Core SNP marker set for industrial hemp variety identification developed based on KASP technology

Abstract

A core SNP marker set for industrial hemp variety identification developed based on the KASP technology. The present invention provides a reagent for detecting SNP sites, and the reagent is used for detecting one or several of the SNP sites 1 to 33. By performing whole-genome resequencing on representative domestic and foreign cannabis germplasm resources, SNP sites are obtained. Based on three screening criteria: a detection rate reaching 100%, a minor allele frequency > 0.4, and uniform distribution on each chromosome, 32 core SNP sites are finally obtained, corresponding primers are designed, and KASP detection is carried out. In addition, based on the sequence polymorphisms of the two alleles CBDAS and THCAS, a specific SNP site for identifying low-toxicity cannabis is obtained, corresponding primers are designed, and KASP detection is carried out. This SNP molecular marker set not only enriches the industrial hemp molecular markers, but also can be widely applied to aspects such as genotyping, molecular identification, purity detection, SNP fingerprint library construction, and molecular marker-assisted breeding of industrial hemp varieties.

Description

Technical Field

[0001] The patent of this invention relates to the field of molecular biology technology, and specifically to a core SNP marker set developed based on KASP technology for the identification of industrial hemp varieties. Background Art

[0002] Hemp (Cannabis sativa L.), also known as fire hemp, thread hemp, cold hemp, and Chinese hemp, is an annual herbaceous plant of the genus Cannabis in the family Cannabaceae. Industrial hemp refers to a type of cannabis crop that has been genetically modified to have a tetrahydrocannabinol (THC) content of less than 0.3% in the dry matter of the leaves and inflorescences at the top of the flowering period, making it unsuitable for drug use. While industrial hemp has no drug value, it has broad applications in textiles, building materials, composite materials, food, medicine, daily chemicals, and soil remediation.

[0003] With the rapid growth in the number of industrial hemp varieties in recent years, there is an urgent need to develop precise identification technology for industrial hemp varieties to protect the intellectual property rights of new varieties and promote the safe and healthy development of the industry.

[0004] With the development of genomics and molecular biology, molecular marker technology has been widely used in applications such as genetic diversity analysis of germplasm resources, variety identification, and gene mining. Plant genomes contain abundant single-base insertions, deletions, transitions, and transversions. Single nucleotide polymorphism (SNP) molecular marker sites developed using these variations offer high accuracy, flexibility, and high throughput. Competitive allele-specific PCR (KASP) is a third-generation molecular marker technology based on SNP analysis. This technology utilizes touch-down PCR combined with a fluorescent quenching probe to generate a fluorescent signal based on the specific matching of primer terminal bases to type SNPs.

[0005] Based on the identification of SNP sites in the whole genome of the cannabis population, the present invention screened out 32 core SNP sites and designed one industrial hemp-specific SNP site (i.e., a site with a THC content of <0.3%). The 33 SNP sites were successfully converted into KASP markers. This group of KASP markers can accurately identify the genotypes of corresponding sites in different industrial hemp varieties (or resources), and is applied to multiple aspects such as molecular identification of industrial hemp varieties, variety purity detection, variety fingerprint library construction, and genetic screening of germplasm resources.

[0006] Invention patent content

[0007] Based on scientific and technological development and industrial needs, the present invention proposes a core SNP marker set for industrial hemp variety identification developed based on KASP technology. Based on the above SNP molecular marker set, the identification and evaluation of industrial hemp varieties can be achieved.

[0008] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0009] The present invention provides a core SNP marker set for industrial hemp variety identification developed based on the KASP technology. The industrial hemp core SNP molecular marker set includes 33 SNP markers, and the numbers of the 33 SNP markers are SNP1 to 33. The 33 SNP loci are as follows:

[0010] The SNP locus 1 is marked with the base T / C and is located at the 6,624,289th position of the hemp genome sequence NC_044371.1;

[0011] The SNP locus 2 is marked with the base A / T and is located at the 21,262,401st position of the hemp genome sequence NC_044371.1;

[0012] The SNP locus 3 is marked with the base G / T and is located at the 37,500,524th position of the hemp genome sequence NC_044371.1;

[0013] The SNP locus 4 is marked with the base G / A and is located at the 53,677,172nd position of the hemp genome sequence NC_044371.1;

[0014] The SNP locus 5 is marked with the base T / C and is located at the 74,696,814th position of the hemp genome sequence NC_044371.1;

[0015] The SNP locus 6 is marked with the base C / T and is located at the 76,426,692nd position of the hemp genome sequence NC_044371.1;

[0016] The SNP locus 7 is marked with the base T / A and is located at the 83,675,323rd position of the hemp genome sequence NC_044371.1;

[0017] The SNP locus 8 is marked with the base G / A and is located at the 100,945,616th position of the hemp genome sequence NC_044371.1;

[0018] The SNP locus 9 is marked with the base G / T and is located at the 17,100,309th position of the hemp genome sequence NC_044375.1;

[0019] The SNP locus 10 is marked with the base A / G and is located at the 26,654,317th position of the hemp genome sequence NC_044375.1;

[0020] The SNP locus 11 is marked with the base T / C and is located at the 46,646,746th position of the hemp genome sequence NC_044375.1;

[0021] The SNP locus 12 is labeled with the base G / A and is located at position 88901914 of the cannabis genome sequence NC_044375.1;

[0022] The SNP locus 13 is labeled with the base A / T and is located at position 92822053 of the cannabis genome sequence NC_044375.1;

[0023] The SNP locus 14 is labeled with the base A / T and is located at position 1880066 of the cannabis genome sequence NC_044372.1;

[0024] The SNP locus 15 is labeled with the base G / A and is located at position 3603067 of the cannabis genome sequence NC_044372.1;

[0025] The SNP locus 16 is labeled with the base C / T and is located at position 7557384 of the cannabis genome sequence NC_044372.1;

[0026] The SNP locus 17 is labeled with the base G / A and is located at position 25156527 of the cannabis genome sequence NC_044372.1;

[0027] The SNP locus 18 is labeled with the base C / T and is located at position 64540738 of the cannabis genome sequence NC_044372.1;

[0028] The SNP locus 19 is labeled with the base C / A and is located at position 869764 of the cannabis genome sequence NC_044373.1;

[0029] The SNP locus 20 is labeled with the base A / C and is located at position 4884699 of the cannabis genome sequence NC_044373.1;

[0030] The SNP locus 21 is labeled with the base G / C and is located at position 30968365 of the cannabis genome sequence NC_044373.1;

[0031] The SNP locus 22 is labeled with the base G / T and is located at position 32615917 of the cannabis genome sequence NC_044373.1;

[0032] The SNP locus 23 is labeled with the base A / T and is located at position 38487893 of the cannabis genome sequence NC_044373.1;

[0033] The SNP locus 24 is labeled with the base C / A and is located at position 79302742 of the cannabis genome sequence NC_044373.1;

[0034] The SNP locus 25 is labeled with the base G / T and is located at position 84524179 of the cannabis genome sequence NC_044373.1;

[0035] The SNP locus 26 is labeled with the base T / C and is located at position 18982824 of the cannabis genome sequence NC_044374.1;

[0036] The SNP locus 27 is labeled with the base T / C and is located at position 79964046 of the cannabis genome sequence NC_044374.1;

[0037] The SNP locus 28 is labeled with the base G / A and is located at position 1389429 of the cannabis genome sequence NC_044377.1;

[0038] The SNP locus 29 is labeled with the base G / A and is located at position 48947727 of the cannabis genome sequence NC_04437T7.1;

[0039] The SNP locus 30 is labeled with the base G / C and is located at position 79258535 of the cannabis genome sequence NC_044377.1;

[0040] The SNP locus 31 is labeled with the base T / C and is located at position 25687904 of the cannabis genome sequence NC_044378.1;

[0041] The SNP locus 32 is labeled with the base G / T and is located at position 46691787 of the cannabis genome sequence NC_044378.1.

[0042] The SNP locus 33 is labeled with the base T / C. The base T is on the THCAS (tetrahydrocannabinolic acid synthase) gene and is located at position 25822713 of the cannabis genome sequence NC_044378.1; the base C is on the CBDAS (cannabidiolic acid synthase) gene and is located at position 30981978 of the cannabis genome sequence NC_044378.1.

[0043] The present invention also provides KASP primers for amplifying the above-mentioned core SNP molecular marker set of industrial cannabis. The KASP primers include 33 KASP primer combinations, which contain primers with nucleotide sequences as shown in SEQ ID NO: 1-99, and each KASP primer combination is used to amplify the corresponding SNP marker.

[0044] Preferably, each KASP primer combination consists of two forward primers F1 and F2 with different terminal bases and one reverse primer R. The 5'-ends of the forward primers F1 and F2 of the primer combination are respectively linked with the FAM-tail: 5'-GAAGGTGACCAAGTTCATGCT-3' universal fluorescent tag sequence and the HEX-tail: 5'-GAAGGTCGGAGTCAACGGATT-3' universal fluorescent tag sequence.

[0045] Specifically, the KASP primers are composed of the nucleotide sequences shown in SEQ ID NO:1-99. Specifically, the KASP primer combinations corresponding to 33 SNP markers (SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11, SNP12, SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, SNP22, SNP23, SNP24, SNP25, SNP26, SNP27, SNP28, SNP29, SNP30, SNP31, SNP32, SNP33) are respectively: SEQ ID NO:1-3, SEQ ID NO:4-6, SEQ ID NO:7-9, SEQ ID NO:10-12, SEQ ID NO:13-15, SEQ ID NO:16-18, SEQ ID NO:19-21, SEQ ID NO:22-24, SEQ ID NO:25-27, SEQ ID NO:28-30, SEQ ID NO:31-33, SEQ ID NO:34-36, SEQ ID NO:37-39, SEQ ID NO:40-42, SEQ ID NO:43-45, SEQ ID NO:46-48, SEQ ID NO:49-51, SEQ ID NO:52-54, SEQ ID NO:55-57, SEQ ID NO:58-60, SEQ ID NO:61-63, SEQ ID NO:64-66, SEQ ID NO:67-69, SEQ ID NO:70-72, SEQ ID NO:73-75, SEQ ID NO:76-78, SEQ ID NO:79-81, SEQ ID NO:82-84, SEQ ID NO:85-87, SEQ ID NO:88-90, SEQ ID NO:91-93, SEQ ID NO:94-96, SEQ ID NO:97-99.

[0046] The present invention also provides the application of the above-mentioned core SNP molecular marker set of industrial hemp or the above-mentioned KASP primers in any of the following aspects:

[0047] Genotyping of industrial hemp varieties;

[0048] Molecular identification of industrial hemp varieties;

[0049] Purity detection of industrial hemp germplasm resources or varieties;

[0050] Construction of an industrial hemp SNP fingerprint library;

[0051] Industrial hemp molecular marker-assisted breeding.

[0052] Preferably, the specific method of the above application includes the following steps:

[0053] S1: Extract the genomic DNA of the industrial hemp sample;

[0054] S2: Using the DNA in S1 as a template, perform PCR amplification with the KASP primers described in any one of the above claims, and obtain the fluorescence signal value of the corresponding product and complete genotyping through a real-time fluorescence quantitative PCR instrument;

[0055] Specifically, the total reaction system for PCR amplification is 10.14 μl, including 5 μl of a DNA sample at 50 ng / μl to 60 ng / μl, 0.14 μl of each KASP primer combination, and 5 μl of KASP 2×MasterMix;

[0056] Specifically, the reaction conditions for PCR amplification are: 94°C, 15 min; 94°C, 20 sec, 66°C to 57°C (decreasing 1°C per cycle, a total of 10 cycles, 1 min per cycle), 10 min; 94°C, 20 sec, 55°C, 1 min, a total of 26 cycles; 40°C, 10 sec; the reading conditions for the fluorescence signal value are 37°C, 30 sec.

[0057] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0058] The present invention has developed a core SNP molecular marker set of industrial hemp based on KASP technology. Using this KASP genotyping technology, it can quickly and accurately identify and evaluate industrial hemp varieties or germplasm resource materials at the molecular level, which is an important supplement to the current phenotypic identification of only industrial hemp varieties, and can make up for the problem that environmental factors greatly affect the phenotype of industrial hemp, resulting in inaccurate identification results. Description of the Drawings

[0059] To more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0060] Figure 1 This is the detection map of the KASP genotyping technology for 11 industrial hemp varieties (or germplasm resources) using the primer pair corresponding to the SNP locus 2 of the present invention;

[0061] Figure 2 This is the detection map of the KASP genotyping technology for 11 industrial hemp varieties (or germplasm resources) using the primer pair corresponding to the SNP locus 14 of the present invention;

[0062] Figure 3 This is the detection map of the KASP genotyping technology for 25 industrial hemp varieties (or germplasm resources) using the primer pair corresponding to the specific locus 33 of the present invention. Among them, the samples close to the Y-axis are low-toxic types, the samples close to the X-axis are drug types, and the samples near the 45° line are intermediate types;

[0063] Figure 4 This is the KASP fingerprint map of 11 industrial hemp varieties (or germplasm resources) of the present invention. Among them, 0 represents the homozygous genotype, 1 represents the heterozygous genotype, and 999 represents the undetected genotype. Detailed implementation manners

[0064] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in combination with the embodiments in the present invention patent. Obviously, the described embodiments are only a part of the embodiments of the present invention patent, rather than all the embodiments. Based on the embodiments in the present invention patent, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the protection scope of the present invention patent.

[0065] Example 1: Obtaining of industrial hemp SNP loci and development of KASP markers

[0066] 1. Acquisition of hemp genome data

[0067] For the reference genome GCA_900626175.2 data, see the NCBI website (the website address is: https: / / www.ncbi.nlm.nih.gov / )

[0068] 2. Screening of SNP markers in the hemp genome

[0069] By performing whole-genome resequencing on representative cannabis germplasm resources from different sources at home and abroad, using GCA_900626175.2 on the NCBI website as the reference genome, filtering and quality control processing of the sequencing data were carried out using fastq (version: 0.20.0) and fastqc (version: 0.11.5) software. Population SNP detection was performed using SAMT OOLS. Based on the three criteria that the call rate (detection rate) reached 100%, MAF (minor allele frequency) > 0.4, and uniform distribution on each chromosome for the obtained SNP sites, a total of 50 SNP sites were screened. The 60bp sequences before and after these 50 SNP sites were intercepted, and KASP primers were designed. Finally, 32 core SNP sites were successfully converted into KASP markers, and the site numbers were SNP1 - 32.

[0070] Specifically, the position information of SNP sites 1 - 32 on the genome and the primer sequence information for amplifying these sites are shown in Table 1:

[0071] Table 1 Position information of SNP sites 1 - 32 on the genome and their corresponding primer sequence information

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080] Note: The primers for sites 1, 3, 5, 6, 8, 11, 12, 15, 16, 17, 19, 22, 24, 26 were designed on their complementary strands.

[0081] Example 2: Design of specific SNP sites and development of KASP markers

[0082] Cannabidiolic acid synthase gene (CBDAS, corresponding gene locus is B D ) and tetrahydrocannabinolic acid synthase gene (THCAS, corresponding gene locus is B T) is the co-dominant allele (B locus) that controls the three chemotypes of cannabinoids (low-toxicity type, intermediate type, and drug type). Based on the sequence similarity and polymorphism of two genes, a specific SNP locus for identifying the B locus was designed, with the locus number SNP33, which was then converted into a KASP marker (T / C). This marker can accurately identify B D / B D (low-toxicity type with THC content < 0.3%, i.e., industrial hemp), B T / B D (intermediate type), and B T / B T (drug type) of the three types.

[0083] Specifically, the position information of SNP locus 33 on the genome and the primer sequence information for amplifying this locus are shown in Table 2:

[0084] Table 2 Position information of SNP locus 33 on the genome and its corresponding primer sequence information

[0085]

[0086]

[0087] Note: The primers for this locus were designed on its complementary strand.

[0088] Example 3: Using SNP molecular marker loci for germplasm analysis

[0089] Using the 1 - 32 SNP markers obtained in Example 1, KASP genotyping was performed on 11 industrial hemp varieties (or germplasm resources) as shown in Table 3. Using the 33rd SNP marker obtained in Example 2, KASP genotyping was performed on 25 industrial hemp varieties (or germplasm resources) as shown in Table 4.

[0090] Table 3 11 industrial hemp varieties (or germplasm resources) for verifying SNP1 - 32

[0091] Number Name Place of origin Industrial hemp variety 1 Yunma 1 Yunnan Industrial hemp variety 2 Yunma 3 Yunnan Industrial hemp variety 3 Yunma 5 Yunnan Industrial hemp variety 4 Yunma 7 Yunnan Industrial hemp variety 5 Yunma 8 Yunnan Industrial hemp variety 6 Yunma 10 Yunnan Industrial hemp variety 7 Yunma Za 2 Yunnan Cannabis germplasm resource 8 C_3 Tibet Cannabis germplasm resource 9 C_44 Henan Cannabis germplasm resource 10 C_62 Ningxia Cannabis germplasm resource 11 C_84 Heilongjiang

[0092] Table 4 25 industrial hemp varieties (or germplasm resources) for verifying SNP33

[0093]

[0094]

[0095] The main experimental material is KASP 5000V4.0TF 2×Mastermix of LGC brand, with the product number KBS - 1050 - 102; the primers are Synthesized by Sangon Biotech; the main instrument is the Bio-rad CFX96 fluorescence quantitative PCR instrument.

[0096] The optimized 2×CTAB method was used to extract whole-genome DNA from the leaves of the cannabis plant. The extraction steps were as follows:

[0097] (1) Grind fresh cannabis leaves in liquid nitrogen. After grinding, take an appropriate amount of powder into a 2 ml centrifuge tube, quickly add 1 ml of ice-cold buffer solution, shake gently to mix, and place on ice for 30 min.

[0098] (2) Centrifuge at 3500 rpm for 3 min in a refrigerated centrifuge at 6°C;

[0099] (3) Remove the supernatant and add 800 μl of 2× CTAB extraction solution preheated in a 65°C water bath. Incubate in a water bath for 60 min. After the water bath, add 800 μl of a 24:1 chloroform:isoamyl alcohol solution. Mix thoroughly and centrifuge at 6000 rpm for 5 min at room temperature.

[0100] (4) Pipette the supernatant into a new 2 ml centrifuge tube, add 800 μl of a 24:1 solution of chloroform and isoamyl alcohol, mix thoroughly, and centrifuge at 11,000 rpm for 10 min at room temperature.

[0101] (5) Pipette the supernatant into a new 1.5 ml centrifuge tube, add 2 / 3 volume of -20°C pre-cooled isopropanol, shake gently, place at -20°C for 5 min, and centrifuge at 3000 rpm for 3 min to precipitate DNA;

[0102] (6) Wash once with 70% alcohol and once with anhydrous ethanol. After drying naturally, add 300 μl of RNA.H2O and incubate in a 37°C water bath for 90 min.

[0103] The DNA quality test steps are as follows: DNA integrity is tested using 1.5% agarose gel, and DNA concentration and quality are tested using an ultra-micro spectrophotometer (NanoPhotometer-N50).

[0104] The steps of KASP typing test are as follows:

[0105] (1) The total reaction volume for PCR amplification was 10.14 μl, including 5 μl of 50-60 ng / μl DNA sample, 0.14 μl of KASP primer mix (F1, F2, and R concentrations were all 100 μm / ml), and 5 μl of KASP 2× MasterMix.

[0106] (2) The reaction procedure for PCR amplification is:

[0107] Stage 1: Pre-denaturation at 94°C for 15 min; Stage 2: 94°C for 20 sec, 66°C to 57°C (decreasing 1°C per cycle, 10 cycles in total, 1 min per cycle), 10 min; Stage 3: 94°C for 20 sec, 55°C for 1 min, 26 cycles in total; The fluorescence signal value is read at 37°C for 1 min.

[0108] If the fluorescence value is found to be low or the genotyping is scattered, the PCR product can be read again by increasing the number of PCR reaction cycles. The maximum increase is 4 times. The additional PCR reaction program is 94°C for 1 min; 55°C for 20 sec, 3 cycles in total; The fluorescence signal value is read at 37°C for 1 min.

[0109] Determine the specific genotype of the gene: The genotype of the sample aggregated near the X-axis is the allele genotype linked to the FAM fluorescent tag sequence, the genotype of the sample aggregated near the Y-axis is the allele genotype linked to the HEX fluorescent tag sequence, the triangle in the 45-degree direction represents the heterozygous genotype, and the square near the origin is the control (NTC).

[0110] The fluorescence signal analysis results are shown in Table 5, which are the KASP genotyping results of 11 industrial hemp varieties (or germplasm resources) at 32 SNP loci. It can be seen that the 32 groups of SNP primers of the present invention can be applied to the genetic identification of industrial hemp varieties.

[0111] Table 5 KASP genotyping results of 11 industrial hemp varieties (or germplasm resources) at 32 SNP loci

[0112]

[0113]

[0114]

[0115] The fluorescence signal analysis results are shown in Table 6, which are the KASP genotyping results of 25 industrial hemp varieties (or germplasm resources) at locus 33. It can be seen that locus 33 of the present invention can be applied to the identification of low-toxic genotypes in cannabis germplasm.

[0116] Table 6 KASP genotyping results of 25 industrial hemp varieties (or germplasm resources) at SNP33

[0117]

[0118]

[0119] Although embodiments of the present invention have been shown and described, it will be understood by those of ordinary skill in the art that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A KASP primer set for detecting the core SNP molecular marker set of industrial hemp, characterized in that, The KASP primer set consists of 33 KASP primer combinations, and each KASP primer combination is used to detect the corresponding SNP marker; The industrial hemp core SNP molecular marker set includes 33 SNP markers, and the numbers of the 33 SNP markers are SNP1 to SNP33. The KASP primer combinations for detecting SNP1 to SNP32 are shown in Table 1, and the KASP primer combination for detecting SNP33 is forward primer F1: GAAGGTGACCAAGTTCATGCTACACTGAACATAGTAGACTTTGA, forward primer F2: GAAGGTCGGAGTCAACGGATTACACTGAACATAGTAGACTTTGG, and reverse primer R: CATGGAAAATCAGACTGGTTG.

2. Application of the KASP primer set according to claim 1 in any of the following aspects: Genotyping of industrial hemp varieties; Molecular identification of industrial hemp varieties; Purity detection of industrial hemp germplasm resources or varieties; Construction of an industrial hemp SNP fingerprint library; Industrial hemp molecular marker-assisted breeding.

3. The application according to claim 2, wherein The application method includes the following steps: S1: Extract the genomic DNA of the industrial hemp sample; S2: Using the DNA in S1 as a template, perform PCR amplification with the KASP primer set according to claim 1, and obtain the fluorescence signal value of the corresponding product and complete genotyping through a real-time fluorescence quantitative PCR instrument.

4. The application according to claim 3, wherein The total reaction system for PCR amplification is 10.14 μl, including 5 μl of a DNA sample at 50 ng / μl to 60 ng / μl, 0.14 μl of each KASP primer combination, and 5 μl of KASP 2×MasterMix.

Images