A nasopharyngeal carcinoma genetic risk assessment system

Abstract

The application discloses a set of nasopharyngeal carcinoma susceptible genes, and constructs a set of nasopharyngeal carcinoma genetic risk assessment systems including sample preparation, multi-target gene detection, multi-gene model prediction and result determination. The nasopharyngeal carcinoma multi-gene genetic risk score based on common and rare genetic sites is different from traditional molecular biomarkers such as cfDNA and miRNA derived from plasma free nucleic acid. The multi-gene genetic risk score is based on the individual's innate genetic information, needs to be detected only once in a lifetime, and can be detected at any age. The multi-gene genetic risk score has the advantages of lifelong stability and easy detection. The genetic risk assessment system is used for high-risk individual identification. The nasopharyngeal carcinoma incidence risk of the individual with the highest score is 21-27 times that of the group with the lowest score. The assessment system can provide a reference for individualized nasopharyngeal carcinoma incidence risk assessment, high-risk population identification, nasopharyngeal carcinoma high-cancer family genetic screening, corresponding genetic counseling and clinical intervention.

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, and more specifically, to a nasopharyngeal carcinoma genetic risk assessment system. Background Technology

[0002] Nasopharyngeal carcinoma (NPC) is a malignant tumor originating from the epithelial membrane of the nasopharynx. Its incidence varies greatly worldwide; in most regions, the age-standardized incidence is less than 1 in 100,000, while it is exceptionally high in southern my country. Early-stage NPC patients have a relatively good prognosis, with a 5-year survival rate exceeding 90%, while late-stage NPC lacks ideal treatment options, resulting in a 5-year survival rate of less than 50%. Due to the nonspecific early symptoms and the often hidden nature of the primary lesion, approximately 80% of NPC patients are diagnosed at an intermediate or advanced stage, leading to poor treatment outcomes and a high mortality rate. Therefore, early diagnosis and treatment of NPC are crucial for its prevention and control.

[0003] Epidemiological surveys have revealed a significant familial clustering of nasopharyngeal carcinoma (NPC). Approximately 10% of NPC patients have a family history of the disease, and the risk of NPC in first-degree relatives of NPC patients is 4 to 10 times higher than in those without a family history. Therefore, identifying and determining susceptibility genes in NPC patients is crucial for assessing the risk of NPC in other family members and for providing genetic counseling. Genetic factors are a significant cause of NPC. Based on an individual's susceptibility gene status, individual genetic risk can be predicted, and precise screening and prevention recommendations can be provided.

[0004] Currently, existing technologies determine an individual's genetic susceptibility to nasopharyngeal carcinoma (NPC) based on NPC-related genes (patents: "Reagent kit and gene chip for predicting the risk of nasopharyngeal carcinoma incidence," "A SNP marker for identifying high-risk groups of nasopharyngeal carcinoma and its reagent kit and application," etc.). However, the loci used are common, low-pathogenic polymorphic variants found in the population. These variants also have a high frequency in normal individuals and a low effect on the disease. Risk scoring using these common, low-pathogenic variants shows that the highest 10% of the group has a 5-7 times higher risk of developing NPC than the lowest-scoring group. Because these methods primarily include sporadic cases—that is, a family with only one NPC patient and no genetic predisposition—they cannot screen for and identify genetic susceptibility genes in patients with a family history of NPC, thus failing to assess the genetic risk of high-risk family members. Furthermore, high-risk family patients carry low-frequency or even rare harmful mutations that are almost exclusively inherited among blood relatives and are difficult to detect in sporadic cases. Therefore, obtaining information from patients with a family history of NPC is essential. Furthermore, genetic risk assessment for family members with high cancer risk is far more urgent than that for family members of sporadic patients, but currently there are no corresponding methods or detection technologies. Besides utilizing genetic susceptibility genes, there are patents using EBV genotyping for individual risk assessment (patents: "Reagent kit for detecting disease-related EBV variant sites," "Reagent kit and gene chip for predicting the risk of nasopharyngeal carcinoma"). However, although EBV infection is widespread in the population, some individuals have low viral loads, and a significant proportion of the population cannot detect positive viral signals due to viral latency, resulting in a low success rate for genotyping (48.79%–54.75%, PMID: 31209392). Nearly half of the individuals cannot successfully obtain EBV genotyping results; therefore, not all individuals can have their risk scores calculated successfully.

[0005] High-risk individuals with a family history of nasopharyngeal carcinoma are key populations for prevention and control in high-incidence areas of nasopharyngeal carcinoma. For this high-risk group, it is urgent to identify highly pathogenic genetic mutations (such as risk alleles with a risk effect >2), develop more efficient gene screening and risk prediction application tools, and then conduct more targeted screening and genetic counseling for high-incidence families of nasopharyngeal carcinoma. Summary of the Invention

[0006] The purpose of this invention is to overcome the aforementioned shortcomings of existing technologies and conduct large-scale whole-exome sequencing studies. By enriching cases with a family history of nasopharyngeal carcinoma (NPC), and through large-scale genomic typing experiments, gene function experiments, and data analysis, highly pathogenic susceptibility genes affecting NPC development are identified. Furthermore, a NPC genetic risk assessment system is constructed using big data modeling and reagent kits. This invention utilizes genetic susceptibility genes for risk assessment, establishing an important method for NPC risk assessment. It boasts advantages such as high detection rate (nearly 100% typing success rate), simple typing, and stable results.

[0007] The first objective of this invention is to provide the application of a reagent for detecting one or more gene mutations in nasopharyngeal carcinoma-related genes.

[0008] A second objective of this invention is to provide a product for assessing the genetic risk of nasopharyngeal carcinoma.

[0009] The third objective of this invention is to provide a genetic risk assessment system for nasopharyngeal carcinoma.

[0010] All physical locations mentioned in this invention use the hg19 version of the reference genome. For sites that do not yet have RS numbers, the site is named using the physical location plus the alleles before and after the mutation. The naming rules are as follows: "Chromosome number: hg19 version Reference genome physical location: Reference allele: Harmful allele."

[0011] To achieve the above objectives, the present invention is implemented through the following solution: A group of susceptibility genes associated with the development of nasopharyngeal carcinoma, said susceptibility genes include one or more of the following: POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, ZNF135, ERCC2, TP63, MUTYH, BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, LZTR1, MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPAL1, NOTCH1, PRKDC, HLA-A, HLA-C, CDKN2B-AS1, and ZFP57.

[0012] The application of reagents for detecting mutations in one or more genes related to nasopharyngeal carcinoma (NPC), wherein the application is in the preparation of products for diagnosing / preventing NPC, or in the interpretation of NPC etiology, assessment of individual NPC risk, genetic counseling for high-risk NPC families, and provision of clinical treatment decision support for one or more of these products. The NPC-related genes are POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, ZNF135, ERCC2, TP63, and MUTYH. One or a combination of several of the following: BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, LZTR1, MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPAL1, NOTCH1, PRKDC, HLA-A, HLA-C, CDKN2B-AS1, ZFP57.

[0013] The reagents are used to detect gene mutations and include various reagents that can achieve this purpose.

[0014] Preferably, the relevant genes are a combination of POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, ZNF135, ERCC2, TP63, MUTYH, BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, LZTR1, MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPAL1, NOTCH1, PRKDC, HLA-A, HLA-C, CDKN2B-AS1, and ZFP57.

[0015] More preferably, the mutations include: common mutations and rare, harmful mutations associated with the development of nasopharyngeal carcinoma. Among them, the common mutations are: rs402710, rs2747421, rs564398, A*11:01, A*02:07, C*01:02, C*03:02; The rare and harmful mutation is defined as a rare mutation in East Asians with a MAF < 0.5%, and that meets at least one of the following criteria: In the ClinVar database, the pathogenicity of a mutation is noted as a pathogenic or potentially pathogenic mutation; In the InterVar database, the pathogenicity of a mutation is noted as a pathogenic or potentially pathogenic mutation; Frameshift mutation; Start codon loss / gain mutation; Stop codon loss / gain mutation; Mutations that affect gene splicing; Mutations predicted as "damaging" by the SIFT database; The mutation is predicted as "damaging" by the MutationTaster database.

[0016] Rare and harmful mutations may have a significant impact on protein function.

[0017] Information on the common mutations is shown in the table below:

[0018] Preferably, the rare harmful mutation includes the following sites: rs377642893, rs1206463301, rs146182235, rs371935755, rs28363218, 9:26997984:C:T, rs1401668672, rs768472959, rs7470629 91, rs181427104, rs1557706222, rs34761954, rs752087698, 9:26997927:T:A, 9:26999686:CT:C, rs80338803, rs200379491, rs58 7780290, rs137967275, rs182018947, 15:49081061:G:C, 15:49089736:CA:C, 19:46136147:GCT:G, rs1412934450, rs1276533174, rs770181520, 19:58579293:C:CT, rs762687232, rs758882072, rs777483913, rs537376932, 15:49060526:G:A, 15:49076307:T:-, rs763144679, rs753018650, rs776487884, rs762307622, ​​rs587780088, rs7 73409311, rs364897, 1:193218892:C:T, rs63750617, rs752043324, rs1443 11212, rs267599192, rs535202189, rs374718902, rs751535193, rs1464074 83, 3:189456562:G:A, rs576449010, rs565094952, rs767906723, rs182657 062, 16:89816189:G:A, rs138729528, 17:7579494:A:G, rs80357590, rs803 58181, rs80357966, rs879254224, rs201392911, rs537616689, rs55760160 8, 19:45856397:G:T, rs751318902, rs200895828, rs771182769, rs1398849 31, rs150000483, rs781431741, rs148677674, rs587780192, rs764884641, rs760669739, rs188076755, rs764843609, rs4986984, rs63751657, rs773053723, rs201 024956, rs34350470, rs200626206, rs35924402, rs200046052, rs572130928, rs55684211 0, 19:39989887:-:C, rs771347725, rs1199048959, rs201397773, 19:50176987:G:C, rs7 63246446, rs200757776, rs778675391, 5:1338049:-:A, rs530094595, 9:139390923:C:A; The information for each point is shown in the table below:

[0019] The present invention also claims a product for assessing the genetic risk of nasopharyngeal carcinoma, containing the aforementioned reagent.

[0020] Preferably, the product is a liquid-phase capture chip kit, which contains the reagent as a capture probe, the capture probe being a DNA probe, and the specific information of the DNA probe is shown in the table below:

[0021] More preferably, the specific information of the DNA probe is shown in the table below:

[0022] This invention also claims a nasopharyngeal carcinoma genetic risk assessment system, comprising a sample DNA preparation module, a mutation site detection module, a genetic risk score calculation module, and a result determination module. Among them, (1) the sample DNA preparation module is used to extract sample DNA to obtain sample DNA. The sample includes, but is not limited to, whole blood, blood clots, serum, plasma, saliva, oropharyngeal swabs, nasopharyngeal swabs, nasopharyngeal sputum samples, urine, feces and other samples containing human DNA. (2) The mutation site detection module is used to determine the mutation status of the gene in the sample DNA obtained by the sample DNA preparation module, and transmits the obtained mutation status of the gene to the genetic risk score calculation module. The mutations include common and rare harmful mutations associated with the development of nasopharyngeal carcinoma: Among them, the common mutations are: rs402710, rs2747421, rs564398, A*11:01, A*02:07, C*01:02, C*03:02; The rare and harmful mutation is a rare mutation in East Asians with a MAF < 0.5%, and meets at least one of the following criteria: In the ClinVar database, the pathogenicity of a mutation is noted as a pathogenic or potentially pathogenic mutation; In the InterVar database, the pathogenicity of a mutation is noted as a pathogenic or potentially pathogenic mutation; Frameshift mutation; Start codon loss / gain mutation; Stop codon loss / gain mutation; Mutations that affect gene splicing; Mutations predicted as "damaging" by the SIFT database; Mutations predicted as "damaging" by the MutationTaster database; Information on the common mutations is shown in the table below:

[0023] (3) Genetic risk score calculation module, which calculates the genetic risk score using the gene mutation information obtained by the mutation site detection module, and transmits the obtained genetic risk score data to the result judgment module. The formula for calculating the genetic risk score is: PRSCR = 1.0856 × PRSC + 2.5053 × Gene_score1 + 0.6319 × Gene_score2 + 0.7766 × Gene_score3; in, PRSC = (4.343E-05×rs402710 genotype score) + (0.2901×rs2747421 genotype score) + (0.8246×rs564398 genotype score) + (0.6154×A*11:01 genotype score) + (1.4355×A*02:07 genotype score) + (0.0233×C*01:02 genotype score) + (1.1258×C*03:02 genotype score). The PRSC score is assigned as follows: no risk allele = "0", one risk allele = "1", two risk alleles = "2". Gene_score1 assigns a score of 1 if an individual carries any one of the seven genes POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, and ZNF135 and has a rare and harmful mutation; otherwise, it assigns a score of 0. Gene_score2 assigns a score of 1 if an individual carries any one of the 11 genes MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPAL1, NOTCH1, and PRKDC and has a rare and harmful mutation; otherwise, it assigns a score of 0. Gene_score3 assigns a score of 1 if an individual carries any one of the following 15 genes: ERCC2, TP63, MUTYH, BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, and LZTR1, and any rare or harmful mutation exists in any of these genes. If no rare or harmful mutation exists in any of these 15 genes, the score is 0.

[0024] (4) Result determination module, used to determine the result based on the PRSCR result. When the PRSCR score is higher than 5.03, the lifetime cumulative risk of nasopharyngeal carcinoma is 26.87% and the individual is determined to be a high genetic risk individual for nasopharyngeal carcinoma. When the score is between 4.10 and 5.03, the lifetime cumulative risk of nasopharyngeal carcinoma is 5.79%-9.10% and the individual is determined to be a medium-high genetic risk individual for nasopharyngeal carcinoma.

[0025] Preferably, the rare and harmful mutations in the seven genes POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, and ZNF135 are rs377642893, rs1206463301, rs146182235, rs371935755, rs28363218, 9:26997984:C:T, rs1401668672, rs768472959, rs747062991, rs181427104, rs1557706222, rs34761954, rs752087698, 9:26997927:T:A, 9:26999686: CT:C, rs80338803, rs200379491, rs587780290, rs137967275, rs182018947, 15:49081061:G:C, 15:49089736:CA:C, 19:46136147:GCT:G, rs14129344 50, rs1276533174, rs770181520, 19:58579293:C:CT, rs762687232, rs758 882072, rs777483913, rs537376932, 15:49060526:G:A, 15:49076307:T:-.

[0026] Preferably, the rare and harmful mutations in the 11 genes MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPAL1, NOTCH1, and PRKDC are rs760669739, rs188076755, rs764843609, rs4986984, rs63751657, rs773053723, rs201024956, rs34350470, and rs200626206. rs35924402, rs200046052, rs572130928, rs556842110, 19:39989887:-:C, rs771347725, rs1199048959, rs2013977 73, 19:50176987:G:C, rs763246446, rs200757776, rs778675391, 5:1338049:-:A, rs530094595, 9:139390923:C:A.

[0027] Preferably, the rare and harmful mutations in the 15 genes ERCC2, TP63, MUTYH, BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, and LZTR1 are rs763144679, rs753018650, rs776487884, and rs762307622. , rs587780088, rs773409311, rs364897, 1:193218892:C:T, rs63750617, rs752043324, rs1 44311212, rs267599192, rs535202189, rs374718902, rs751535193, rs146407483, 3:18945 6562:G:A, rs576449010, rs565094952, rs767906723, rs182657062, 16:89816189:G:A, rs1 38729528, 17:7579494:A:G, rs80357590, rs80358181, rs80357966, rs879254224, rs20139 2911, rs537616689, rs557601608, 19:45856397:G:T, rs751318902, rs200895828, rs77118 2769, rs139884931, rs150000483, rs781431741, rs148677674, rs587780192, rs764884641.

[0028] Preferably, the mutation site detection module includes a library construction and sequencing submodule and a sequencing data processing submodule. The library construction and sequencing submodule is used to construct libraries and sequence DNA obtained from the sample DNA preparation module, and transmit the data to the sequencing data processing submodule. The sequencing data processing submodule is used to process sequencing data, determine the site variations of common mutations and rare harmful mutations, and transmit the data to the genetic risk score calculation module.

[0029] More preferably, the library construction and sequencing submodule utilizes liquid phase capture for library construction and sequencing.

[0030] As a specific implementation method, this invention provides a specific method for assessing the genetic risk of nasopharyngeal carcinoma: (1) Extract genomic DNA from the collected samples, including but not limited to whole blood, blood clots, serum, plasma, saliva, oropharyngeal swabs, nasopharyngeal swabs, nasopharyngeal smears, urine, feces and other samples containing human DNA; (2) Library construction was performed on the extracted genomic DNA. The specific steps are as follows: ① Fragment the genomic DNA; ② Perform end repair and add base A to fragmented DNA; ③ Connect sequencing adapters to perform product purification and PCR amplification; ④ After amplification, the product is purified and enriched; ⑤ The enriched product is subjected to target region hybridization capture; ⑥ Elute the capture library, perform PCR amplification on the product, and purify the amplified library; ⑦ Conduct document quality control; Among them, there are 37 genes and 772 capture regions. The specific DNA probe information is as follows:

[0031] The captured region includes 37 genes: POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, ZNF135, ERCC2, TP63, MUTYH, BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, LZTR1, MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPAL1, NOTCH1, PRKDC, HLA-A, HLA-C, CDKN2B-AS1, and ZFP57.

[0032] (3) Perform next-generation sequencing on the constructed library; (4) The sequencing data was analyzed, and the sequencing data obtained from the capture detection was compared with the hg19 reference genome. Mutation detection was performed using GATK to obtain mutations, and further mutations of nasopharyngeal carcinoma-related genes were obtained, including: common mutations and rare harmful mutations related to the pathogenesis of nasopharyngeal carcinoma. The common mutations mentioned are: rs402710, rs2747421, rs564398, A*11:01, A*02:07, C*01:02, and C*03:02, with specific information as follows:

[0033] Rare and harmful mutations are defined as those with a MAF < 0.5% in East Asians and that meet at least one of the following criteria: In the ClinVar database, the pathogenicity of a mutation is noted as a pathogenic or potentially pathogenic mutation; In the InterVar database, the pathogenicity of a mutation is noted as a pathogenic or potentially pathogenic mutation; Frameshift mutation; Start codon loss / gain mutation; Stop codon loss / gain mutation; Mutations that affect gene splicing; Mutations predicted as "damaging" by the SIFT database; Mutations predicted as "damaging" by the MutationTaster database; (4) Genetic risk score PRSCR The above statistics on rare and common mutations were compiled, and the genetic risk score (PRSCR) for familial nasopharyngeal carcinoma was calculated using the following risk scoring formula: PRSCR = 1.0856 × PRSC + 2.5053 × Gene_score1 +0.6319 × Gene_score2+ 0.7766 × Gene_score3; in, PRSC = (4.343E-05×rs402710 genotype score) + (0.2901×rs2747421 genotype score) + (0.8246×rs564398 genotype score) + (0.6154×A*11:01 genotype score) + (1.4355×A*02:07 genotype score) + (0.0233×C*01:02 genotype score) + (1.1258×C*03:02 genotype score); For PRSC, genotype scores for 7 common mutations are assigned as follows: no risk allele = "0", one risk allele = "1", and two risk alleles = "2". Gene_score1 is a score for rare and harmful mutations in an individual carrying seven newly discovered nasopharyngeal carcinoma susceptibility genes (POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, and ZNF135). If any one of the seven genes has a rare and harmful mutation, the score is 1; if none of the seven genes have a rare and harmful mutation, the score is 0. Gene_score2 is a score for rare and harmful mutations in 11 nasopharyngeal carcinoma susceptibility genes (MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPAL1, NOTCH1, and PRKDC) in an individual. If any of the 11 genes has a rare and harmful mutation, the score is 1; if no rare and harmful mutations are found in any of the 11 genes, the score is 0. Gene_score3 is a score indicating whether an individual carries rare and harmful mutations in 15 tumor susceptibility genes (ERCC2, TP63, MUTYH, BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, and LZTR1). A score of 1 is assigned if any one of the 15 genes contains a rare and harmful mutation, and a score of 0 is assigned if none of the 15 genes contain such mutations. (5) High-risk individual determination: Based on the calculated genetic risk score of nasopharyngeal carcinoma, when the score is higher than 5.03, the lifetime cumulative risk of nasopharyngeal carcinoma is 26.87% on average, and the individual is determined to be a high genetic risk individual for nasopharyngeal carcinoma. When the score is between 4.10 and 5.03, the lifetime cumulative risk of nasopharyngeal carcinoma is 5.79%-9.10% on average, and the individual is determined to be a medium-high genetic risk individual for nasopharyngeal carcinoma.

[0034] As another specific implementation method, the present invention provides a specific method for assessing the genetic risk of nasopharyngeal carcinoma: (1) Extract genomic DNA from the collected samples, including but not limited to whole blood, blood clots, serum, plasma, saliva, oropharyngeal swabs, nasopharyngeal swabs, nasopharyngeal smears, urine, feces and other samples containing human DNA; (2) Library construction was performed on the extracted genomic DNA. The specific steps are as follows: ① Fragment the genomic DNA; ② Perform end repair and add base A to fragmented DNA; ③ Connect sequencing adapters to perform product purification and PCR amplification; ④ After amplification, the product is purified and enriched; ⑤ The enriched product is subjected to target region hybridization capture; ⑥ Elute the capture library, perform PCR amplification on the product, and purify the amplified library; ⑦ Conduct document quality control; Among them, there are 103 capture regions, and the specific DNA probe information is as follows:

[0035] (3) Perform next-generation sequencing on the constructed library; (4) The sequencing data were analyzed and compared with the hg19 reference genome. GATK was used to detect mutations, and the genotype detection results for the following sites were obtained: Group (1): rs377642893, rs1206463301, rs146182235, rs371935755, rs28363218, 9:26997984:C:T, rs1401668672, rs768472959, rs747 062991, rs181427104, rs1557706222, rs34761954, rs752087698, 9:26997927:T:A, 9:26999686:CT:C, rs80338803, rs200379491, r s587780290, rs137967275, rs182018947, 15:49081061:G:C, 15:49089736:CA:C, 19:46136147:GCT:G, rs1412934450, rs127653317 4, rs770181520, 19:58579293:C:CT, rs762687232, rs758882072, rs777483913, rs537376932, 15:49060526:G:A, 15:49076307:T:-; Group (2): rs763144679, rs753018650, rs776487884, rs762307622, ​​rs58778008 8, rs773409311, rs364897, 1:193218892:C:T, rs63750617, rs752043324, rs 144311212, rs267599192, rs535202189, rs374718902, rs751535193, rs146 407483, 3:189456562:G:A, rs576449010, rs565094952, rs767906723, rs182 657062, 16:89816189:G:A, rs138729528, 17:7579494:A:G, rs80357590, rs 80358181, rs80357966, rs879254224, rs201392911, rs537616689, rs557601 608, 19:45856397:G:T, rs751318902, rs200895828, rs771182769, rs139884 931, rs150000483, rs781431741, rs148677674, rs587780192, rs764884641; Group (3): rs760669739, rs188076755, rs764843609, rs4986984, rs63751657, rs773053723, rs201024956, rs34350470, rs200626206, rs35924402, rs200046052, rs572130928, rs55684211 0, 19:39989887:-:C, rs771347725, rs1199048959, rs201397773, 19:50176987:G:C, rs7 63246446, rs200757776, rs778675391, 5:1338049:-:A, rs530094595, 9:139390923:C:A; Group (4): rs402710, rs2747421, rs564398, A*11:01, A*02:07, C*01:02, C*03:02.

[0036] (5) Conduct genetic risk assessment: The genetic risk score (PRSCR) for familial nasopharyngeal carcinoma is calculated using the following risk scoring formula: PRSCR = 1.0856×PRSC +2.5053×Gene_score1 +0.6319×Gene_score 2+0.7766×Gene_score3; Wherein, PRSC = (score of 4.343E-05×rs402710 genotype) + (score of 0.2901×rs2747421 genotype) + (score of 0.8246×rs564398 genotype) + (score of 0.6154×A*11:01 genotype) + (score of 1.4355×A*02:07 genotype) + (score of 0.0233×C*01:02 genotype) + (score of 1.1258×C*03:02 genotype); the genotype scores of these seven genotypes are assigned as follows: no risk allele = "0", one risk allele = "1", two risk alleles = "2"; Gene_score1 is a score for individuals carrying rare and harmful mutations in seven newly discovered nasopharyngeal carcinoma susceptibility genes (POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, and ZNF135) (Group 1). If any one of the seven genes has a rare and harmful mutation, the score is 1; if none of the seven genes have a rare and harmful mutation, the score is 0. Gene_score2 is a score for individuals carrying rare and harmful mutations (group 3) in 11 nasopharyngeal carcinoma susceptibility genes (MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPAL1, NOTCH1, and PRKDC). If any of the 11 genes has a rare and harmful mutation, a score of 1 is assigned; if no rare and harmful mutations are found in any of the 11 genes, a score of 0 is assigned. Gene_score3 is a score for whether an individual carries rare and harmful mutations in 15 tumor susceptibility genes (ERCC2, TP63, MUTYH, BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, and LZTR1) (Group 2). If any one of the 15 genes has a rare and harmful mutation, the score is 1; if none of the 15 genes have a rare and harmful mutation, the score is 0. The summary information for each user is as follows:

[0037] (6) High-risk individual determination: Based on the calculated genetic risk score of nasopharyngeal carcinoma, when the score is higher than 5.03, the lifetime cumulative risk of nasopharyngeal carcinoma is 26.87% on average, and the individual is determined to be a high genetic risk individual for nasopharyngeal carcinoma. When the score is between 4.10 and 5.03, the lifetime cumulative risk of nasopharyngeal carcinoma is 5.79%-9.10% on average, and the individual is determined to be a medium-high genetic risk individual for nasopharyngeal carcinoma.

[0038] This invention is based on a whole-exome association study conducted in a high-incidence family cohort of nasopharyngeal carcinoma (NPC). Through original, comprehensive, and systematic research, it identifies susceptibility genes and rare harmful mutations associated with familial NPC, and discovers new susceptibility genes. Furthermore, by combining rare harmful mutations of tumor-related and NPC-related susceptibility genes with common NPC-related mutations, a more comprehensive genetic model is constructed, effectively improving the ability of genetic risk assessment models to identify high-risk individuals. This invention can provide better risk stratification for NPC, opening new avenues for personalized NPC prevention, chemotherapy, and drug screening.

[0039] Compared with the prior art, the present invention has the following beneficial effects: (1) A family history of nasopharyngeal carcinoma is an important risk factor for nasopharyngeal carcinoma. People with a family history of nasopharyngeal carcinoma are a key population in high-incidence areas that urgently need prevention and control. However, there is currently no effective risk assessment tool for this population. Genetic risk assessment based solely on family history is extremely inaccurate. This invention can fill the gap in this field by predicting the individual genetic risk of people with a family history of nasopharyngeal carcinoma based on the individual's susceptibility gene status and providing individuals with precise screening and prevention recommendations.

[0040] (2) This invention is based on the results of the whole exome association study conducted by the largest international cohort of familial nasopharyngeal carcinoma studies. It incorporates several rare and harmful mutations on important nasopharyngeal carcinoma susceptibility genes newly discovered in this study. Compared with the previous nasopharyngeal carcinoma polygenic genetic risk model based on common mutations, it has a better ability to identify high-risk populations.

[0041] (3) The nasopharyngeal carcinoma polygenic genetic risk score model based on genetic loci is a novel molecular biomarker, which is different from traditional molecular biomarkers derived from plasma such as cfDNA and miRNA. The polygenic genetic risk score is based on an individual's innate genetic information, and only needs to be tested once in a lifetime. It can be tested at any age and has the advantages of lifelong stability and ease of detection. Attached Figure Description

[0042] Figure 1POLN mutation site carrier status in families and Sanger sequencing results; (A) Pedigree of families carrying the POLN p.P577L mutation. (B) Sanger sequencing results of healthy relatives carrying the wild-type p.P577L mutation; (C) Sanger sequencing results of patients carrying the heterozygous p.P577L mutation; (D) Sanger validation results of three harmful mutations. Figure 2 The effects of rare and harmful POLN mutations on POLN protein expression and its function as a tumor suppressor gene in nasopharyngeal carcinoma; (A) The three-dimensional structure of POLN and the location of the three rare and harmful mutations; (B) Changes in the binding distance of POLN to other amino acids or DNA before and after the mutation of the three amino acids; (C) Detection results of degradation rate of wild-type and mutant POLN protein in HK1 EBV+ and CNE2 EBV+ cell lines; (D) Detection results of expression level of wild-type and mutant POLN protein in HK1 EBV+ and CNE2 EBV+ cell lines; (E) POLN mRNA expression in normal nasopharyngeal tissue and nasopharyngeal carcinoma tissue; (F) POLN protein expression in normal nasopharyngeal tissue and nasopharyngeal carcinoma tissue; (G) Effects of wild-type and mutant POLN on cell proliferation.

[0043] Figure 3 Carrier status of six new nasopharyngeal carcinoma susceptibility genes in case and healthy control populations (A) Overall carrier frequency of six new nasopharyngeal carcinoma susceptibility genes in patients with familial nasopharyngeal carcinoma and in healthy controls; (B)-(G) Carrier status of mutation sites on the six new susceptibility genes.

[0044] Figure 4 The Sanger sequencing results are for site verification in Example 2.

[0045] Figure 5 Carrier status of tumor-associated genes in familial nasopharyngeal carcinoma cases and healthy controls; (A) Overall carrier frequency of 15 tumor-associated genes in familial nasopharyngeal carcinoma patients and healthy controls; (B)-(E) Carrier status of mutation sites on the four most frequent tumor-associated genes.

[0046] Figure 6 Risk estimation of nasopharyngeal carcinoma in individuals at each quantile of the genetic score PRSCR; (A) relative risk of nasopharyngeal carcinoma in individuals at each quantile of the genetic score PRSCR; (B) lifetime cumulative risk of nasopharyngeal carcinoma in male individuals at each quantile of the genetic score PRSCR; (C) lifetime cumulative risk of nasopharyngeal carcinoma in female individuals at each quantile of the genetic score PRSCR. Detailed Implementation

[0047] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0048] The samples used in the following examples include, but are not limited to, whole blood, blood clots, serum, plasma, saliva, oropharyngeal swabs, nasopharyngeal swabs, nasopharyngeal endoscopy samples, urine, and feces containing human DNA. DNA extraction was performed using standard methods, employing the Qiagen DNA midi kit (100) or similar products. Quantification was performed using a spectrophotometer, and quality control was conducted using agarose gel electrophoresis. Genomic DNA bands were typically no less than 20 kb. The quality-controlled DNA was then adjusted to a concentration of 50 ng / μl, transferred to 384-well plates, and stored at -80°C for later use.

[0049] Example 1: Whole-exome library assembly, sequencing, and co-segregation analysis to identify rare and harmful mutations in the POLN gene in families with a high incidence of nasopharyngeal carcinoma. I. Whole-exome sequencing for identifying POLN gene mutations in high-incidence families of nasopharyngeal carcinoma (I) Experimental Samples To identify genetic susceptibility genes for nasopharyngeal carcinoma, peripheral blood or saliva samples were collected from 35 nasopharyngeal carcinoma patients and 34 healthy first-degree relatives from 13 high-incidence families.

[0050] (II) Experimental Methods 1. Establish a standardized specimen bank and database of high-incidence families of nasopharyngeal carcinoma, probands of familial nasopharyngeal carcinoma, and healthy controls. The system collects complete demographic data, family history information on nasopharyngeal carcinoma, and clinical data, and collects peripheral blood or saliva that meets the standards using standard operating procedures to establish a unified standard specimen bank and database.

[0051] 2. DNA extraction and whole-exome library construction and sequencing (1) DNA extraction from peripheral blood, saliva or oropharyngeal swabs DNA was extracted from specimens from 35 nasopharyngeal carcinoma patients and 34 healthy first-degree relatives.

[0052] (2) Whole exome library assembly and sequencing ① DNA fragmentation: Sonicating genomic DNA to break it into DNA fragments of 150-300 bp; ② End repair and adapter ligation: End repair and sequencing adapter ligation are performed on DNA fragments; the products are purified and quantified; ③ Product enrichment and capture: The purified product was amplified by PCR, and the purified DNA was enriched and captured by hybridization using Agilent whole exome capture probe; ④ Enrichment of target region: The captured product is eluted, then PCR amplified, tagged, and quality controlled; ⑤ Sequencing: The test products that have passed quality control will be subjected to next-generation sequencing.

[0053] 3. Detection, annotation, and screening of rare mutation sites (1) Mutation site detection The downloaded sequence files were filtered and quality controlled. The quality-controlled sequences were aligned to the reference genome (hg19) using bwa, repetitive sequences were marked using picard, alignment and base score correction were performed using GATK, and SNP and indel detection were performed using GATKHaplotypeCaller to retain high-quality mutation sites.

[0054] (2) Annotation and screening of rare harmful mutations We employed a "mutation-phenotype" co-segregation analysis strategy based on dominant inheritance patterns, focusing only on mutations carried by all patients in the same family but not by their healthy relatives, screening for rare mutations that co-segregate with the disease; and annotating the potential impact of these mutations on gene function using the ClinVar, InterVar, SIFT, and MutationTaster databases.

[0055] (III) Experimental Results A rare, harmful mutation, rs146182235 (c.C1730T, p.P577L, abbreviated as p.P577L), was found to co-segregate with the familial nasopharyngeal carcinoma phenotype in nasopharyngeal carcinoma families. Preliminary screening of POLN as a novel nasopharyngeal carcinoma susceptibility gene suggests its potential role in nasopharyngeal carcinoma susceptibility. Figure 1 AC).

[0056] II. Sanger sequencing to uncover POLN gene mutations in high-incidence families of nasopharyngeal carcinoma (I) Experimental Samples Peripheral blood, saliva, or oropharyngeal swab samples from another 351 patients with familial nasopharyngeal carcinoma were tested for POLN gene mutations.

[0057] (II) Experimental Methods (1) DNA extraction from peripheral blood, saliva or oropharyngeal swabs, etc. DNA was extracted from samples from another 351 patients with familial nasopharyngeal carcinoma.

[0058] (2) Primer design referenced the human genome sequence database hg19. The following are the Sanger sequencing primers covering all exons and exon-intron junction regions of POLN: against POLN Exon 1 and Exon 2: 5'- CTCAGCTCCACCCCATAGTC -3' and 5'- AGGCTAGGCAGCCTTCTC -3'; against POLN exon3: 5'- TGGATGATTGATGCCTATTTTC -3' and 5'- GAGCTGGGCTTCATCTGTCT -3'; against POLN exon4: 5'-TTCAGTGTTAGTTAACTGTGTGACTT-3' and 5'-AGAGCAAGAACGCCTCTTTT-3'; against POLN exon5: 5'-TGAAGATTGTGTCTCCATATTACC-3' and 5'-GCTCTCCTATCAAAATCTGACAC-3'; against POLN exon6: 5'- GCCTTTTCTCTTTCTCTCTGC -3' and 5'- GACCTTTGAGCAAGTTTCCATT -3'; against POLN exon7: 5'-TTTAGTGAATGTGTGTATGTGCTATC-3' and 5'-CCCATTCATAGGAGGAGTCA-3'; against POLN exon8: 5'-CGTTTGAACTTAAGAACTTTGTCA-3' and 5'-GAAATGCCAAGGTCACAACTA-3'; against POLN exon9: 5'- TCAGTTACAGACTGTGGTGAGC -3' and 5'- GGTGCCAATGAAAAGACATC -3'; against POLN Exon 10 and 11: 5'- GGCTTTTCAACAAATGCAG -3' and 5'- TGCCACTGGGAACAACTATC -3'; against POLN Exon 12 and 13: 5'- CCCATCTCGCTGTTGAGAAT -3' and 5'- GGTCTGAAGGTCAGCACACA -3'; against POLN exon14: 5'- CTTTTCTCCAGATGAAAATACGTG -3' and 5'- AGAACACTGGGAGGGCTACT-3'; against POLN exon15: 5'- AGTATTCACTGAGCCTGTGGC -3' and 5'- CACGTGATCAGGGAAGGCTG -3'; against POLN exon16: 5'- TGGAAGTTTAGGGCCAGCAG -3', 5'- AAAGTGCACAGGCAAACACA -3'; against POLN exon17: 5'- CACACAGGCTAGAGTCAAAAGG-3' and 5'- GTGATCGCAAAATGCACTC-3'; against POLN exon18: 5'- AACAAAGTGAGACCCCCATC -3', 5'- GCCACAAAAGCGAGACTCTT -3'; against POLN exon19: 5'- TCCCCATTTCATTTCTCACC -3' and 5'- GCCTTATGAAAGTAGCTTGGA -3'; against POLN exon20: 5'- GGTGTGTGGTTGGACTGTCT -3' and 5'-TTTAAACAGGCACACAGC -3'; against POLN exon21: 5'- CACAGTCACGGCTGGTGT -3' and 5'- ATCCTCCCACAGAGGGTTG -3'; against POLN Exon 22 and 23: 5'- CACTTGCCCCCCATGATAGAC -3' and 5'- CCCGATAAGCAGAGATGGTG -3'; against POLN exon24: 5'-CTTCGCATGCACCCCTGA -3' and 5'-GAAGACAGCTGAGGGGCTTT -3'; against POLN Exon 25 and 26: 5'- AGTGGACACAGGAAACAAGG -3' and 5'- GTCAGAGCTGGTGGCTTCT -3'.

[0059] (3) PCR amplification The PCR amplification products were subjected to 1% agarose gel electrophoresis. The target fragment was excised, recovered, purified, and then sequenced by Sanger sequencing. The PCR reaction system is shown in Table 1, and the PCR reaction conditions are shown in Table 2.

[0060] Table 1 PCR reaction system

[0061] Table 2 PCR reaction conditions

[0062] (III) Experimental Results In 351 patients with familial nasopharyngeal carcinoma, two other rare and harmful mutations were found in the POLN gene: rs377642893 (c.G908A, p. R303Q, abbreviated as p. R303Q) and rs1206463301 (c.T1634G, p.F545C, abbreviated as p.F545C).

[0063] Therefore, among the above-mentioned familial nasopharyngeal carcinomas, a total of 3 patients were found to carry the rare and harmful POLN mutation. A typical example of Sanger sequencing validation is shown below. Figure 1 D, these three familial nasopharyngeal carcinoma patients are heterozygous for rare and harmful mutations in POLN-p.P577L, -p.R303Q and -p.F545C, respectively.

[0064] III. TaqMan probe typing technology for identifying rare and harmful mutations in the POLN gene (I) Experimental Samples Furthermore, the three rare and harmful mutation sites of POLN (POLN-p.P577L, -p.R303Q and -p.F545C) were further validated in an additional 212 cases of familial nasopharyngeal carcinoma and 3,175 healthy controls.

[0065] (II) Experimental Methods 1. DNA extraction from peripheral blood, saliva, or oropharyngeal swabs DNA was extracted from peripheral blood or saliva samples from another 212 cases of familial nasopharyngeal carcinoma and 3,175 healthy controls.

[0066] 2. TaqMan probe method for genotyping single nucleotide polymorphism sites Sequences within 100 bp upstream and downstream of the mutation site were retrieved from the NCBI database. Ingenic Semiconductor designed corresponding amplification primers and fluorescent probes based on the provided sequences. The mutation sequence is detailed in Table 3 below. Blank and positive controls were included in each experiment.

[0067] Table 3 Sequences for designing Taqman probes

[0068] Physical location was determined using the hg19 reference genome; site annotation was performed using the ENSEMBL database; and pathogenicity prediction was performed using the ClinVar and InterVar databases.

[0069] The reaction system and reaction conditions for the experiment are shown in Tables 4 and 5 below: Table 4 Reaction System:

[0070] Table 5 Reaction conditions:

[0071] The overall genotyping success rate exceeded 99%. For quality control, some samples were randomly selected and genotyped repeatedly, and the results confirmed 100% consistency.

[0072] (III) Experimental Results: Among 212 cases of familial nasopharyngeal carcinoma, one carrier of the p.P577L mutation (male, age of onset 43 years, whose father had nasopharyngeal carcinoma) was detected, and another healthy control (male, age of examination 59 years) carried the p.R303Q mutation. The p.F545C mutation was not detected in these groups.

[0073] An analysis of 576 familial nasopharyngeal carcinoma (NPC) samples from different families across the three phases (including NPC probands from 13 families, 351 NPC cases undergoing Sanger sequencing, and 212 NPC cases undergoing TaqMan testing) and 3175 healthy controls revealed that the frequency of rare and detrimental POLN mutations was 0.87% in NPC, compared to only 0.031% in healthy controls. The adjusted odds ratio (OR) was 27.75 (P = 4.41 × 10⁻⁶). -4 This indicates that individuals carrying rare and harmful mutations in POLN have a significantly increased risk of developing nasopharyngeal carcinoma.

[0074] IV. Protein Structure Prediction and Biological Experimental Verification of the Impact of Rare Destructive Mutations in POLN on Nasopharyngeal Carcinoma The vast majority of nasopharyngeal carcinoma cells carry EB virus. In order to study the effect of rare POLN harmful mutations on susceptibility to nasopharyngeal carcinoma, we used EB virus-positive nasopharyngeal carcinoma cell lines HK1 (HK1-EBV+) and CNE2 (CNE2 EBV+) for research.

[0075] (I) Prediction of the impact of rare and harmful mutations on the structure of POLN protein (1) Experimental methods The POLN protein structure before and after mutations at three sites (rs146182235, rs1206463301 and rs377642893) was predicted using PyMOL software.

[0076] (2) Experimental results The predicted results are as follows Figure 2 A and Figure 2 As shown in B, after amino acid 577 of the POLN protein mutates from P to L (rs146182235, p.P577L), the binding distance between the POLN protein and DNA changes from 8.5 Å to 9.3 Å, indicating a weakened binding ability. Similarly, after amino acid 545 of the POLN protein mutates from F to C (rs1206463301, p.F545C), the binding distance between the POLN protein and DNA changes from 4.6 Å to 6.9 Å, indicating a weakened binding ability. Originally, amino acid 303 (R) of the POLN protein could bind to amino acid 335, but after amino acid 303 mutates from R to Q (rs377642893, p.R303Q), it can no longer bind to amino acid 335, thus altering the structure of the POLN protein.

[0077] (II) The effect of rare and harmful mutations on POLN protein (1) Experimental methods Protein expression vectors for wild-type POLN and the three mutants (rs146182235, rs1206463301, and rs377642893) obtained above were constructed and transiently transfected into HK1 EBV+ and CNE2 EBV+ cell lines, respectively. The synthesis of new POLN protein was inhibited using the protein synthesis inhibitor actinomycin (CHX), while the content of already synthesized protein was only affected by the degradation rate. Proteins were collected after 0, 2, 4, and 8 hours of actinomycin treatment. The degradation rate of POLN protein was detected using Western blotting, and the relative expression levels of protein at different time points were calculated based on the grayscale ratio of POLN protein to the internal control protein α-Tubulin.

[0078] (2) Experimental results The results show that ( Figure 2 C): Rare and harmful mutations in POLN (rs146182235, rs1206463301, and rs377642893) accelerate the degradation of POLN, indicating that rare and harmful mutations in POLN (rs146182235, rs1206463301, and rs377642893) impair the stability of the POLN protein.

[0079] (III) Detection of POLN protein expression levels in each group by Western blotting (1) Experimental methods Western blotting was used to detect the total protein expression levels of wild-type and three mutant POLNs (rs146182235, rs1206463301 and rs377642893) using POLN antibodies, and HA-tagged antibodies were used to detect the exogenous POLN expression levels.

[0080] (2) Experimental results The results show that ( Figure 2 D), rare and harmful mutations in POLN, rs146182235, rs1206463301, and rs377642893, lead to downregulation of POLN protein expression.

[0081] The above results indicate that rare, detrimental mutations in POLN inhibit POLN protein expression by affecting protein stability.

[0082] (iv) Expression of POLN in normal nasopharyngeal tissue and nasopharyngeal carcinoma tissue (1) Experimental methods RNA was extracted from normal nasopharyngeal tissue and nasopharyngeal carcinoma tissue, and after reverse transcription, the expression of POLN mRNA in normal nasopharyngeal tissue and nasopharyngeal carcinoma tissue was detected by qPCR using POLN-specific primers: 5'-AGTGGATTCTAAGACTTGGGGA-3' and 5'-GGACTGAGGAGACAGCTTGG-3'.

[0083] (2) Experimental results The results show that ( Figure 2 E and Figure 2 POLN is a tumor suppressor gene in nasopharyngeal carcinoma, and it is expressed at low levels in nasopharyngeal carcinoma tissue compared to normal nasopharyngeal tissue.

[0084] (V) CCK8 cell proliferation experiment (1) Experimental methods CNE2 EBV+ and HK1 EBV+ cells overexpressing wild-type and mutant POLN, respectively, were seeded into 96-well plates at a density of 1000 cells / well. Cell proliferation was assessed daily at the same time using CCK8 reagent. 100 μl of complete culture medium and 10 μl of CCK8 reagent were added to each well, mixed thoroughly, and incubated in a cell culture incubator for 2 h before measuring absorbance at 450 nm.

[0085] (2) Experimental results The results show that ( Figure 2 (G) Wild-type POLN can inhibit the proliferation of nasopharyngeal carcinoma cells, while the proliferation inhibition ability of mutant POLN carrying three rare harmful mutations (rs146182235, rs1206463301 and rs377642893) is weakened, indicating that the three rare harmful mutations affect the function of POLN as a tumor suppressor gene.

[0086] Example 2: Whole-exome sequencing and gene association analysis revealed six new familial nasopharyngeal carcinoma genetic susceptibility genes and their rare harmful mutations. This embodiment performs whole-exome sequencing and association analysis on high-incidence families of nasopharyngeal carcinoma (including probands of familial nasopharyngeal carcinoma and their unaffected relatives) and ordinary healthy individuals.

[0087] I. Gene mining associated with familial nasopharyngeal carcinoma (I) Experimental Methods 1. Establish a standardized specimen bank and database of high-incidence families of nasopharyngeal carcinoma, probands of familial nasopharyngeal carcinoma, and healthy controls. A total of 906 individuals, including 502 familial nasopharyngeal carcinoma patients, 76 unaffected relatives from high-incidence families, and 328 healthy controls, were included in this study. Complete demographic data, family history information on nasopharyngeal carcinoma, and clinical data were systematically collected. Standardized blood, saliva, or oropharyngeal swab samples were collected using standard operating procedures, and a unified standard specimen bank and database were established.

[0088] 2. DNA extraction and whole-exome library construction and sequencing (1) DNA extraction from peripheral blood, saliva or oropharyngeal swabs DNA was extracted from specimens of 502 patients with familial nasopharyngeal carcinoma, 76 unaffected relatives from high-incidence families, and 328 healthy controls.

[0089] (2) Whole exome library assembly and sequencing ① DNA fragmentation: Sonicating genomic DNA to break it into DNA fragments of 150-300 bp; ② End repair and adapter ligation: End repair and sequencing adapter ligation are performed on DNA fragments; the products are purified and quantified; ③ Product enrichment and capture: The purified product was amplified by PCR, and the purified DNA was enriched and captured by hybridization using Agilent whole exome capture probe; ④ Enrichment of target region: The captured product is eluted, then PCR amplified, tagged, and quality controlled; ⑤ Sequencing: The test products that have passed quality control will be subjected to next-generation sequencing.

[0090] 3. Detection, annotation, and screening of mutation sites. (1) Mutation site detection The downloaded sequence files were filtered and quality controlled. The quality-controlled sequences were aligned to the reference genome (hg19) using bwa, repetitive sequences were marked using picard, alignment and base score correction were performed using GATK, and SNP and indel detection were performed using GATKHaplotypeCaller to retain high-quality mutation sites.

[0091] (2) Annotation and screening of mutation sites Mutation sites were annotated using Annovar and VEP software. First, the population frequency of mutations was annotated, filtering out and retaining rare mutations with a MAF < 0.5% in East Asians. Second, the pathogenicity of mutations was annotated using the ClinVar and InterVar databases, the impact of mutations on gene function was annotated using the refGene database, and harmfulness prediction was performed using the SIFT and MutationTaster databases. Finally, harmful mutations that are rare in East Asian populations (MAF < 0.5%) and meet any of the following criteria were retained: ① In the ClinVar database, the pathogenicity of a mutation is annotated as pathogenic or potentially pathogenic. ② In the InterVar database, the pathogenicity of mutations is annotated as pathogenic or potentially pathogenic mutations; ③ Frameshift mutation; ④ Start codon loss / gain mutation; ⑤ Stop codon loss / gain mutation; ⑥ Mutations that affect gene splicing; ⑦ Mutations predicted as "damaging" by the SIFT database; ⑧ Mutations predicted as "damaging" by the MutationTaster database; Through these annotations and screenings, rare and harmful mutations in the genes were eventually identified.

[0092] Further, the rare and harmful mutations obtained above were grouped by gene, and then the association analysis between disease phenotype (i.e. whether or not the disease is present) and gene mutation was performed by gene using STAAR software to find susceptibility genes associated with the onset of familial nasopharyngeal carcinoma, and the information of the individual's sex, age, and the first three principal components was corrected.

[0093] (II) Experimental Results The association analysis yielded 6 Ps. STAAR-O For genes with a p-value less than 0.05, the p-value was obtained through STAAR-S, STAAR-B, and STAAR-A tests combining six different parameters. The specific results are shown in Table 6 below: Table 6: Results of association analysis at the gene level

[0094] All the rare and harmful mutations contained in these genes are shown in Table 7 and Figure 3 As shown: Table 7: Rare and harmful mutation sites of 6 newly discovered susceptibility genes

[0095] Physical location was determined using the hg19 reference genome; site annotation was performed using the ENSEMBL database; and pathogenicity prediction was performed using the ClinVar and InterVar databases.

[0096] II. Validation of the discovered sites using Sanger sequencing (I) Experimental Methods 1. Primer design Referring to the human genome sequence database hg19, the Sanger sequencing primers covering the sites to be tested are shown in Table 8. Table 8. Sanger sequencing primers for each position:

[0097] (2) PCR amplification Twenty samples were randomly selected from the samples that underwent whole exome sequencing. PCR amplification was performed using the primers listed in Table 8 (PCR reaction system is shown in Table 9, PCR reaction conditions are shown in Table 10). The PCR amplification products were subjected to 1% agarose gel electrophoresis. The target fragment was excised, recovered, purified, and then subjected to Sanger sequencing.

[0098] Table 9: PCR Reaction System

[0099] Table 10: PCR reaction conditions

[0100] (II) Experimental Results The verification results are as follows Figure 4 As shown in the partial image, Sanger sequencing revealed that patients in high-incidence families of nasopharyngeal carcinoma do indeed carry rare and harmful mutations in susceptibility genes.

[0101] Example 3: Validation of rare and harmful mutations in six newly discovered susceptibility genes in other nasopharyngeal carcinoma cases. I. Experimental Methods Using published whole-exome sequencing data of nasopharyngeal carcinoma in the database (Accession ID: SRA291701, SRP035573, SRA288429, PRJEB12830, HRA000052, and HRA000053, involving a total of 269 samples), further analysis was conducted on the six genes (RAD54L [Gene ID: 8438, Ensembl: ENSG00000085999], LRRC19 [Gene ID: 64922, Ensembl: ENSG00000184434], CAPN3 [Gene ID: 825, Ensembl: ENSG00000092529], CEP152 [Gene ID: 22995, Ensembl: ENSG00000103995], EML2 [Gene ID: The following experiments were conducted to verify the results of gene analysis using genes 24139, Ensembl: ENSG00000125746, and ZNF135 [Gene ID: 7694, Ensembl: ENSG00000176293]. The specific experimental methods are as follows: 1. Mutation detection of 6 new susceptibility genes The sequence files underwent quality control filtering. The quality-controlled sequences were aligned to the reference genome (hg19) using BWA. Repetitive sequences were marked using PICARD, and alignment and base score corrections were performed using GATK. SNP and indel detection were conducted using GATKHaplotypeCaller, retaining high-quality samples (269 cases) and mutation sites. The gene regions containing the mutations were annotated, and mutations located in six novel susceptibility genes were screened for further analysis.

[0102] 2. Annotation and screening of mutation sites The mutation site annotation and screening methods were used in Example 2, and the mutation sites were annotated using Annovar and VEP software. Through a series of annotations and filtering, rare and harmful mutations with significant impact were obtained.

[0103] II. Experimental Results After annotation and filtering, eight rare mutations with significant impact located in six susceptibility genes were identified in 269 nasopharyngeal carcinoma patients, as shown in Table 11: Table 11 Eight rare and harmful mutations found in 269 patients with nasopharyngeal carcinoma.

[0104] Physical location was determined using the hg19 reference genome; site annotation was performed using the ENSEMBL database; and pathogenicity prediction was performed using the ClinVar and InterVar databases.

[0105] These findings indicate that the six novel nasopharyngeal carcinoma susceptibility genes discovered in Example 2 also exhibit rare and harmful mutations in the nasopharyngeal carcinoma samples of this example.

[0106] Example 4: Relationship between susceptibility genes and rare harmful mutations of nasopharyngeal carcinoma and other tumor-related familial nasopharyngeal carcinoma. I. Experimental Methods In addition, 11 genes associated with the pathogenesis of nasopharyngeal carcinoma and 15 susceptibility genes associated with the pathogenesis of hereditary tumors (involving 15 types of tumors) were also investigated. The list of genes is shown in Table 12. Mutations carried in these 26 genes in the samples described in Example 2 (including 502 patients with familial nasopharyngeal carcinoma, 76 unaffected relatives from high-incidence families, and 328 healthy controls) were screened using the same method as in "Mutation Site Annotation and Screening" in Example 2.

[0107] Table 12 List of 11 genes associated with nasopharyngeal carcinoma and 15 susceptibility genes associated with the development of hereditary tumors

[0108] (II) Experimental Results In the sample described in Example 2 (including 502 patients with familial nasopharyngeal carcinoma, 76 unaffected relatives from high-incidence families, and 328 healthy controls), mutations in these 15 tumor susceptibility genes are shown in Table 13 and... Figure 5 As shown, in 502 patients with familial nasopharyngeal carcinoma, the carrier rate of these 15 gene mutations was 7.17%, while in the unaffected controls, the carrier rate was 2.78%.

[0109] The results showed that individuals carrying 15 genes associated with hereditary tumor development had a 2.18 times higher risk of inheriting nasopharyngeal carcinoma than non-carriers (95% CI: 1.11–4.25). p = 0.02).

[0110] Table 13 Mutation information on 15 tumor susceptibility genes

[0111] Physical location was determined using the hg19 reference genome; site annotation was performed using the ENSEMBL database; and pathogenicity prediction was performed using the ClinVar and InterVar databases.

[0112] Similarly, in the sample described in Example 2 (including 502 patients with familial nasopharyngeal carcinoma, 76 unaffected relatives from high-incidence families, and 328 healthy controls), mutations in 11 genes associated with nasopharyngeal carcinoma were detected, as shown in Table 14 below. In the 502 patients with familial nasopharyngeal carcinoma, the carrier rate of these 11 gene mutations was 7.17%, while in the unaffected controls, the carrier rate was 4.21%. These results indicate that individuals carrying these 11 nasopharyngeal carcinoma susceptibility genes have a 1.76 times higher risk of developing the disease than non-carriers (95% CI: 0.94–3.29, P = 0.08).

[0113] Table 14: Mutation information on 11 nasopharyngeal carcinoma susceptibility genes

[0114] Physical location was determined using the hg19 reference genome; site annotation was performed using the ENSEMBL database; and pathogenicity prediction was performed using the ClinVar and InterVar databases.

[0115] Example 5: Correlation between common mutations and the risk of familial nasopharyngeal carcinoma (I) Experimental Methods In Example 2, a generalized linear mixture model was used to perform association analysis on 502 cases of familial nasopharyngeal carcinoma, 76 unaffected relatives from high-incidence families, and 328 healthy controls. Common mutation sites (SNPs) highly associated with nasopharyngeal carcinoma (NPC) incidence were obtained from the GWAS catalog database, as these mutation sites have a high population frequency. SNPs highly linked to these sites and detected in whole-exome sequencing datasets were also obtained from the 1000 Genomes database. Additionally, HLA alleles associated with familial NPC incidence were extracted from the whole-exome sequencing datasets, and association analysis was performed using these alleles in conjunction with the extracted SNPs.

[0116] (II) Experimental Results After adjusting for gender, age, and principal components, correlation analysis was performed, and the results are shown in Table 15. Table 15: Association Analysis Results of Seven Common Mutations

[0117] Example 6: A risk scoring model for familial nasopharyngeal carcinoma based on a combination of common and rare mutations. I. Experimental Methods In Example 2, among the 502 cases of familial nasopharyngeal carcinoma, 76 unaffected relatives from high-incidence families, and 328 healthy controls, independent samples without kinship were extracted based on the kinship coefficient, totaling 787 cases. These samples were randomly divided into a training set (N=394) and a validation set (N=393).

[0118] A comprehensive genetic risk score (PRSCR) was constructed by combining rare and harmful mutations in the seven newly discovered nasopharyngeal carcinoma susceptibility genes in Examples 1-3, rare and harmful mutations in the 11 genes and 15 tumor susceptibility genes associated with nasopharyngeal carcinoma in Example 4, and common mutations associated with familial nasopharyngeal carcinoma obtained in Example 5.

[0119] The optimized combined risk score (PRSCR) for familial nasopharyngeal carcinoma based on common and rare mutations is as follows: PRSCR = 1.0856 × PRSC + 2.5053 × Gene_score1 + 0.6319 × Gene_score2 + 0.7766 × Gene_score3, Wherein, PRSC is a score constructed using a multiple regression method based on common mutations obtained in Example 5: PRSC = (4.343E-05×rs402710 genotype score) + (0.2901×rs2747421 genotype score) + (0.8246×rs564398 genotype score) + (0.6154×A*11:01 genotype score) + (1.4355×A*02:07 genotype score) + (0.0233×C*01:02 genotype score) + (1.1258×C*03:02 genotype score). The PRSC score is assigned as follows: no risk allele = "0", one risk allele = "1", two risk alleles = "2". Gene_score1 indicates whether an individual carries any rare harmful mutation among the seven newly discovered susceptibility genes (POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, and ZNF135). Carrying any one of these mutations results in a value of 1, while not carrying one results in a value of 0. Gene_score2 indicates whether an individual carries any of the 11 genes associated with nasopharyngeal carcinoma (MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPA). The variable is 1 for carriers and 0 for non-carriers. Gene_score3 indicates whether an individual carries any rare and harmful mutation among the other 15 tumor-related susceptibility genes (ERCC2, TP63, MUTYH, BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, and LZTR1). The variable is 1 for carriers and 0 for non-carriers.

[0120] Furthermore, PRSCR was used to assess the risk of nasopharyngeal carcinoma on the training set samples (N=394) and the validation set samples (N=393).

[0121] The relative risk of nasopharyngeal carcinoma (NPC) for each group estimated from the validation set samples was mapped to the population cumulative risk using the "iCARE" method to estimate the lifetime cumulative incidence rate of NPC for individuals. The age-specific NPC incidence rates for men and women were obtained from IARC's *Cancer Incidence Studies Across Five Continents*, Volume 11 (http: / / ci5.iarc.fr / CI5.×I / Pages / age.specific.curves_sel.asp).

[0122] II. Experimental Results Using logistic regression analysis, the quantile effect of the combined genetic risk score for familial nasopharyngeal carcinoma (PRSCR) in the training set (N=394) is shown in Table 16. The results show that in the training set, individuals with a combined PRSCR score between the 75th and 90th percentiles had a significantly higher risk of developing the disease than those with a score in the lowest 25th percentile (8.94-fold relative risk). Individuals with a combined PRSCR score between the 90th and 95th percentiles had a significantly higher risk than those with a score in the lowest 25th percentile (15.6-fold relative risk). Individuals with a combined PRSCR score in the highest 5th percentile had a significantly higher risk than those with a score in the lowest 25th percentile (27.3-fold relative risk). This suggests that the combined PRSCR score can effectively identify high-risk individuals for nasopharyngeal carcinoma in the training set.

[0123] Table 16: Percentile Effects of PRSCR in the Training Set

[0124] Next, the joint scoring model was validated in the validation set (N=393). Logistic regression analysis was used to obtain the quantile effect of the familial nasopharyngeal carcinoma genetic risk joint score (PRSCR) in the validation set, as shown in Table 17. Figure 6 As shown in the results, in the validation set, individuals with a combined PRSCR score between the 75th and 90th percentiles had a significantly higher risk of developing nasopharyngeal carcinoma than those with a score in the lowest 25th percentile (6.19-fold relative risk). Individuals with a combined PRSCR score between the 90th and 95th percentiles had a significantly higher risk than those with a score in the lowest 25th percentile (6.97-fold relative risk). Individuals with a combined PRSCR score in the highest 5th percentile had a significantly higher risk than those with a score in the lowest 25th percentile (21.3-fold relative risk). This indicates that the combined score's ability to identify high-risk individuals for nasopharyngeal carcinoma was well validated in the validation set.

[0125] Table 17: Percentile Effect of the Combined Score of Common and Rare Mutations (PRSCR) on the Validation Set

[0126] Based on the percentage effect of the aforementioned combined score in the validation set, the lifetime cumulative incidence of nasopharyngeal carcinoma for individuals was estimated, and the results are as follows: Figure 6 As shown in Table 18, the results indicate that men with a combined score in the lowest 25th percentile have a lifetime cumulative risk of nasopharyngeal carcinoma (NPC) of only 0.81%, while men with combined scores in the 75%-90% and 90%-95% ranges have lifetime cumulative NPC risks of 5.79% and 9.10%, respectively. For men with a combined score in the highest 5%, the lifetime cumulative NPC risk reaches 26.87%. Based on these estimates, individuals with a score of 4.10-5.03 (with a lifetime cumulative incidence rate of 5.79%-9.10%) are defined as having a medium-to-high risk of NPC, and individuals with a score greater than 5.03 (with a lifetime cumulative incidence rate of 26.87%) are defined as having a very high risk of NPC. A similar trend was observed in women. Figure 6 ).

[0127] Table 18: Lifetime cumulative incidence of nasopharyngeal carcinoma in individuals with different scores

[0128] In summary, the genetic risk score for familial nasopharyngeal carcinoma constructed by combining common and rare mutations has the efficacy of identifying high-risk individuals for familial nasopharyngeal carcinoma.

[0129] Example 7: A method for nasopharyngeal carcinoma susceptibility gene detection and genetic risk assessment S1. Sample DNA extraction; Collect samples containing human DNA from the test subject, such as whole blood, blood clots, serum, plasma, saliva, oropharyngeal swabs, nasopharyngeal swabs, nasopharyngeal smears, urine, or feces, and perform the procedures according to standard methods.

[0130] Specifically, DNA was extracted from the sample using the Qiagen DNA midi kit (100). Quantification was performed using a spectrophotometer, and quality control was conducted using agarose gel electrophoresis. Genomic DNA bands were typically no less than 20 kb. The quality-controlled DNA was then adjusted to a concentration of 50 ng / μl, transferred to 384-well plates, and stored at -80°C for later use.

[0131] S2. Liquid phase capture and library preparation for sequencing: Use the NadPrep® DNA Universal Library Construction Kit (for Illumina®) to construct the library according to the instructions.

[0132] Specifically, the sample DNA was fragmented using sonication. The fragmented DNA underwent end repair and A-tailing enzyme addition, followed by ligation with sequencing adapters. The ligation products were purified and amplified by PCR. The amplified products were then purified and quality-checked. Using NadPrep® Hybrid Capture Reagents and NadPrep® NanoBlockers (for Illumina®), the library and target region probes were hybridized and captured according to the manufacturer's instructions. After capture, the library was eluted, and the captured products were amplified by PCR. Library purification was performed using magnetic beads provided by the NadPrep SP Beads kit, and library quantification and quality control were performed using Qubit. The qualified library products were then subjected to next-generation sequencing using the Illumina Novaseq platform. The captured DNA probes are shown in Table 19 below. Table 19: 103 capture regions of 37 genes (i.e., DNA probe information)

[0133] S3. Sequencing data processing: The sequencing data obtained from S2 were compared with the hg19 reference genome, and mutation detection was performed using GATK to obtain the genotypes of the sites listed in Table 20.

[0134] Table 20: Mutation site information for 37 genes detected

[0135] S4. Genetic Risk Rating Scale (PRSCR) The rare and common mutations in relevant genes were statistically analyzed, and the genetic risk score (PRSCR) for familial nasopharyngeal carcinoma was calculated using the following risk scoring formula: PRSCR = 1.0856 × PRSC + 2.5053 × Gene_score1 +0.6319 × Gene_score2+ 0.7766 × Gene_score3; in, PRSC = (4.343E-05×rs402710 genotype score) + (0.2901×rs2747421 genotype score) + (0.8246×rs564398 genotype score) + (0.6154×A*11:01 genotype score) + (1.4355×A*02:07 genotype score) + (0.0233×C*01:02 genotype score) + (1.1258×C*03:02 genotype score); For PRSC, genotype scores for 7 common mutations are assigned as follows: no risk allele = "0", one risk allele = "1", and two risk alleles = "2". Gene_score1 is a score for rare and harmful mutations in an individual carrying seven newly discovered nasopharyngeal carcinoma susceptibility genes (POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, and ZNF135). If any one of the seven genes has a rare and harmful mutation, the score is 1; if none of the seven genes have a rare and harmful mutation, the score is 0. Gene_score2 is a score for rare and harmful mutations in 11 nasopharyngeal carcinoma susceptibility genes (MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPAL1, NOTCH1, and PRKDC) in an individual. If any of the 11 genes has a rare and harmful mutation, the score is 1; if no rare and harmful mutations are found in any of the 11 genes, the score is 0. Gene_score3 is a score indicating whether an individual carries rare and harmful mutations in 15 tumor susceptibility genes (ERCC2, TP63, MUTYH, BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, and LZTR1). A score of 1 is assigned if any one of the 15 genes contains a rare and harmful mutation, and a score of 0 is assigned if none of the 15 genes contain such mutations. Detailed information on all the above mutations is shown in Table 20.

[0136] S5. Result Determination Based on the calculated genetic risk score for familial nasopharyngeal carcinoma, when the PRSCR score is higher than 5.03, the individual's lifetime cumulative risk of developing nasopharyngeal carcinoma is on average 26.87%, and the individual is identified as a high-risk individual for nasopharyngeal carcinoma. When the score is between 4.10 and 5.03, the individual's lifetime cumulative risk of developing nasopharyngeal carcinoma is on average 5.79%-9.10%, and the individual is identified as a medium-to-high-risk individual for nasopharyngeal carcinoma.

[0137] Example 8: A method for nasopharyngeal carcinoma susceptibility gene detection and genetic risk assessment S1. Sample DNA extraction; Same as Example 7; S2. Liquid phase capture and library preparation for sequencing: Same as Example 7, except for the capture area. The captured DNA probes are shown in Table 21 below.

[0138] Table 21: DNA probes for 772 capture regions of 37 genes

[0139] The captured region includes 37 genes: POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, ZNF135, ERCC2, TP63, MUTYH, BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, LZTR1, MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPAL1, NOTCH1, PRKDC, HLA-A, HLA-C, CDKN2B-AS1, and ZFP57.

[0140] S3. Sequencing data processing: The sequencing data obtained from S2 were compared with the hg19 reference genome, and mutation detection was performed using GATK to identify mutations. Further analysis revealed mutations in nasopharyngeal carcinoma-related genes, including common and rare harmful mutations associated with nasopharyngeal carcinoma development. The common mutations mentioned are: rs402710, rs2747421, rs564398, A*11:01, A*02:07, C*01:02, and C*03:02. For details, please refer to Table 22. Table 22: Information on common mutations

[0141] Rare and harmful mutations are defined as those with a MAF < 0.5% in East Asians and that meet at least one of the following criteria: In the ClinVar database, the pathogenicity of a mutation is noted as a pathogenic or potentially pathogenic mutation; In the InterVar database, the pathogenicity of a mutation is noted as a pathogenic or potentially pathogenic mutation; Frameshift mutation; Start codon loss / gain mutation; Stop codon loss / gain mutation; Mutations that affect gene splicing; Mutations predicted as "damaging" by the SIFT database; Mutations predicted as "damaging" by the MutationTaster database; S4. Genetic Risk Rating Scale (PRSCR) The rare and common mutations in relevant genes were statistically analyzed, and the genetic risk score (PRSCR) for familial nasopharyngeal carcinoma was calculated using the following risk scoring formula: PRSCR = 1.0856 × PRSC + 2.5053 × Gene_score1 +0.6319 × Gene_score2+ 0.7766 × Gene_score3; in, PRSC = (4.343E-05×rs402710 genotype score) + (0.2901×rs2747421 genotype score) + (0.8246×rs564398 genotype score) + (0.6154×A*11:01 genotype score) + (1.4355×A*02:07 genotype score) + (0.0233×C*01:02 genotype score) + (1.1258×C*03:02 genotype score); For PRSC, genotype scores for 7 common mutations are assigned as follows: no risk allele = "0", one risk allele = "1", and two risk alleles = "2". Gene_score1 is a score for rare and harmful mutations in an individual carrying seven newly discovered nasopharyngeal carcinoma susceptibility genes (POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, and ZNF135). If any one of the seven genes has a rare and harmful mutation, the score is 1; if none of the seven genes have a rare and harmful mutation, the score is 0. Gene_score2 is a score for rare and harmful mutations in 11 nasopharyngeal carcinoma susceptibility genes (MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPAL1, NOTCH1, and PRKDC) in an individual. If any of the 11 genes has a rare and harmful mutation, the score is 1; if no rare and harmful mutations are found in any of the 11 genes, the score is 0. Gene_score3 is a score indicating whether an individual carries rare and harmful mutations in 15 tumor susceptibility genes (ERCC2, TP63, MUTYH, BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, and LZTR1). A score of 1 is assigned if any one of the 15 genes contains a rare and harmful mutation, and a score of 0 is assigned if none of the 15 genes contain such mutations. S5. Result Determination Based on the calculated genetic risk score for familial nasopharyngeal carcinoma, when the PRSCR score is higher than 5.03, the individual's lifetime cumulative risk of developing nasopharyngeal carcinoma is on average 26.87%, and the individual is identified as a high-risk individual for nasopharyngeal carcinoma. When the score is between 4.10 and 5.03, the individual's lifetime cumulative risk of developing nasopharyngeal carcinoma is on average 5.79%-9.10%, and the individual is identified as a medium-to-high-risk individual for nasopharyngeal carcinoma.

[0142] Example 9: A liquid-phase capture chip kit for assessing the genetic risk of nasopharyngeal carcinoma The kit of this invention includes: a liquid-phase capture chip for detecting the exons and exon-intron junctions of 37 genes in the human genome, and DNA probes for capturing them. The 37 genes are: POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, ZNF135, ERCC2, TP63, MUTYH, BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, LZTR1, MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPAL1, NOTCH1, PRKDC, HLA-A, HLA-C, CDKN2B-AS1, and ZFP57. The capture region (i.e., DNA probe) information is shown in Table 21.

[0143] (I) Preparation of the reagent kit 1. Design and synthesis of capture probes Liquid-phase hybridization capture probes were designed using the Nanoda XCapert online probe design cloud platform. Candidate regions were covered with 1× probes, and probe encryption was performed for indels longer than 6 bp. The DNA probes listed in Table 21 were synthesized using chemical synthesis methods and underwent quality control.

[0144] 2. Construction of the reagent kit Other components of the kit include: fragmented DNA end repair & A-addition reagent, adapter ligation reagent and Unique Dual Indexe (UDI) adapters for the Illumina platform, ligation product purification reagent, PCR amplification reagent, library purification reagent, library hybridization reagent, and capture reagent.

[0145] (II) Detection Methods 1. DNA extraction DNA was extracted from the sample using the Qiagen DNA midi kit (100). Quantification was performed using a spectrophotometer, and quality control was conducted using agarose gel electrophoresis. Genomic DNA bands were typically no less than 20 kb. The quality-controlled DNA was then adjusted to a concentration of 50 ng / μl, transferred to 384-well plates, and stored at -80°C for later use.

[0146] 2. Library construction and next-generation sequencing Library construction was performed using the NadPrep® DNA Universal Library Construction Kit (for Illumina®) according to the manufacturer's instructions. Specifically, sample DNA was fragmented using sonication, and the fragmented DNA was end-repaired and A-tailing added using the End Repair & A-Tailing Enzyme, followed by ligation with sequencing adapters. The ligation products were purified and PCR amplified, and the amplified products were purified and quality-controlled.

[0147] Using NadPrep® Hybrid Capture Reagents and NadPrep® NanoBlockers (for Illumina®) kits, hybridization capture of the library and DNA probes in Table 21 was performed according to the instructions. After capture, the library was eluted, and the captured products were amplified by PCR. The library was purified using magnetic beads provided by the NadPrep SP Beads kit, and the library was quantitatively tested using Qubit.

[0148] For qualified library products, next-generation sequencing was performed using the Illumina Novaseq platform.

[0149] 3. Site detection The obtained sequencing data were compared with the hg19 reference genome, and mutation detection was performed using GATK. Genotyping was performed on the sites listed in Table 20.

[0150] 4. Genetic risk assessment for nasopharyngeal carcinoma Same as Example 8.

[0151] Example 10: Application of a liquid-phase capture array kit for assessing the genetic risk of nasopharyngeal carcinoma Using the liquid-phase capture chip kit for predicting the risk of familial nasopharyngeal carcinoma as described in Example 9, DNA extracted from samples of 5 patients with familial nasopharyngeal carcinoma was captured, library constructed, and sequenced. The average data volume per sample was 0.5 G. The average Q30 of the samples was 93.88%, the alignment rate was 97.37%, the target hit rate was 84.32%, and the candidate region coverage was 100%, indicating good data quality. Specific data quality results are shown in Table 23 below. Table 23: Data quality of the kit in 5 test samples

[0152] Using the nasopharyngeal carcinoma susceptibility gene detection and genetic risk assessment method described in Example 8, the sequencing data was first processed, including comparing the sequencing data with the hg19 reference genome, using GATK to detect mutations in the coverage regions listed in Table 21, and annotating all obtained sites. Common mutations were screened: genotyping results for rs402710, rs2747421, rs564398, A*11:01, A*02:07, C*01:02, and C*03:02; rare and harmful variants were screened according to the rules described in Example 8. The presence of rare and harmful mutations and common mutations in relevant genes was statistically analyzed, and the genetic risk score (PRSCR) for familial nasopharyngeal carcinoma was calculated using the risk scoring formula in Example 8. Risk was determined based on the calculated PRSCR. The scoring results showed that the scores of these five familial nasopharyngeal carcinoma patients were higher than the 95th percentile of 5.03 in the population, and these five individuals were determined to be high-risk individuals for nasopharyngeal carcinoma.

[0153] Example 11: A liquid-phase capture chip kit for assessing the genetic risk of nasopharyngeal carcinoma The kit described in this invention includes a liquid-phase capture chip, and the DNA probes used for capture are shown in Table 19: (I) Preparation of the reagent kit 1. Design and synthesis of capture probes Same as Example 9.

[0154] 2. Construction of the reagent kit Same as Example 9.

[0155] (II) Detection Methods Same as in Example 10, except that the DNA probe is replaced with the DNA probe in Table 19.

[0156] Example 12 A nasopharyngeal carcinoma genetic risk assessment system It contains a sample DNA preparation module, a liquid phase capture and library construction sequencing module, a sequencing data processing module, a genetic risk score calculation module for familial nasopharyngeal carcinoma, and a result determination module connected in sequence. in, (1) Sample DNA preparation module: Extract DNA from samples containing human DNA, such as whole blood, blood clots, serum, plasma, saliva, oropharyngeal swabs, nasopharyngeal swabs, nasopharyngeal smears, urine or feces. (2) Liquid phase capture and library construction sequencing module: used to capture and construct libraries for DNA obtained from the sample DNA preparation module (the capture region is the DNA probe, and the information is shown in Table 21), and transmit the sequencing data to the sequencing data processing module. The target region for sequencing includes 37 genes: POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, ZNF135, ERCC2, TP63, MUTYH, BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, LZTR1, MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPAL1, NOTCH1, PRKDC, HLA-A, HLA-C, CDKN2B-AS1 and ZFP57; (3) Sequencing data processing module: This module processes the data obtained from the liquid phase capture and library construction sequencing modules. The obtained data were compared with the reference genome hg19, and mutation detection was performed using GATK to further identify mutations in nasopharyngeal carcinoma-related genes, including common mutations and rare harmful mutations associated with the pathogenesis of nasopharyngeal carcinoma. Among them, the common mutations are: rs402710, rs2747421, rs564398, A*11:01, A*02:07, C*01:02, and C*03:02. Specific information is shown in Table 22. Rare and harmful mutations are defined as those with a MAF < 0.5% in East Asians and that meet at least one of the following criteria: In the ClinVar database, the pathogenicity of a mutation is annotated as pathogenic or potentially pathogenic. In the InterVar database, the pathogenicity of mutations is noted as pathogenic or potentially pathogenic. Frameshift mutation, Start codon loss / gain mutation Stop codon loss / acquisition mutation Mutations that affect gene splicing Mutations predicted as "damaging" by the SIFT database. Mutations predicted as "damaging" by the MutationTaster database. The genotyping results are fed into the genetic risk score calculation module for familial nasopharyngeal carcinoma; (4) Genetic risk score calculation module for familial nasopharyngeal carcinoma: Based on the common and rare harmful mutations in 37 genes, the genetic risk score for familial nasopharyngeal carcinoma is calculated using the following risk score formula: PRSCR = 1.0856 × PRSC +2.5053 × Gene_score1 + 0.6319 × Gene_score2+ 0.7766 × Gene_score3; in, PRSC = (4.343E-05×rs402710 genotype score) + (0.2901×rs2747421 genotype score) + (0.8246×rs564398 genotype score) + (0.6154×A*11:01 genotype score) + (1.4355×A*02:07 genotype score) + (0.0233×C*01:02 genotype score) + (1.1258×C*03:02 genotype score) Among them, the genotype scores for the seven common mutations are assigned as follows: no risk allele = "0", one risk allele = "1", and two risk alleles = "2".

[0157] Furthermore, for PRSCR, Gene_score1 is a score for rare and harmful mutations in an individual carrying seven newly discovered nasopharyngeal carcinoma susceptibility genes (POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, and ZNF135). If any one of the seven genes has a rare and harmful mutation, the score is 1; if none of the seven genes have a rare and harmful mutation, the score is 0. Gene_score2 is a score for rare and harmful mutations in 11 nasopharyngeal carcinoma susceptibility genes (MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPAL1, NOTCH1, and PRKDC) in an individual. If any of the 11 genes has a rare and harmful mutation, the score is 1; if no rare and harmful mutations are found in any of the 11 genes, the score is 0. Gene_score3 is a score for whether an individual carries rare and harmful mutations in 15 tumor susceptibility genes (ERCC2, TP63, MUTYH, BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, and LZTR1). If any of the 15 genes has a rare and harmful mutation, the score is 1; if none of the 15 genes have a rare and harmful mutation, the score is 0.

[0158] The obtained genetic risk score (PRSCR) results are output to the results output display module.

[0159] (5) Result output display module: Based on the calculated genetic risk score of familial nasopharyngeal carcinoma, when the score is higher than 5.03, the individual's lifetime cumulative risk of nasopharyngeal carcinoma is 26.87% on average, and the individual is judged to be a high genetic risk individual for nasopharyngeal carcinoma. When the score is between 4.10 and 5.03, the individual's lifetime cumulative risk of nasopharyngeal carcinoma is 5.79%-9.10% on average, and the individual is judged to be a medium-high genetic risk individual for nasopharyngeal carcinoma.

[0160] Example 13 A nasopharyngeal carcinoma genetic risk assessment system It contains a sample DNA preparation module, a liquid phase capture and library construction sequencing module, a sequencing data processing module, a genetic risk score calculation module for familial nasopharyngeal carcinoma, and a result determination module connected in sequence. in, (1) Sample DNA preparation module: Extract DNA from samples containing human DNA, such as whole blood, blood clots, serum, plasma, saliva, oropharyngeal swabs, nasopharyngeal swabs, nasopharyngeal smears, urine, and feces. (2) Liquid phase capture and library construction sequencing module: Same as in Example 12, except that the capture region, i.e. the DNA probe, is different. Information is shown in Table 19.

[0161] (3) Sequencing data processing module: The data obtained by the liquid phase capture and library construction sequencing module is processed, the obtained data is compared with the reference genome hg19, mutation detection is performed using GATK, the genotypes of mutation sites in Table 20 are obtained, and the genotype results are sent to the genetic risk score calculation module for familial nasopharyngeal carcinoma. (4) Genetic risk score calculation module for familial nasopharyngeal carcinoma: Based on the presence of common and rare harmful mutations in each relevant gene, the genetic risk score for familial nasopharyngeal carcinoma is calculated using the following risk score formula: PRSCR = 1.0856 × PRSC +2.5053 × Gene_score1 + 0.6319 × Gene_score2+ 0.7766 × Gene_score3; in, PRSC = (4.343E-05×rs402710 genotype score) + (0.2901×rs2747421 genotype score) + (0.8246×rs564398 genotype score) + (0.6154×A*11:01 genotype score) + (1.4355×A*02:07 genotype score) + (0.0233×C*01:02 genotype score) + (1.1258×C*03:02 genotype score) Among them, the genotype scores for the seven common mutations are assigned as follows: no risk allele = "0", one risk allele = "1", and two risk alleles = "2".

[0162] Gene_score1 is a score for rare and harmful mutations in an individual carrying seven newly discovered nasopharyngeal carcinoma susceptibility genes (POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, and ZNF135). If any one of the seven genes has a rare and harmful mutation, the score is 1; if none of the seven genes have a rare and harmful mutation, the score is 0. Gene_score2 is a score for rare and harmful mutations in 11 nasopharyngeal carcinoma susceptibility genes (MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPAL1, NOTCH1, and PRKDC) in an individual. If any of the 11 genes has a rare and harmful mutation, the score is 1; if no rare and harmful mutations are found in any of the 11 genes, the score is 0. Gene_score3 is a score indicating whether an individual carries rare and harmful mutations in 15 tumor susceptibility genes (ERCC2, TP63, MUTYH, BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, and LZTR1). A score of 1 is assigned if any one of the 15 genes contains a rare and harmful mutation, and a score of 0 is assigned if none of the 15 genes contain such mutations. The obtained genetic risk score (PRSCR) results are output to the results output display module.

[0163] (5) Result output display module: Based on the calculated genetic risk score of familial nasopharyngeal carcinoma, when the score is higher than 5.03, the individual's lifetime cumulative risk of nasopharyngeal carcinoma is 26.87% on average, and the individual is judged to be a high genetic risk individual for nasopharyngeal carcinoma. When the score is between 4.10 and 5.03, the individual's lifetime cumulative risk of nasopharyngeal carcinoma is 5.79%-9.10% on average, and the individual is judged to be a medium-high genetic risk individual for nasopharyngeal carcinoma.

[0164] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A nasopharyngeal carcinoma genetic risk assessment system, characterized in that, It includes modules for sample DNA preparation, mutation site detection, genetic risk score calculation, and result interpretation. (1) The sample DNA preparation module is used to extract sample DNA to obtain sample DNA; (2) The mutation site detection module is used to determine the mutation status of genes in the sample DNA obtained by the sample DNA preparation module, and transmits the obtained gene mutation status data to the genetic risk score calculation module. The mutations include common and rare harmful mutations associated with the development of nasopharyngeal carcinoma: Among them, the common mutations are: rs402710, rs2747421, rs564398, A*11:01, A*02:07, C*01:02, C*03:02; The rare and harmful mutation is a rare mutation in East Asians with a MAF < 0.5%, and meets at least one of the following criteria: In the ClinVar database, the pathogenicity of a mutation is noted as a pathogenic or potentially pathogenic mutation; In the InterVar database, the pathogenicity of a mutation is noted as a pathogenic or potentially pathogenic mutation; Frameshift mutation; Start codon loss / gain mutation; Stop codon loss / gain mutation; Mutations that affect gene splicing; Mutations predicted as "damaging" by the SIFT database; Mutations predicted as "damaging" by the MutationTaster database; Information on the common mutations is shown in the table below: (3) Genetic risk score calculation module, which calculates the genetic risk score using the gene mutation information obtained by the mutation site detection module, and transmits the obtained genetic risk score data to the result judgment module. The formula for calculating the genetic risk score is: PRSCR = 1.0856 × PRSC + 2.5053 × Gene_score1 + 0.6319 × Gene_score2 + 0.7766 × Gene_score3; in, PRSC = (4.343E-05×rs402710 genotype score) + (0.2901×rs2747421 genotype score) + (0.8246×rs564398 genotype score) + (0.6154×A*11:01 genotype score) + (1.4355×A*02:07 genotype score) + (0.0233×C*01:02 genotype score) + (1.1258×C*03:02 genotype score). For PRSC, genotype scores for 7 common mutations are assigned as follows: no risk allele = 0, one risk allele = 1, two risk alleles = 2. Gene_score1 is assigned as follows: if an individual has a rare and harmful mutation in any of the seven genes POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, and ZNF135, the score is 1; if no rare and harmful mutations are found in any of these seven genes, the score is 0. Gene_score2 is assigned as follows: if an individual has a rare and harmful mutation in any of the 11 genes MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPAL1, NOTCH1, or PRKDC, the score is 1; if no rare and harmful mutations are found in any of these 11 genes, the score is 0. Gene_score3 assigns a score of 1 if an individual carries any one of the following 15 genes: ERCC2, TP63, MUTYH, BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, and LZTR1, and any rare or harmful mutation exists in any of these genes. If no rare or harmful mutation exists in any of these 15 genes, the score is 0. (4) Result determination module, used to determine the result based on the PRSCR result. When the PRSCR score is higher than 5.03, the lifetime cumulative risk of nasopharyngeal carcinoma is 26.87% and the individual is determined to be a high genetic risk individual for nasopharyngeal carcinoma. When the score is between 4.10 and 5.03, the lifetime cumulative risk of nasopharyngeal carcinoma is 5.79%-9.10% and the individual is determined to be a medium-high genetic risk individual for nasopharyngeal carcinoma. The seven genes POLN, RAD54L, LRRC19, CAPN3, CEP152, EML2, and ZNF135 have rare and harmful mutations as follows: rs377642893, rs1206463301, rs146182235, rs371935755, rs28363218, 9:26997984:C:T, rs1401668672, rs768472959, rs747062991, rs181427104, rs1557706222, rs34761954, rs752087698, 9:26997927:T:A, 9:26999686:CT: C, rs80338803, rs200379491, rs587780290, rs137967275, rs182018947, 15:49081061:G:C, 15:49089736:CA:C, 19:46136147:GCT:G, rs141293445 0,rs1276533174,rs770181520,19:58579293:C:CT,rs762687232,rs7588 82072, rs777483913, rs537376932, 15:49060526:G:A and 15:49076307:T:-; The rare and harmful mutations in the 11 genes MST1R, MLH1, BCL2L12, BRD2, CLPTM1L, DLL3, HNRNPU, ITGB6, NIPAL1, NOTCH1, and PRKDC are rs760669739, rs188076755, rs764843609, rs4986984, rs63751657, rs773053723, rs201024956, rs34350470, rs200626206, and rs 35924402, rs200046052, rs572130928, rs556842110, 19:39989887:-:C, rs771347725, rs1199048959, rs20139777 3, 19:50176987:G:C, rs763246446, rs200757776, rs778675391, 5:1338049:-:A, rs530094595 and 9:139390923:C:A; The rare and harmful mutations in the 15 genes ERCC2, TP63, MUTYH, BRCA1, GBA, ERBB4, FANCA, TP53, CHEK2, MPL, CDC73, MSH6, ABCB11, COL7A1, and LZTR1 are rs763144679, rs753018650, rs776487884, rs762307622, ​​and rs 587780088, rs773409311, rs364897, 1:193218892:C:T, rs63750617, rs752043324, rs144 311212, rs267599192, rs535202189, rs374718902, rs751535193, rs146407483, 3:1894565 62:G:A, rs576449010, rs565094952, rs767906723, rs182657062, 16:89816189:G:A, rs13 8729528, 17:7579494:A:G, rs80357590, rs80358181, rs80357966, rs879254224, rs201392 911, rs537616689, rs557601608, 19:45856397:G:T, rs751318902, rs200895828, rs771182 769, rs139884931, rs150000483, rs781431741, rs148677674, rs587780192 and rs764884641.

2. The nasopharyngeal carcinoma genetic risk assessment system according to claim 1, characterized in that, The mutation site detection module includes a library preparation and sequencing submodule and a sequencing data processing submodule. The library construction and sequencing submodule is used to construct libraries and sequence DNA obtained from the sample DNA preparation module, and transmit the data to the sequencing data processing submodule. The sequencing data processing submodule is used to process sequencing data and determine the site variations of common mutations and rare harmful mutations as described in claim 1.

3. The nasopharyngeal carcinoma genetic risk assessment system according to claim 1, characterized in that, Information on each rare and harmful mutation site is shown in the table below: 。 4. The application of the nasopharyngeal carcinoma genetic risk assessment system of claim 1 in the preparation of the following products, characterized in that, The product is one or more of the following: Products for assessing individual risk of nasopharyngeal carcinoma; Products related to genetic counseling for families with a high risk of nasopharyngeal carcinoma; Products that support clinical treatment decisions for nasopharyngeal carcinoma.

5. A product for assessing the genetic risk of nasopharyngeal carcinoma, characterized in that, The system comprising claim 1.

Images