High-expression recombinant vector, engineering bacteria and application of caspofungin B deacylase
By constructing a high-expression recombinant vector of echinocin B deacylase in Escherichia coli, using the screening of linking peptides and signal peptides to optimize the fermentation conditions, the problems of echinocin B deacylase activity and solubility were solved, and the efficient preparation of echinocin B parent nucleus compound was achieved, providing a new way for the synthesis of anifungin.
Patent Information
- Application Number
- CN202211302441.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-24
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2042-10-24
AI Technical Summary
In the prior art, the activity and solubleness of echinocin B deacylase in E. coli are not ideal, resulting in low biocatalytic preparation efficiency of echinocin B parent nucleus compound, and the gene operation of E. coli is complex and the fermentation cycle is long.
A highly expressed recombinant vector of echinocin B deacylase was used to transform Escherichia coli B deacylase by screening the peptide and signal peptide to construct a nucleic acid sequence containing promoter, RBS, MalE signal peptide, GGSGGGSG and Escherichia coli B deacylase α and β subunits through screening of linking peptides and signal peptides. The nucleic acid sequences containing promoters, RBS, MalE signal peptides, GGSGGGSG, and Escherichia coli B deacylase α and β subunits were constructed to transform Escherichia coli B L21 (DE3) host bacteria, and optimize the fermentation conditions for biocatalytic reactions.
The active expression level of echinocin B deacylase in Escherichia coli was improved, and the efficient preparation of echinocin B parent nucleus compound was achieved, providing a new pathway for the synthesis of anifungin, with an enzyme activity reaching 98.6U/g.
Smart Images

Figure CN115873883B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a high-expression recombinant vector and a genetically engineered bacterium of echinocandin B deacylase, and their application in the microbial catalytic preparation of the echinocandin B core compound. Background Art
[0002] In recent years, the problem of invasive fungal infections has become increasingly serious. The lethality rate of fungal infections in patients after surgery is high, especially for those with low immunity, which poses a serious challenge to global medical services. Currently, many antifungal drugs have been developed and used, such as polyenes, triazoles, flucytosine, etc. However, these drugs have disadvantages such as large toxic side effects, poor drug resistance, and low clinical efficacy. Echinocandin drugs, as the latest antifungal drugs, have advantages such as strong antibacterial activity, long half-life, and good patient tolerance. Among them, anidulafungin is a third-generation echinocandin drug, and the biocatalytic preparation of anidulafungin precursors has become a research hotspot for antifungal drugs at home and abroad.
[0003] The key rate-limiting step in the preparation of anidulafungin by the semi-synthetic method is the catalytic hydrolysis of the substrate echinocandin B (ECB) to the linoleoyl side chain using echinocandin B deacylase. However, there are still many problems in the deacylation process, mainly including low substrate solubility and low catalytic efficiency of ECB deacylase. Among them, ECB deacylase often has disadvantages such as low yield, high inclusion body content, and low activity in wild bacteria. In recent years, the heterologous expression hosts of echinocandin B deacylase have mainly been Streptomyces, such as Streptomyces lividans, Streptomyces coelicolor, etc. However, its gene molecular operation is very inconvenient, the available vectors and modification methods are limited, and its fermentation cycle and metabolic regulation are much more complex than those of Escherichia coli.
[0004] Circular permutation covalently connects the ends of natural proteins and introduces new ends through the cleavage of existing peptide bonds, which can perturb the local tertiary structure and protein dynamics and introduce possible quaternary structure changes. Similar to fusion expression, in the present invention, the β subunit and α subunit of echinocandin B deacylase are connected by a linker peptide, which is beneficial to efficient expression in Escherichia coli.
[0005] Patent document CN 113174398 A discloses an expression cassette and application for recombinant expression of echinocandin B deacylase in Escherichia coli. By adding two specific sequence solubilizing short peptides, echinocandin B deacylase can be effectively and highly expressed, and the enzyme activity can reach 57.88 U / g after the fermentation culture of the cells is disrupted.
[0006] After the introduction of the solubilizing short peptide, the active expression of echinocandin B deacylase in Escherichia coli was effectively improved. However, its activity and solubility were still not ideal. A large number of inclusion bodies aggregated in the periplasmic space, and the inactive protein even hindered the growth of Escherichia coli to a certain extent. Summary of the Invention
[0007] The object of the present invention is to overcome the deficiency of the low activity of ECB deacylase in the prior art, and to provide a high-expression recombinant vector and a genetically engineered bacterium of echinocandin B deacylase, as well as its application in the microbial catalysis for the preparation of the echinocandin B mother nucleus compound.
[0008] The technical solution adopted by the present invention is as follows:
[0009] A high-expression recombinant vector of echinocandin B deacylase mainly comprises a promoter nucleic acid sequence, an RBS nucleic acid sequence, a nucleic acid sequence encoding a MalE signal peptide, a nucleic acid sequence encoding the β subunit of echinocandin B deacylase, a nucleic acid sequence encoding a linker peptide GGSGGGSG, a nucleic acid sequence encoding the α subunit of echinocandin B deacylase, and a terminator, which are connected in sequence.
[0010] The nucleic acid sequence encoding the β subunit of echinocandin B deacylase is as shown in SEQ ID No.1, and the nucleic acid sequence encoding the α subunit of echinocandin B deacylase is as shown in SEQ ID No.2.
[0011] The nucleic acid sequence encoding the MalE signal peptide is as shown in SEQ ID No.5, and the nucleic acid sequence encoding the linker peptide GGSGGGSG is as shown in SEQ ID No.6.
[0012] The constructed vector comprises a promoter nucleic acid sequence as shown in SEQ ID No.4. The promoter can be a commonly used promoter and can be selected according to the host source to be expressed. For example, the T7 promoter can be selected in the host cells for prokaryotic expression.
[0013] The present invention also relates to a genetically engineered bacterium with high expression of echinocandin B deacylase, which is obtained by transforming a host bacterium with the recombinant vector. The genetically engineered bacterium is obtained by introducing the recombinant expression vector into the host bacterium. Preferably, for the genetically engineered bacterium, the host bacterium is Escherichia coli BL21 (DE3). The recombinant expression vector used is an expression vector for expression in Escherichia coli. For example, the commonly used pET28a(+) vector can be used, and of course, other vectors can also be used.
[0014] The present invention also relates to the application of the genetically engineered bacterium in the microbial catalysis for the preparation of anidulafungin intermediate - echinocandin B mother nucleus compound.
[0015] The involved reaction formula is as follows:
[0016]
[0017] Specifically, the application is as follows: Using caspofungin B as a reaction substrate, the wet cells of the genetically engineered bacterium as a biocatalyst, urea and choline chloride as cosolvents, and a potassium phosphate buffer solution with a pH of 7-8 as a reaction medium to form a reaction system, and performing a biocatalytic reaction at a temperature of 35-45 °C and a stirring speed of 500-800 r / min to obtain the caspofungin B core compound.
[0018] The wet cells are obtained by the following method: Inoculating the genetically engineered bacterium into TB medium, culturing at 35-37 °C and 150-200 rpm until the OD600 reaches 0.8, adding an inducer IPTG with a final concentration of 0.1-1 mM to the fermentation broth, transferring it to a shaker at 12-28 °C and 150-200 rpm for enzyme induction, centrifuging the obtained fermentation broth to collect the cell precipitate, which is the wet cells. The wet cells can be further washed twice with 0.1 mM PBS buffer and then resuspended. The cell suspension is diluted by an appropriate multiple and then the cells are lysed using an ultrasonic cell disruptor. After centrifuging the lysate, an intracellular crude enzyme solution is obtained.
[0019] Specifically, the addition concentration of the inducer IPTG is 0.2 mM. After adding the inducer, transfer it to a shaker at 16 °C and 180 rpm for enzyme induction for 16 h. Centrifuge the obtained fermentation broth to collect the cell precipitate, which is the wet cells.
[0020] The beneficial effects of the present invention are mainly reflected in: The present invention provides a high-expression recombinant vector of caspofungin B deacylase, which can improve the active expression level of caspofungin B deacylase in Escherichia coli. Through the screening of linker peptides and signal peptides, caspofungin B deacylase can be effectively and highly expressed, providing a new way for the synthesis of anidulafungin. Description of the Drawings
[0021] Figure 1 It is a graph showing the enzyme activity and biomass results after fusion expression with different linker peptides.
[0022] Figure 2 It is a graph showing the enzyme activity and biomass results after fusion expression with different signal peptides.
[0023] Figure 3 It is a graph showing the detection results of optimizing the inducer concentration of the expression strain.
[0024] Figure 4 It is a graph showing the detection results of optimizing the culture temperature of the expression strain.
[0025] Figure 5 It is a graph showing the detection results of optimizing the induction duration of the expression strain. Detailed Embodiments
[0026] The present invention will be further described in detail below in conjunction with specific embodiments, but the present invention is not limited to the following embodiments:
[0027] LB medium (g / L): Tryptone 10, Yeast extract 5, NaCl 10, pH 7.0;
[0028] TB medium (g / L): Tryptone 12, Yeast extract 24, Glycerol 5, Potassium dihydrogen phosphate 2.31, Dipotassium hydrogen phosphate 12.54, pH 7.0. Kanamycin was added to a final concentration of 50 μg / mL before inoculation.
[0029] Method for determining the enzyme activity of echinocandin B deacylase:
[0030] At 40 °C, the echinocandin B deacylase activity was determined in a total of 1 mL reaction mixture, which consisted of pH 7.0, 0.1 M potassium phosphate buffer and 0.2 g / L ECB. The reaction was carried out at 800 rpm for 30 minutes. After the reaction, centrifugation was used to terminate the reaction. Subsequently, a high performance liquid chromatograph was used to detect the product formation. One unit of echinocandin B deacylase activity (U) was defined as the amount of enzyme required to produce 1 μg of the echinocandin B parent nucleus per minute under the standard conditions of 40 °C and pH 7.0. The specific enzyme activity (U / g) was defined as the activity possessed by each gram of dry cells.
[0031] Example 1: Construction of recombinant strains BL21-CondonPlus(DE3) pG1, pG2, pG3, pY1, pY2, pY3, pE1, pE2
[0032] 1. Construction of recombinant plasmids containing different linker peptides
[0033] The nucleic acid sequences of the linker peptides are as follows:
[0034] G1 linker peptide (amino acid sequence GGSG): ggtggtagcggt
[0035] G2 linker peptide (amino acid sequence GGSGGGSG): ggtggtagcggtggtggtagcggt
[0036] G3 linker peptide (amino acid sequence GGSGGGSGGGSG):
[0037] ggtggtagcggtggtggtagcggtggtggtagcggt
[0038] Y1 linker peptide (amino acid sequence YDPS): tacgatccgagc
[0039] Y2 linker peptide (amino acid sequence YDPSYDPS): tacgatccgagctacgatccgagc
[0040] Y3 linker peptide (amino acid sequence YDPSYDPSYDPS):
[0041] tacgatccgagctacgatccgagctacgatccgagc
[0042] E1 linker peptide (amino acid sequence EAAAK): gaggccgctgcaaag
[0043] E2 linker peptide (amino acid sequence EAAAKEAAAK):
[0044] gaggccgctgcaaaggaggccgctgcaaag
[0045] The selected linker peptides were fused and expressed with the C-terminus of the β subunit and the N-terminus of the α subunit to construct recombinant plasmids containing different linker peptides.
[0046] 2. Construction of recombinant strains containing different linker peptides
[0047] The recombinant plasmids were transformed into competent Escherichia coli BL21-CondonPlus (DE3) cells. The transformed competent cells were spread on LB agar plates containing 50 μg / mL kanamycin resistance (LB solid medium plates) and cultured overnight at 37°C (for the preparation and transformation of Escherichia coli competent cells, refer to the Molecular Cloning Laboratory Manual).
[0048] (1) Pick the activated colonies into 100 mL of TB medium and culture at 37°C and 180 rpm for 2 h until the OD600 reaches 0.8; the composition of the medium is: 12 g / L of tryptone, 24 g / L of yeast extract, 5 g / L of glycerol, 2.31 g / L of potassium dihydrogen phosphate, and 12.54 g / L of dipotassium hydrogen phosphate.
[0049] (2) Add the inducer IPTG with a final concentration of 0.1 mM to the fermentation broth, transfer to a shaker at 16°C and 180 rpm for enzyme induction;
[0050] (3) Centrifuge the obtained fermentation broth to collect the cell precipitate. The precipitate was washed twice with 0.1 mM PBS buffer and then resuspended. The cell suspension was diluted by an appropriate multiple and then the cells were lysed using an ultrasonic cell disruptor. After centrifugation of the lysate, the crude intracellular enzyme solution was obtained.
[0051] 1. Sample treatment and detection
[0052] The fermented bacterial liquid was then placed in a 50 mL centrifuge tube and centrifuged at 4°C and 5000 rpm for 5 min. The supernatant was discarded and the bacterial cells were collected. The centrifuged bacterial cells were resuspended with an equal volume of 0.1 mM PBS and sonicated on ice. The cell suspension after sonication was centrifuged at 4°C and 8000 rpm for 10 min, and the centrifuged supernatant (the supernatant part of the sonicated cells) was collected.
[0053] At 40°C, the echinocandin B deacylase activity was measured in a total of 1 mL reaction mixture, which consisted of pH 7.0, 0.1 M potassium phosphate buffer and 0.2 g / L ECB. The reaction was carried out at 800 rpm for 30 minutes. After the reaction, centrifugation was performed to terminate the reaction. Subsequently, a high performance liquid chromatograph was used to detect the product formation. One unit of echinocandin B deacylase activity (U) was defined as the amount of enzyme required to produce 1 μg of the echinocandin B parent nucleus per minute under the standard conditions of 40°C and pH 7.0. The specific enzyme activity (U / g) was defined as the activity per gram of dry cells.
[0054] Then, the expression level of the recombinant protein was determined by detecting the activity of the bacterial cells, and the results were as Figure 1 shown. When the linker peptide was selected as GGSGGGSG (the nucleotide sequence of the recombinant plasmid was as shown in SEQ ID No. 3), the activity of the bacterial cells increased significantly. It was speculated that selecting a circular permutation form vector with a linker peptide of appropriate length and rigidity could improve the correct assembly efficiency of the large and small subunits.
[0055] Example 2: Construction of recombinant strains pOmpA, pMalE, pCusF, pPhoA
[0056] 1. Construction of vectors containing different signal peptides
[0057] The nucleic acid sequence of the signal peptide was as follows:
[0058] OmpA signal peptide:
[0059] ATGAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCGCAGGCC
[0060] CusF signal peptide:
[0061] atgaaaaaagcactgcaagtcgcaatgttcagtctgtttaccgttattggctttaatgcccaggct
[0062] MalE signal peptide:
[0063] atgaaaataaaaacaggtgcacgcatcctcgcattatccgcattaacgacgatgatgttttccgcctcggctctcgcc
[0064] PhoA signal peptide:
[0065] atgaaacaaagcactattgcactggcactcttaccgttactgtttacccctgtgacaaaagcc
[0066] Fusion expression of the selected signal peptide and ECB deacylase was carried out and introduced into competent cells BL21-CondonPlus (DE3) for spread culture. Pick the activated colonies into 100 mL of TB medium and culture at 37 °C and 180 rpm for 2 h until the OD600 reaches 0.8. Add the inducer IPTG with a final concentration of 0.1 mM to the fermentation broth, transfer to a shaker at 16 °C and 180 rpm for enzyme induction. The obtained fermentation broth was centrifuged to collect the cell precipitate, and the precipitate was washed twice with 0.1 mM PBS buffer and then resuspended. The cell suspension was diluted by an appropriate multiple and then the cells were lysed using an ultrasonic disruptor. After centrifugation of the lysate, the crude intracellular enzyme solution was obtained.
[0067] 2. Sample treatment and detection
[0068] Refer to the sample treatment and detection methods in Example 1 to collect, process and detect the samples.
[0069] The results are as Figure 2 shown. When the signal peptide MalE was selected, the cell activity increased significantly, reaching 98.6 U / g. Compared with other signal peptides, MalE has a stronger hydrophobic core and a larger number of strongly hydrophobic amino acid leucines in the middle of the structure. This may contribute to the mutual recognition of MalE and the inner membrane transport protein of the cell or make it easier to bind to the phospholipid layer, enabling the echinocandin B deacylase to enter the periplasmic space more easily.
[0070] Example 3: Optimization of fermentation conditions of recombinant strains
[0071] 1. Optimization of inducer concentration of recombinant strains
[0072] IPTG (isopropyl-β-D-thiogalactoside) is an analogue of the substrate of β-galactosidase and is a commonly used inducer. However, the concentration of IPTG is not the higher the better. Therefore, the optimization of the inducer concentration was carried out in the range of 0.1 mM - 1 mM, and the results are as Figure 3As shown in the figure, when the IPTG concentration exceeds 0.6 mM, the biomass decreases with the increase of concentration, indicating that this inducer concentration has a certain growth inhibitory effect on cells; when the concentration exceeds 0.2 mM, the enzyme activity decreases with the increase of IPTG concentration. Therefore, 0.2 mM was finally selected as the optimal inducer concentration for inducing E. coli.
[0073] 2. Optimization of culture temperature for recombinant strains
[0074] The induction temperature was optimized in the range of 12-28°C. Figure 4 As shown in the figure, with the continuous increase of induction temperature, the biomass also increased, and the enzyme activity first increased and then decreased. It reached the highest when the induction temperature was 16°C, and when the induction temperature was increased to 24°C, the target protein completely lost its activity. This may be because the target protein did not have time to fold correctly at this temperature and could only exist in the form of inclusion bodies. Therefore, 16°C was finally decided as the optimal induction temperature.
[0075] 3. Optimization of induction time of recombinant strains
[0076] The target protein is induced to express under the action of the inducer IPTG. Increasing the induction time helps to fully utilize the nutrients in the culture medium and fully express the target protein. However, if the induction time is too long, the cells will gradually die and the target protein will be greatly lost. Figure 5 As shown in the figure, the biomass increased with the increase of induction time, but when the induction time exceeded 20 h, the biomass stopped increasing and even began to decrease, while the enzyme activity reached the highest level after 16 h of induction. Considering the enzyme activity and biomass, 16 h was finally selected as the optimal induction time.
[0077] 4. Sample processing and testing
[0078] Refer to the sample processing and detection method in Example 1 to collect, process and detect samples.
[0079] The results showed that under the optimized induction conditions, the bacterial activity of echinocandin B deacylase reached 98.6U / g.
[0080] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.
Claims
1. A high-expression recombinant vector of echinocandin B deacylase, mainly comprising a promoter nucleic acid sequence, an RBS nucleic acid sequence, a nucleic acid sequence encoding MalE signal peptide, a nucleic acid sequence encoding the β subunit of echinocandin B deacylase, a nucleic acid sequence encoding a linker peptide GGSGGGSG, a nucleic acid sequence encoding the α subunit of echinocandin B deacylase, and a terminator, which are sequentially linked; the nucleic acid sequence encoding the β subunit of echinocandin B deacylase is as shown in SEQ ID No.1, and the nucleic acid sequence encoding the α subunit of echinocandin B deacylase is as shown in SEQ ID No.
2.
2. The recombinant vector according to claim 1, characterized in that The nucleic acid sequence encoding MalE signal peptide is as shown in SEQ ID No.5, and the nucleic acid sequence encoding the linker peptide GGSGGGSG is as shown in SEQ ID No.
6.
3. A high-expression genetically engineered bacterium of echinocandin B deacylase, obtained by transforming Escherichia coli with the recombinant vector described in claim 1.
4. The genetically engineered bacterium according to claim 3, characterized in that The Escherichia coli is Escherichia coli BL21(DE3).
5. Use of the genetically engineered bacterium described in claim 3 in the microbial catalytic preparation of an intermediate of anidulafungin - the echinocandin B core compound.
6. The application according to claim 5, characterized in that The use is as follows: Using echinocandin B as a reaction substrate, using the wet cells of the genetically engineered bacterium or the enzyme solution obtained by crushing the wet cells as a biocatalyst, using urea and choline chloride as cosolvents, and using a pH 7 - 8 potassium phosphate buffer as a reaction medium to form a reaction system, and performing a biocatalytic reaction at a temperature of 35 - 45 °C and a stirring speed of 500 - 800 r / min to obtain the echinocandin B core compound.
7. The application according to claim 6, wherein The wet cells are obtained by the following method: Inoculating the genetically engineered bacterium into TB medium, culturing at 35 - 37 °C and 150 - 200 rpm until the OD600 reaches 0.8, adding an inducer IPTG with a final concentration of 0.1 - 1 mM to the fermentation broth, transferring it to a shaker at 12 - 20 °C and 150 - 200 rpm for enzyme induction, centrifuging the obtained fermentation broth to collect the cell precipitate, which is the wet cells.
8. The application according to claim 7, wherein The addition concentration of the inducer IPTG is 0.2 mM. After adding the inducer, transfer it to a shaker at 16 °C and 180 rpm for 16 h of enzyme induction. Centrifuge the obtained fermentation broth to collect the cell precipitate, which is the wet cells.
Citation Information
Patent Citations
Expression cassette for recombinant expression of echinocandin B deacylase and application thereof
CN113174398A
Method for producing a cyclic peptide
CN104768966A
Recombinant ECB (echinocandin B) deacylase mutant and application
CN109897843A