparation and transformation of competent cells

[0242] The pREDCas9 plasmid (containing the spectinomycin resistance gene) was transformed into the competent cells of L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402 and L-valine-producing bacteria CGMCC22721, respectively, and spread on 2-YT agar plates containing spectinomycin (100 mg / L) and cultured at 32°C. Single colonies resistant to spectinomycin (100 mg / L) were selected and identified by PCR using primers pRedCas9-PF, primers pRedCas9-PR and r Taq polymerase. The colonies with 943 bp were obtained as positive transformants containing the pREDCas9 plasmid (i.e., recombinant bacteria L-threonine CGMCC25404-Cas9, recombinant bacteria L-tryptophan CGMCC25403-Cas9, recombinant bacteria L-arginine CGMCC25402-Cas9 and recombinant bacteria L-valine CGMCC22721-Cas9).

[0243] Prepare recombinant L-threonine CGMCC25404-Cas9, L-tryptophan CGMCC25403-Cas9, L-arginine CGMCC25402-Cas9 and L-valine CGMCC22721-Cas9 competent cells. When the cells grow to OD 600 =0.1Add IPTG at a final concentration of 0.1 mM to induce λ-Red-mediated homologous recombination. 600 When ρ = 0.6, the bacteria were collected to prepare 4 types of competent cells containing pREDCas9 plasmid.

[0244] The sgRNA plasmid containing the target sequence (pGRB-sgRNA-1) prepared in step 1 of this example and the point mutation recombinant DNA fragment (Up-folD T107A-Down, SEQ ID No.11) were transformed into the above four competent cells containing pREDCas9 plasmids, and the transformed cells were spread on 2-YT agar plates containing spectinomycin (100 mg / L) and ampicillin (100 mg / L) and cultured at 32°C to obtain transformants. The transformants were identified by PCR using primers P5, P6 and r Taq polymerase, and the obtained 420 bp PCR product was denatured at 95°C for 10 min and ice-bathed for 5 min before SSCP (Single-Strand Conformation Polymorphis) electrophoresis (Up-fold T107A -Down amplified PCR fragment was used as the positive control, W3110 amplified PCR fragment was used as the negative control, and water was used as the blank control). Due to the different fragment structures and electrophoretic positions, the strain whose electrophoretic position of the PCR fragment was inconsistent with that of the negative control fragment but consistent with that of the positive control fragment was the strain with successful allelic replacement (i.e., positive recombinant).

[0245] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0246] P5: 5'-CAGCGACGGTGCCGCCTCACC-3',

[0247] P6: 5'-ATGCCATCGATGGTGTTGTC-3',

[0248] pRedCas9-PF: 5'-GCAGTGGCGGTTTTCATG-3',

[0249] pRedCas9-PR: 5'-CCTTGGTGATCTCGCCTTTC-3'.

[0250] PCR amplification system: 2×Premix r Taq 12.5 μL, primers (10 pM) 1 μL each, supplemented with ddH2O, total volume 25 μL.

[0251] PCR amplification program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s; 56°C annealing for 30 s; 72°C extension for 90 s (30 cycles), 72°C over-extension for 10 min.

[0252] Preparation and electrophoresis conditions of SSCP electrophoresis PAGE: 8 mL of 40% acrylamide, 4 mL of glycerol, 2 mL of 10×TBE, 40 μL of TEMED, 600 μL of 10% APS, and 26 mL of ddH2O; place the electrophoresis tank in ice and perform electrophoresis in 1×TBE buffer at a voltage of 120 V for 10 h.

[0253] The transformants with successful point mutation (positive recombinants) were inoculated in 2-YT medium containing spectinomycin (100 mg / L) and 2-YT medium containing arabinose with a final concentration of 0.2% to eliminate the plasmid pGRB-sgRNA-1, and the colonies that grew on the medium containing spectinomycin (100 mg / L) but did not grow on the medium containing ampicillin (100 mg / L) were selected, which were the recombinant bacteria that eliminated the plasmid pGRB-sgRNA-1. These colonies were then transferred to 2-YT medium and cultured at 42°C to eliminate the pREDCas9 plasmid. The colonies that did not grow on the medium containing spectinomycin (100 mg / L) but grew on the 2-YT medium without resistance were selected, which were the recombinant bacteria that eliminated the pRedCas9 plasmid.

[0254] The positive recombinants after plasmid elimination were again amplified by PCR with primers P5 / P6 to obtain the sequence containing the point mutation and sequenced. The sequencing results were compared with the genome sequence of Escherichia coli W3110, and it was determined that the mutation of the 107th base T of the folD gene to the base A was the gene mutant folD T107A Positive transformants. T107A The L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402 and L-valine-producing bacteria CGMCC22721 were named recombinant bacteria YPThr-folD-001, recombinant bacteria YPTrp-folD-001, recombinant bacteria YPR-folD-001 and recombinant bacteria YPV-folD-001, respectively.

[0255] The recombinant bacteria YPThr-folD-001, YPTrp-folD-001, YPR-folD-001 and YPV-folD-001 all contain the folD shown in SEQ ID No.4 T107A Gene.

[0256] The sgRNA plasmid in this embodiment (i.e., the recombinant vector pGRB-sgRNA-1) contains the folD gene editing target (5'-cacaaatatagacctgaag-3'). After being introduced into the recipient bacteria, the guide RNA is transcribed to form a complex with the Cas9 protein (expressed by the pREDCas9 plasmid), and the folD gene target is recognized through base complementary pairing and PAM sequence. The Cas9 protein will cause the DNA double strands upstream and downstream of the folD gene to break. On this basis, a repair template (donor DNA molecule, which is the DNA molecule shown in SEQ ID No. 11 in the present invention) is introduced into the recipient bacteria. The recipient bacteria will use its own DNA damage repair response mechanism according to the provided template to introduce site-directed mutations during the repair process to achieve point mutations in the folD gene, that is, the 107th thymine (T) in the nucleotide sequence of the folD gene (SEQ ID No. 1) is mutated to adenine (A).

[0257] Example 3: Construction of a genome-wide overexpression of a bifunctional methylenetetrahydrofolate dehydrogenase folD gene or folD T107A Genetically engineered strains

[0258] To further study and verify the overexpression of folD gene or folD in production bacteria T107A In this example, the pseudogene yaiT on the genome of Escherichia coli W3110 was used as the integration site of the foreign gene (the integration of this site does not change the biological properties of Escherichia coli) to construct a strain overexpressing the folD gene or folD T107A Genetically engineered strains (recombinant bacteria).

[0259] Based on the Escherichia coli W3110 genome sequence published by NCBI, the wild-type folD gene and the mutant folD gene were respectively integrated into the yaiT gene coding region of L-threonine-producing strain CGMCC25404, L-tryptophan-producing strain CGMCC25403, L-arginine-producing strain CGMCC25402 and L-valine-producing strain CGMCC22721 using CRISPR / Cas9 gene editing technology (sequencing confirmed that the wild-type yaiT gene and folD gene were retained on the chromosomes of these amino acid-producing strains). T107A gene, in order to further study the folD gene and mutant folD in high-yield strains T107A The effect of genes on the synthesis of L-amino acids such as L-threonine, L-tryptophan, L-valine and L-arginine.

[0260] 1. Construction of sgRNA plasmid

[0261] According to the Escherichia coli W3110 genome sequence published by NCBI, sgRNA target sequences were designed using CRISPRRGEN Tools (http: / / www.rgenome.net / cas-designer / ). After selecting the appropriate sgRNA target sequence, the linearized pGRB cloning vector end sequence was added to the 5' and 3' ends of the target sequence to form a complete sgRNA plasmid through recombination.

[0262] To amplify the DNA fragment containing the sgRNA target sequence, no template is required, only the PCR annealing process is required. The system and procedure are as follows. PCR reaction system: sgRNA-2F 10μL, sgRNA-2R 10μL; PCR reaction procedure: 95℃ denaturation for 5min, 50℃ annealing for 1min. After annealing, the target fragment (DNA fragment containing the sgRNA target sequence) was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100ng / μL.

[0263] pGRB plasmid was digested with Spe I to obtain linearized pGRB plasmid, and then dephosphorylated to prevent pGRB plasmid from self-ligation. Enzyme digestion system: 10×Buffer 5μL, SpeⅠ2.5μL, pGRB plasmid DNA 3000-5000ng, supplemented with ddH2O to 50μL. After 37℃ digestion for 3h, agarose gel electrophoresis was performed to cut the gel and then dephosphorylated. Dephosphorylation system: 10×Buffer 5μL, linearized pGRB plasmid DNA 1000-2000ng, CIAP 2.5μL, supplemented with ddH2O to 50μL. After 37℃ treatment for 1h, the linearized pGRB plasmid was recovered using a DNA purification kit.

[0264] The DNA fragment containing the sgRNA target sequence was connected to the linearized pGRB plasmid by homologous recombination using the Gibson Assembly Kit (New England). Recombination system: 2.5 μL of NEB assembly enzyme, 2 μL of linearized pGRB plasmid, and 0.5 μL of DNA fragment containing the sgRNA target sequence. After assembling at 50°C for 30 minutes, the product was transformed into DH5α competent cells, the plasmid was extracted, and sequencing was performed using sequencing primers sgRNA-PF / sgRNA-PR. The constructed sgRNA plasmid was named pGRB-sgRNA-2.

[0265] The primers used in this experiment were designed as follows (synthesized by Shanghai Invitrogen). The underlined bases are the homology arm sequences of the pGRB cloning vector, and the bases in lowercase are the sgRNA target sequences:

[0266] Primer sgRNA-2F:

[0267] 5'- TGACAGCTAGCTCAGTCCTAGGTATAATACTAGT ggcaactatgtaaactatag GTTTTAGAGCT AGAAATAGCAAGTTAAAATAAGG -3',

[0268] Primer sgRNA-2R:

[0269] 5'- CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC ctatagtttacatagttgcc ACTAGTATTAT ACCTAGGACTGAGCTAGCTGTCA -3',

[0270] Primer sgRNA-PF: 5'-GTCTCATGAGCGGATACATATTTG-3',

[0271] Primer sgRNA-PR: 5′-ATGAGAAAGCGCCACGCT-3′.

[0272] 2. PCR amplification of genomic overexpressed DNA sequences

[0273] Based on the Escherichia coli W3110 genome sequence published by NCBI, four pairs of upstream and downstream homology arm sequences and folD or folD were designed and synthesized. T107A Primers for the gene coding region and promoter region were used to introduce folD gene or folD into the yaiT gene coding region of L-amino acid producing bacteria by CRISPR / Cas9 gene editing. T107A Gene.

[0274] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0275] P7: 5'-AAGAGAATGGAAGAGAGGCC-3',

[0276] P8: 5'-TATAAAAAGAATTTTCAGCCCCCAATCAAGTGCTGTAACG-3',

[0277] P9: 5'-CGTTACAGCACTTGATTGGGGGCTGAAAATTCTTTTTATA-3',

[0278] P10: 5'-ACCGTCAATAATCTTTGCTGCCATCAGAGAGAGGATTCCA-3',

[0279] P11: 5'-TGGAATCCTCTCTCTGATGGCAGCAAAGATTATTGACGGT-3',

[0280] P12: 5'-CGGTAGTGTAGGTTTCGTTGTTACTCATCCTGTGGATCATG-3',

[0281] P13: 5'-CATGATCCACAGGATGAGTAACAACGAAACCTACACTACCG-3',

[0282] P14: 5'-CGACCTGTAGTATCCCATTC-3'.

[0283] Using Escherichia coli W3110 genomic DNA as a template, primers P7 / P8 and P13 / P14 were used with KAPA HiFi HotStart for PCR amplification to obtain an upstream homology arm fragment of 590 bp (positions 1-590 of SEQ ID No. 12) and a downstream homology arm fragment of 606 bp (positions 1673-2278 of SEQ ID No. 12); using Escherichia coli W3110 genomic DNA as a template, primers P9 / P10 and KAPA HiFi HotStart were used to PCR amplify a 300 bp folD gene promoter fragment (positions 551-850 of SEQ ID No. 12); using Escherichia coli W3110 genomic DNA and the plasmid pET28(a)-L36Q constructed in Example 1 as templates, primers P11 / P12 and KAPA HiFi HotStart were used to PCR amplify the folD gene (the sequence of the amplified product is positions 811-1713 of SEQ ID No. 12) and the folD T107A The gene (the amplified product sequence is 811-1713th position of SEQ ID No.13) is 903bp. After the PCR reaction is completed, the DNA is recovered by agarose gel electrophoresis using a column DNA gel recovery kit. The recovered DNA is amplified by overlap PCR using P7 and P14 as primers to obtain the genomic overexpressed DNA recombinant fragments Up-folD-Down (SEQ ID No.12) and Up-folD T107A -Down (SEQ ID No. 13) 2278 bp.

[0284] PCR amplification system: 5×HiFi with Mg 2+Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0285] PCR amplification program: pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 56°C for 15 s; extension at 72°C for 60 s; 30 cycles), over-extension at 72°C for 5 min.

[0286] 3. Preparation and transformation of competent cells

[0287] Prepare competent cells of recombinant bacteria containing pREDCas9 plasmids L-threonine CGMCC25404-Cas9, L-tryptophan CGMCC25403-Cas9, L-arginine CGMCC25402-Cas9, and L-valine CGMCC22721-Cas9. When the cells grow to OD 600 =0.1Add IPTG at a final concentration of 0.1 mM to induce λ-Red-mediated homologous recombination. 600 When ρ = 0.6, the bacteria were collected to prepare 4 types of competent cells containing pREDCas9 plasmid.

[0288] The sgRNA plasmid containing the target sequence (pGRB-sgRNA-2) prepared in step 1 of this example and the genomic overexpression DNA recombinant fragment Up-folD-Down (SEQ ID No. 12) prepared in step 2 were transformed into the above four competent cells containing pREDCas9 plasmids, and pGRB-sgRNA-2 and Up-folD T107A -Down (SEQ ID No.13) was transformed into the above four competent cells containing pREDCas9 plasmids, and the transformed bacteria were spread on 2-YT agar plates containing spectinomycin (100 mg / L) and ampicillin (100 mg / L) and cultured at 32°C. The single colonies produced by the culture were identified by PCR using primers P15, primers P16 and r Taq polymerase. The PCR amplified fragments containing 1312 bp were positive transformants, and the fragments that could not be amplified were original bacteria.

[0289] The positive transformants were inoculated in 2-YT medium containing spectinomycin (100 mg / L) and 2-YT medium containing arabinose with a final concentration of 0.2% to eliminate the plasmid pGRB-sgRNA-2, and the colonies that grew on the medium containing spectinomycin (100 mg / L) but did not grow on the medium containing ampicillin (100 mg / L) were selected, which were the recombinant bacteria that eliminated the plasmid pGRB-sgRNA-2. These colonies were then transferred to 2-YT medium and cultured at 42°C to eliminate the pREDCas9 plasmid, and the colonies that did not grow on the medium containing spectinomycin (100 mg / L) but grew on the 2-YT medium without resistance were selected, which were the recombinant bacteria that eliminated the pRedCas9 plasmid.

[0290] The recombinant bacteria after elimination of the plasmid were identified by PCR using primers P17 / P18 and r Taq polymerase. The positive transformants were those that amplified a fragment of 1749 bp in size, and the original bacteria were those that did not amplify the fragment.

[0291] The L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402, and L-valine-producing bacteria CGMCC22721 overexpressing the folD gene on the genome constructed above were named YPThr-folD-002 (without mutation point), YPTrp-folD-002 (without mutation point), YPR-folD-002 (without mutation point), and YPV-folD-002 (without mutation point), respectively;

[0292] The folD was overexpressed in the genome constructed above. T107A The L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402 and L-valine-producing bacteria CGMCC22721 containing the genes were named YPThr-folD-003 (including mutation point), YPTrp-folD-003 (including mutation point), YPR-folD-003 (including mutation point) and YPV-folD-003 (including mutation point), respectively.

[0293] The recombinant bacteria YPThr-folD-002, YPTrp-folD-002, YPR-folD-002 and YPV-folD-002 contain double copies of the folD gene shown in SEQ ID No. 1; specifically, the recombinant bacteria YPThr-folD-002, YPTrp-folD-002, YPR-folD-002 and YPV-folD-002 are obtained by replacing part of the coding region of the yaiT gene on the genome of Escherichia coli L-threonine producing bacteria CGMCC25404, L-tryptophan producing bacteria CGMCC25403, L-arginine producing bacteria CGMCC25402 and L-valine producing bacteria CGMCC22721 with the folD gene and its promoter, while keeping other nucleotides in the genome unchanged. The recombinant bacteria containing double copies of the folD gene can significantly and stably increase the expression level of the folD gene.

[0294] The recombinant bacteria YPThr-folD-003, YPTrp-folD-003, YPR-folD-003 and YPV-folD-003 contain the mutated folD shown in SEQ ID No.4 T107A Specifically, the recombinant bacteria YPThr-folD-003, YPTrp-folD-003, YPR-folD-003 and YPV-folD-003 are obtained by replacing part of the coding region of the yaiT gene on the genome of Escherichia coli L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402 and L-valine-producing bacteria CGMCC22721 with a mutant folD T107A The mutant folD was introduced into the recombinant bacterium. T107A The recombinant strain of the gene overexpressed folD T107A Genetically engineered strains (recombinant bacteria).

[0295] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0296] P15: 5'-GGGCGTTGGATTAAGTCTGT-3',

[0297] P16: 5'-GGATGGAAACCGTCCACGTC-3',

[0298] P17: 5'-GTCGCTTCACGCGATAAAATC-3',

[0299] P18: 5'-CCCACCCAGTAGATTCGGTC-3'.

[0300] PCR amplification system: 2×Premix r Taq 12.5 μL, primers (10 pM) 1 μL each, supplemented with ddH2O, total volume 25 μL.

[0301] PCR amplification program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s; 56°C annealing for 30 s; 72°C extension for 90 s (30 cycles), 72°C over-extension for 10 min.

[0302] The sgRNA plasmid (recombinant vector pGRB-sgRNA-2) in this example contains the pseudogene yaiT editing target (5'-ggcaactatgtaaactatag-3'). After being introduced into the recipient bacteria, the guide RNA is transcribed to form a complex with the Cas9 protein (expressed by the pREDCas9 plasmid), and the yaiT gene target is recognized by base complementary pairing and PAM sequence. The Cas9 protein will cause the DNA double strands upstream and downstream of the yaiT gene to break. On this basis, a repair template (donor DNA molecule, which is the DNA molecule shown in SEQ ID No. 12 or SEQ ID No. 13 in the present invention) is introduced into the recipient bacteria. The recipient bacteria will use its own DNA damage repair response mechanism according to the provided template to introduce the insertion of DNA fragments during the repair process to achieve gene replacement, that is, replace part of the coding region of the yaiT gene with the folD gene or folD T107A Gene.

[0303] Example 4: Construction of an engineered strain lacking the bifunctional methylenetetrahydrofolate dehydrogenase folD gene in the genome

[0304] Based on the Escherichia coli W3110 genome sequence published by NCBI, the folD gene of L-threonine-producing strains CGMCC25404, L-tryptophan-producing strains CGMCC25403, L-arginine-producing strains CGMCC25402 and L-valine-producing strains CGMCC22721 (sequencing confirmed that the wild-type folD gene was retained on the chromosomes of these amino acid-producing strains) was knocked out using CRISPR / Cas9 gene editing technology to further study the effect of the Escherichia coli folD gene on the synthesis of L-amino acids such as L-threonine, L-tryptophan, L-valine and L-arginine in high-yield strains.

[0305] 1. Construction of sgRNA

[0306] According to the Escherichia coli W3110 genome sequence published by NCBI, sgRNA target sequences were designed using CRISPRRGEN Tools (http: / / www.rgenome.net / cas-designer / ). After selecting the appropriate sgRNA target sequence, the linearized pGRB cloning vector homology arm sequences were added to the 5' and 3' ends of the target sequence to form a complete sgRNA plasmid through recombination.

[0307] Amplify the DNA fragment containing the sgRNA target sequence without template, only need to carry out PCR annealing process, the system and procedure are as follows: PCR reaction system: sgRNA-3F 10μL, sgRNA-3R 10μL; PCR reaction procedure: 95℃ denaturation 5min, 50℃ annealing 1min. After annealing, use DNA purification kit to recover the target fragment (DNA fragment containing sgRNA target sequence), determine its DNA concentration, and dilute the concentration to 100ng / μL.

[0308] pGRB plasmid was digested with Spe I to obtain linearized pGRB plasmid, and then dephosphorylated to prevent pGRB plasmid from self-ligation. Enzyme digestion system: 10×Buffer 5μL, Spe I 2.5μL, pGRB plasmid DNA 3000-5000ng, supplemented with ddH2O to 50μL. After 37℃ digestion for 3h, agarose gel electrophoresis was performed to cut the gel and then dephosphorylated. Dephosphorylation system: 10×Buffer 5μL, linearized pGRB plasmid DNA 1000-2000ng, CIAP 2.5μL, supplemented with ddH2O to 50μL. After 37℃ treatment for 1h, the linearized pGRB plasmid was recovered using a DNA purification kit.

[0309] The DNA fragment containing the sgRNA target sequence was connected to the linearized pGRB plasmid by homologous recombination using the Gibson Assembly Kit (New England). Recombination system: 2.5 μL of NEB assembly enzyme, 2 μL of linearized pGRB plasmid, and 0.5 μL of DNA fragment containing the sgRNA target sequence. After assembling at 50°C for 30 minutes, the product was transformed into DH5α competent cells, the plasmid was extracted, and sequencing was performed using sequencing primers sgRNA-PF / sgRNA-PR. The constructed sgRNA plasmid was named pGRB-sgRNA-3.

[0310] The primers used in this experiment were designed as follows (synthesized by Shanghai Invitrogen). The underlined bases are the homology arm sequences of the pGRB cloning vector, and the bases in lowercase are the sgRNA target sequences:

[0311] Primer sgRNA-3F:

[0312] 5'- TGACAGCTAGCTCAGTCCTAGGTATAATACTAGT tattcatccggacaaagacg GTTTTAGAGCT AGAAATAGCAAGTTAAAATAAGG -3',

[0313] Primer sgRNA-3R:

[0314] 5'- CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC cgtctttgtccggatgaata ACTAGTATTAT ACCTAGGACTGAGCTAGCTGTCA -3'',

[0315] Primer sgRNA-PF: 5'-GTCTCATGAGCGGATACATATTTG-3',

[0316] Primer sgRNA-PR: 5′-ATGAGAAAGCGCCACGCT-3′.

[0317] 2. PCR amplification of the missing DNA recombinant fragments in the genome

[0318] Based on the Escherichia coli W3110 genome sequence published by NCBI, two pairs of primers for amplifying upstream and downstream homology arm sequences were designed and synthesized, and the folD gene in the L-amino acid producing bacteria was knocked out by CRISPR / Cas9 gene editing.

[0319] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0320] P19: 5'-GAAGATGGCCCGCAAGGGAC-3',

[0321] P20: 5'-CAGATGGAATCCTCTCTCTGCATGGCGACATTTTCTTTAG-3',

[0322] P21: 5'-CTAAAGAAAATGTCGCCATGCAGAGAGAGGATTCCATCTG-3',

[0323] P22: 5'-GCGGATGTATTATCAAGTATTTC-3'.

[0324] Using E. coli W3110 genomic DNA as a template, primers P19 / P20 and P21 / P22 were used for PCR amplification with KAPA HiFiHotStart to obtain upstream homology arm and downstream homology arm fragments of 937 bp and 876 bp, respectively; after the PCR reaction, agarose gel electrophoresis was used to recover the DNA using a column DNA gel recovery kit. The recovered DNA was amplified by overlap PCR with primers P19 / P22 to obtain a recombinant DNA fragment ΔfolD-Up-Dwon (SEQ ID No.14) of 1773 bp lacking the folD gene in the genome.

[0325] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0326] PCR amplification program: pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 56°C for 15 s; extension at 72°C for 60 s; 30 cycles), over-extension at 72°C for 5 min.

[0327] 3. Preparation and transformation of competent cells

[0328] Prepare competent cells containing pREDCas9 plasmids for L-threonine CGMCC25404-Cas9, L-tryptophan CGMCC25403-Cas9, L-arginine CGMCC25402-Cas9, and L-valine CGMCC22721-Cas9. When the cells grow to OD 600 =0.1Add IPTG at a final concentration of 0.1 mM to induce λ-Red-mediated homologous recombination. 600 When ρ = 0.6, the bacteria were collected to prepare 4 types of competent cells containing pREDCas9 plasmid.

[0329] The sgRNA plasmid (pGRB-sgRNA-3) containing the target sequence prepared in step 1 of this example and the recombinant DNA fragment ΔfolD-Up-Dwon (SEQ ID No. 14) containing the folD gene deleted from the genome prepared in step 2 were transformed into the above four competent cells containing pREDCas9 plasmids, and the transformed bacteria were spread on 2-YT agar plates containing spectinomycin (100 mg / L) and ampicillin (100 mg / L) and cultured at 32°C. The single colonies produced by the culture were identified by PCR using primers P19, primers P22 and r Taq polymerase. The PCR amplified fragment containing a size of 1773 bp (SEQ ID No. 14) was a positive transformant, and the amplified fragment containing a size of 2640 bp was the original bacteria.

[0330] The positive transformants were inoculated in 2-YT medium containing spectinomycin (100 mg / L) and 2-YT medium containing a final concentration of 0.2% arabinose to eliminate the plasmid pGRB-sgRNA-3, and the colonies that grew on the medium containing spectinomycin (100 mg / L) but did not grow on the medium containing ampicillin (100 mg / L) were selected, which were the recombinant bacteria that eliminated the plasmid pGRB-sgRNA-3. These colonies were then transferred to 2-YT medium and cultured at 42°C to eliminate the pREDCas9 plasmid. The colonies that did not grow on the medium containing spectinomycin (100 mg / L) but grew on the 2-YT medium without resistance were selected, which were the recombinant bacteria that eliminated the pRedCas9 plasmid.

[0331] The recombinant bacteria after elimination of the plasmid were again identified by PCR using primers P19 / P22 and r Taq polymerase. The positive transformants were those containing 1773 bp (SEQ ID No. 14) amplified by PCR.

[0332] The positive transformants lacking the folD gene in the genomes of the above-constructed L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402 and L-valine-producing bacteria CGMCC22721 were named YPThr-folD-004, YPTrp-folD-004, YPR-folD-004 and YPV-folD-004, respectively.

[0333] PCR amplification system: 2×Premix r Taq 12.5 μL, primers (10 pM) 1 μL each, supplemented with ddH2O, total volume 25 μL.

[0334] PCR amplification program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s; 56°C annealing for 30 s; 72°C extension for 90 s (30 cycles), 72°C over-extension for 10 min.

[0335] Example 5: Construction of plasmids to overexpress bifunctional methylenetetrahydrofolate dehydrogenase folD gene or folD T107A Genetically engineered strains

[0336] In this example, the plasmid carrying the exogenous gene is expressed outside the chromosome to construct a plasmid overexpressing the folD gene or folD T107A Genetically engineered strains (recombinant bacteria).

[0337] Based on the Escherichia coli W3110 genome sequence published by NCBI, the wild-type folD gene and the mutant folD gene were expressed in Escherichia coli using the pET28(a) expression vector (purchased from TaKaRa, containing kanamycin resistance) and expressed in Escherichia coli. T107A The gene coding region and promoter region were introduced into L-threonine producing strain CGMCC25404, L-tryptophan producing strain CGMCC25403, L-arginine producing strain CGMCC25402 and L-valine producing strain CGMCC 22721 (sequencing confirmed that the wild-type folD gene was retained on the chromosomes of these amino acid producing strains), so as to further study the multi-copy folD gene and mutant folD in high-yielding strains. T107A Effects of genes on the production of L-amino acids such as L-threonine, L-tryptophan, L-valine and L-arginine.

[0338] Prepare L-threonine CGMCC25404, L-tryptophan CGMCC25403, L-arginine CGMCC25402, and L-valine CGMCC22721 competent cells. 600 When ρ = 0.6, the bacteria were collected to prepare 4 types of competent cells.

[0339] The plasmid pET28(a)-folD constructed in step 1 of Example 1 and the plasmid pET28(a)-L36Q constructed in step 2 of Example 1 were transformed into the above four competent cells, and the transformed bacteria were spread on 2-YT agar plates containing kanamycin (50 mg / L) and cultured at 37° C. The single colonies produced by the culture were identified by PCR using primers T7F / T7R and r Taq polymerase. The PCR amplified fragments containing 1147 bp in size were positive transformants, and the fragments that could not be amplified were original bacteria.

[0340] PCR amplification system: 2×Premix r Taq 12.5 μL, primers (10 pM) 1 μL each, supplemented with ddH2O, total volume 25 μL.

[0341] PCR amplification program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s; 56°C annealing for 30 s; 72°C extension for 90 s (30 cycles), 72°C over-extension for 10 min.

[0342] The L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402, and L-valine-producing bacteria CGMCC22721 overexpressing the folD gene on the above-constructed plasmids were named YPThr-folD-005 (without mutation point), YPTrp-folD-005 (without mutation point), YPR-folD-005 (without mutation point), and YPV-folD-005 (without mutation point), respectively;

[0343] The plasmid constructed above was used to overexpress folD T107A The L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402 and L-valine-producing bacteria CGMCC22721 containing the genes were named YPThr-folD-006 (including mutation point), YPTrp-folD-006 (including mutation point), YPR-folD-006 (including mutation point) and YPV-folD-006 (including mutation point), respectively.

[0344] The recombinant bacteria YPThr-folD-005, YPTrp-folD-005, YPR-folD-005 and YPV-folD-005 contain the folD gene shown in SEQID No.1, and are engineered bacteria that overexpress the wild-type folD gene on the plasmid, that is, the exogenous gene folD is overexpressed outside the chromosome by the plasmid pET28(a)-folD.

[0345] The recombinant bacteria YPThr-folD-006, YPTrp-folD-006, YPR-folD-006 and YPV-folD-006 contain the mutant folD shown in SEQ ID No.4 T107A Gene, for overexpression of mutant folD on plasmid T107A Genetically engineered bacteria, i.e., plasmid pET28(a)-L36Q carrying the exogenous gene folD T107A Overexpressed extrachromosomally.

[0346] Example 6, L-amino acid fermentation experiment

[0347] 1. L-threonine fermentation experiment

[0348] The Escherichia coli W3110 strain, the recombinant bacteria W3110-pET28 (a) -L36Q (i.e., the W3110-folD mutant 2 screened by random mutation in step 2 of Example 1), the Escherichia coli CGMCC25404 strain, and the recombinant bacteria YPThr-folD-001, YPThr-folD-002, YPThr-folD-003, YPThr-folD-004, YPThr-folD-005 and YPThr-folD-006 were inoculated in a 5L fermenter of the BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.) and the fermentation experiment was carried out using L-threonine fermentation medium and culture conditions, and each strain was repeated three times. Among them, YPThr-folD-005 and YPThr-folD-006 are engineered strains overexpressed on plasmids, and IPTG induction is required during the fermentation process. The specific induction method is shown in Example 1. After the fermentation, the L-threonine content was detected by high performance liquid chromatography (HPLC), and the results were taken as the average of three repetitions, as shown in Table 4.

[0349] L-threonine fermentation medium: the solvent is water, the solutes and their concentrations are glucose 13 g / L, (NH4)2SO4 1 g / L, H3PO4 0.5 g / L, KCl 0.8 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.01 g / L, MnSO4·H2O 0.01 g / L, FM902 yeast powder 1.5 g / L, corn syrup 5 g / L, molasses 17 g / L, and ammonia is added to adjust the pH to 7.0.

[0350] L-Threonine fermentation conditions:

[0351] Calibration DO 100%: temperature 37℃, air volume 5L / min, speed 800rpm, tank pressure 0Mpa, calibration after 5min;

[0352] Inoculation amount 10%;

[0353] Initial conditions: pH 7.0, culture temperature 37°C, tank pressure 0 MPa, air volume 0.5 L / min, rotation speed 400 rpm;

[0354] Full process control: 1. When dissolved oxygen is less than 30%, the rotation speed is increased in sequence: 500rpm→600rpm→air volume 1L / min→700rpm→800rpm; 2. After 8h of fermentation, the tank pressure is increased by 0.01Mpa; after 12h of fermentation, the tank pressure is increased by 0.02Mpa→0.03Mpa→0.04Mpa→0.05Mpa;

[0355] Residual sugar control: 0.1%-0.5% before F12h; after F12h, the residual sugar should be controlled at 0.1%-0.3% in combination with DO requirements;

[0356] Feed materials: 25% ammonia water, 55% concentrated sugar, 10% sodium bicarbonate;

[0357] Fermentation cycle: about 30 hours, the control process uses 20%-30% dissolved oxygen as the standard for increasing and decreasing air volume.

[0358] Table 4 L-threonic acid production of folD genetically engineered strains

[0359]

[0360] The above fermentation results show that, for both the high-yield L-threonine strain and the model strain W3110, the replacement of leucine at position 36 of the amino acid sequence of the folD gene with glutamine is conducive to the increase of L-threonine production; for the high-yield L-threonine strain, the wild-type folD gene and the mutant folD T107A Overexpression of the gene is conducive to the increase of L-threonine production, while knocking out the folD gene is not conducive to the increase of L-threonine production.

[0361] 2. L-Tryptophan Fermentation Experiment

[0362] Escherichia coli W3110 strain, recombinant bacteria W3110-pET28 (a) -L36Q, Escherichia coli CGMCC25403 strain and recombinant bacteria YPtrp-folD-001, YPtrp-folD-002, YPtrp-folD-003, YPtrp-folD-004, YPtrp-folD-005 and YPtrp-folD-006 were inoculated in a 5L fermenter of BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.) with L-tryptophan fermentation medium and culture conditions for fermentation experiments, and each strain was repeated three times. Among them, YPtrp-folD-005 and YPtrp-folD-006 are engineered strains overexpressed on plasmids, and IPTG induction is required during the fermentation process. The specific induction method is shown in Example 1. After the fermentation was completed, the L-tryptophan content was detected by high performance liquid chromatography (HPLC), and the results were taken as the average of three replicates, as shown in Table 5.

[0363] L-tryptophan fermentation medium: the solvent is water, the solutes and their concentrations are glucose 7g / L, FM902 yeast powder 1g / L, (NH4)2SO4 1.2g / L, citric acid 1.2g / L, MgSO4·7H2O 1.5g / L, K2HPO4·3H2O 5.5g / L, defoaming agent 0.2mL / L, and ammonia is added to adjust the pH to 7.0.

[0364] L-Tryptophan Culture Conditions:

[0365] Calibration DO 100%: temperature 35°C, speed 800rpm, air volume 5L / min, tank pressure 0.00Mpa;

[0366] Inoculation amount 10%;

[0367] Initial conditions: temperature 35°C, pH 7.0, air volume 1.0 L / min, rotation speed 350 rpm;

[0368] Full-process control: when dissolved oxygen is ≤20% before the end of the basal sugar, increase the speed in sequence → 400rpm → 450rpm; when the basal sugar is consumed, add sugar to control the dissolved oxygen at 15%-30%; the pH value is 7.0 before F24 hours and 6.7 after F24 hours;

[0369] Residual sugar control: 0.1%-0.5% before F12h; after F12h, the residual sugar should be controlled at 0.1%-0.3% in combination with DO requirements;

[0370] Feed materials: 25% ammonia water, 55% concentrated sugar, 10% sodium bicarbonate;

[0371] Fermentation cycle: about 34 hours, the control process uses 15%-30% dissolved oxygen as the standard for increasing and decreasing air volume.

[0372] Table 5 L-tryptophan production of folD genetically engineered strains

[0373]

[0374] The above fermentation results show that, for both the high-L-tryptophan-producing strain and the model strain W3110, the replacement of leucine at position 36 of the amino acid sequence of the folD gene with glutamine is conducive to the increase of L-tryptophan production. T107A Overexpression of the gene is conducive to the increase of L-tryptophan production, while knocking out the folD gene is not conducive to the increase of L-tryptophan production.

[0375] 3. L-arginine fermentation experiment

[0376] Escherichia coli W3110 strain, recombinant bacteria W3110-pET28 (a) -L36Q, Escherichia coli CGMCC25402 strain and recombinant bacteria YPR-folD-001, YPR-folD-002, YPR-folD-003, YPR-folD-004, YPR-folD-005 and YPR-folD-006 were inoculated in a 5L fermenter of BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.) with L-arginine fermentation medium and culture conditions for fermentation experiments, and each strain was repeated three times. Among them, YPR-folD-005 and YPR-folD-006 are engineered strains overexpressed on plasmids, and IPTG induction is required during the fermentation process. The specific induction method is shown in Example 1. After the fermentation was completed, the L-arginine content was detected by high performance liquid chromatography (HPLC), and the results were taken as the average of three replicates, as shown in Table 6.

[0377] L-arginine fermentation medium: the solvent is water, the solutes and their concentrations are glucose 8g / L, FM902 yeast powder 3g / L, K2HPO4·3H2O 6g / L, MgSO4·7H2O 1g / L, FeSO4·7H2O 0.05g / L, betaine 0.5g / L, VB 12 0.005g / L, defoamer 0.3mL / L, ammonium sulfate 3g / L, pH 7.2.

[0378] L-arginine fermentation culture conditions: Corrected DO 100%: temperature 35°C, pH 7.2, rotation speed 100rpm, air volume 6L / min, tank pressure 0.00Mpa;

[0379] Inoculation amount 10%;

[0380] Initial conditions: temperature 35°C, pH 7.2, tank pressure 0.01mpa, air volume 1.5L / min, rotation speed 350rpm;

[0381] Full process control: control DO at 20%-30%; when dissolved oxygen ≤25%, increase the speed each time: 300rpm→400rpm→2.0L / min→500rpm→0.02Mpa→600rpm→3.0L / min→0.03Mpa→700rpm→3.5L / min→0.04Mpa→800rpm→900rpm→4.0L / min→0.05Mpa→1000rpm;

[0382] Residual sugar control: The residual sugar is controlled at 0.05%-0.1% throughout the process;

[0383] Feed materials: 25% ammonia water, 80% concentrated sugar, 10% sodium bicarbonate;

[0384] Fermentation cycle: about 50h, the control process uses 20%-30% dissolved oxygen as the standard for increasing and decreasing air volume.

[0385] Table 6 L-arginine production of folD genetically engineered strains

[0386]

[0387] The above fermentation results show that, for both the high-yield L-arginine strain and the model strain W3110, the replacement of leucine at position 36 of the amino acid sequence of the folD gene with glutamine is conducive to the increase of L-arginine production; for the high-yield L-arginine strain, the wild-type folD gene and the mutant folD T107A Overexpression of the gene is conducive to the increase of L-arginine production, while knocking out the folD gene is not conducive to the increase of L-arginine production.

[0388] IV. L-valine fermentation experiment

[0389] Escherichia coli W3110 strain, recombinant bacteria W3110-pET28 (a) -L36Q, Escherichia coli CGMCC22721 strain and recombinant bacteria YPV-folD-001, YPV-folD-002, YPV-folD-003, YPV-folD-004, YPV-folD-005 and YPV-folD-006 were inoculated in a 5L fermenter of BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.) with L-arginine fermentation medium and culture conditions for fermentation experiments, and each strain was repeated three times. Among them, YPV-folD-005 and YPV-folD-006 are engineered strains overexpressed on plasmids, and IPTG induction is required during the fermentation process. The specific induction method is shown in Example 1. After the fermentation was completed, the L-valine content was detected by high performance liquid chromatography (HPLC), and the results were taken as the average of three replicates, as shown in Table 7.

[0390] L-valine fermentation medium: the solvent is water, the solutes and their concentrations are yeast extract powder 4g / L, corn steep liquor powder 2g / L, peptone 4g / L, methionine 2g / L, KH2PO4·3H2O 7g / L, MgSO4·7H2O 2g / L, CoCl2 20mg / L, (NH4)2SO43g / L, citric acid 2g / L, FeSO4·7H2O 50mg / L, MnSO4·7H2O 30mg / L, VH 20mg / L, VB1 1.5mg / L, VB3 1.5mg / L VB 12 1.5g / L, defoamer 0.3mL / L, (NH4)2SO4 3g / L, pH 7.0.

[0391] L-valine fermentation culture conditions: Dissolved oxygen electrode calibration method: calibrate the zero point in saturated sodium sulfite solution and calibrate the hundred point in air;

[0392] L-valine fermentation includes two stages of aerobic-limited oxygen fermentation. The cells are first cultured under aerobic fermentation. The air volume, speed and sugar addition rate are adjusted in the early stage to control the dissolved oxygen at about 25%. 600 When the value reaches 50-60, the speed is reduced to 400rpm and the air volume is reduced to 2L / min; and the aerobic fermentation is converted to oxygen-limited fermentation.

[0393] Table 7 L-valine production of folD genetically engineered strains

[0394]

[0395] The above fermentation results show that, for both the high-yield L-valine strain and the model strain W3110, the replacement of leucine at position 36 of the amino acid sequence of the folD gene with glutamine is conducive to the increase of L-valine production; for the high-yield L-valine strain, the wild-type folD gene and the mutant folD T107A Overexpression of the gene is conducive to the increase of L-valine production, while knocking out the folD gene is not conducive to the increase of L-valine production.

[0396] In summary, the above fermentation results show that, for both the high-yield L-amino acid strain and the model strain W3110, the replacement of leucine at position 36 of the amino acid sequence of the folD gene with glutamine is conducive to the increase of the production of L-threonine, L-tryptophan, L-arginine and L-valine; for the high-yield L-amino acid strain, the wild-type folD gene and the mutant folD T107A Overexpression of the gene helps to increase the production of L-threonine, L-tryptophan, L-arginine and L-valine, while knocking out the folD gene is not conducive to increasing their production.

[0397] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of a protein in increasing the production of L-amino acids in Escherichia coli, wherein the amino acid sequence of the protein is shown in SEQ ID No. 5, and the L-amino acids are L-threonine, L-tryptophan, L-arginine and / or L-valine.

2. Use of a nucleic acid molecule in increasing the production of L-amino acids in Escherichia coli, wherein the nucleic acid molecule is any of the following: B1) a nucleic acid molecule encoding the protein according to claim 1; B2) The coding sequence is the DNA molecule shown in SEQ ID No. 4; B3) The nucleotide sequence is the DNA molecule shown in SEQ ID No. 4; The L-amino acid is L-threonine, L-tryptophan, L-arginine and / or L-valine.

3. Application of biological materials in increasing the yield of L-amino acids of microorganisms, wherein the biological materials are any of the following: C1) an expression cassette containing the nucleic acid molecule according to claim 2; C2) a recombinant vector containing the nucleic acid molecule of claim 2, or a recombinant vector containing the expression cassette of C1); C3) a recombinant microorganism containing the nucleic acid molecule of claim 2, or a recombinant microorganism containing the expression cassette of C1), or a recombinant microorganism containing the recombinant vector of C2); C4) a recombinant cell containing the nucleic acid molecule of claim 2, or a recombinant cell containing the expression cassette of C1), or a recombinant cell containing the recombinant vector of C2); The L-amino acid is L-threonine, L-tryptophan, L-arginine and / or L-valine; The microorganism is Escherichia coli.

4. A method for increasing the yield of L-amino acids in microorganisms, characterized in that: The method comprises any of the following: E1) increasing the expression level or content of the nucleic acid molecule of claim 2 in a target microorganism to obtain a microorganism having a higher L-amino acid production than the target microorganism; E2) mutating the DNA molecule having the nucleotide sequence of SEQ ID No. 1 in the target microorganism to obtain a microorganism having a higher L-amino acid production than the target microorganism, wherein the mutation is to mutate the leucine residue at position 36 of the amino acid sequence encoded by the DNA molecule shown in SEQ ID No. 1 into a glutamine residue; The L-amino acid is L-threonine, L-tryptophan, L-arginine and / or L-valine; The microorganism is Escherichia coli.

5. The method according to claim 4, characterized in that The mutation is to mutate the nucleotide T at position 107 in the DNA molecule shown in SEQ ID No.1 to A.

6. A method for preparing L-amino acids, characterized in that: The method comprises producing L-threonine, L-tryptophan, L-arginine and / or L-valine using the recombinant microorganism described in claim 3.

Images