PLGA@M2 nano-drug and application thereof in preparation of medicine for treating or removing blood inflammation

Through the design of PLGA@M2 nanomedicine, PLGA particles are wrapped with the M2 macrophage membrane to overexpress IL-1R, IL-6R and TNFR, which solves the problem of difficult targeted adsorption of inflammatory factors in the blood and achieves efficient clearance of IL-1β, IL-6 and TNF-α, making it suitable for intravenous injection to treat blood inflammation.

CN115887413BActive Publication Date: 2025-10-21THE SECOND AFFILIATED HOSPITAL ARMY MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211428018.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-15
Publication Date
2025-10-21
Estimated Expiration
2042-11-15

AI Technical Summary

Technical Problem

Existing technologies make it difficult to safely and accurately target and adsorb common inflammatory factors in the blood, such as IL-1β, IL-6, and TNF-α, and it is difficult to quickly reduce inflammation in dialysis patients during hemodialysis.

Method used

PLGA@M2 nanomedicine is used, in which PLGA particles are wrapped by M2 macrophage membranes, IL-1R, IL-6R and TNFR are overexpressed, and polarization is induced by IL-4 and IL-13 to M2 type cell membranes wrapping PLGA to form PLGA@M2 nanomedicines, which are used for intravenous injection treatment or clearing blood inflammation.

Benefits of technology

It achieves precise targeted adsorption of inflammatory factors in the blood, significantly reducing the levels of IL-1β, IL-6 and TNF-α in the blood. It has good biocompatibility and low toxicity, and is suitable for intravenous injection to treat blood inflammation, especially for dialysis patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115887413B_ABST
    Figure CN115887413B_ABST
Patent Text Reader

Abstract

The application provides a PLGA@M2 nano drug and application thereof in preparation of a drug for treating or removing blood inflammation. The PLGA@M2 nano drug is synthesized by using the macrophage membrane polarized to M2 and overexpressing inflammation receptors to wrap PLGA. The nano drug can precisely target and adsorb three common inflammation factors in blood through in-vivo injection, and treat in-vivo blood inflammation storm. Meanwhile, the PLGA@M2 nano drug is loaded in an in-vitro adsorption column, so that the inflammation in blood of dialysis patients can be removed, and a feasible prevention and treatment measure for systemic inflammation of dialysis patients is provided.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of medicine, and specifically relates to a PLGA@M2 nanomedicine and an application thereof in preparing a medicine for treating or clearing blood inflammation. Background Art

[0002] Inflammation is considered a common comorbidity in chronic kidney disease (CKD), particularly in patients on chronic dialysis, and several circulating markers are commonly assessed as indicators of systemic inflammation. IL-1β is a proinflammatory mediator of acute and chronic inflammation that induces the synthesis of hundreds of secondary inflammatory mediators. IL-6 is a proinflammatory cytokine that promotes inflammation through activation and proliferation of lymphocytes, B cell differentiation, leukocyte recruitment, and induction of acute phase response proteins. TNF-α, a soluble receptor produced primarily by monocytes and macrophages, is downstream of IL-6 and is a specific marker of vulnerable plaques and risk of cardiovascular events, playing a direct role in the development of atherosclerosis.

[0003] Macrophages are highly heterogeneous and plastic cells that play an important role not only in physiological conditions but also in inflammatory processes (including the initiation and resolution of inflammation). Macrophages have two different phenotypes: one is called the classical pro-inflammatory macrophage (M1) and the other is called the anti-inflammatory macrophage (M2). Polarized M2 macrophages have important therapeutic value, especially playing an important role in anti-inflammatory.

[0004] PLGA (poly(lactic-co-glycolic acid)) is a biodegradable functional polymer organic compound with excellent biocompatibility, non-toxicity, and excellent encapsulation and film-forming properties. It is considered an excellent medical material and has been widely studied for applications such as drug delivery, antibody preparation, and adjuvants. Currently, the FDA has approved several PLGA microsphere-based drug formulations for clinical use, such as Lupron Deport. In 2009, China's SFDA also approved the marketing of two injectable microsphere drug formulations.

[0005] How to develop a safe nanomedicine that can be used for intravenous injection to treat inflammatory diseases caused by ischemic hypotension or poor recovery of kidney damage caused by cardiovascular surgery, and accurately target and adsorb common inflammatory factors such as IL-1β, IL-6 and TNF-α in the blood has always been an area that medical researchers have been pondering.

[0006] Moreover, in the current hemodialysis treatment methods, in addition to intervening in the production of inflammation in dialysis patients, how to quickly reduce and eliminate inflammation in the blood of dialysis patients during the hemodialysis process is a new treatment strategy. Summary of the Invention

[0007] In view of this, in order to overcome the deficiencies of the prior art, the present invention provides a PLGA@M2 nanomedicine and its use in the preparation of a drug for treating or clearing blood inflammation.

[0008] The present invention provides a PLGA@M2 nanomedicine, wherein the PLGA@M2 nanomedicine is formed by wrapping PLGA particles with M2 macrophage membranes, and the M2 macrophage membranes overexpress IL1R, IL6R and TNFR inflammatory receptor membrane proteins.

[0009] The present invention also provides a method for preparing the above-mentioned PLGA@M2 nanomedicine, which comprises the steps of:

[0010] 1) Overexpression of IL1R, IL6R, and TNFR in RAW cells;

[0011] 2) IL-4 and IL-13 induce the cells overexpressing IL1R, IL6R and TNFR RAW to polarize to M2;

[0012] 3) collecting the RAW cells polarized to M2, freezing and then thawing them, centrifuging them, and extracting cell membranes;

[0013] 4) mixing the extracted cell membrane with PLGA to obtain the PLGA@M2 nanomedicine comprising the M2 macrophage membrane-coated PLGA particles.

[0014] Furthermore, in step 3), the RAW cells polarized to M2 were frozen at -80°C for 10-30 min and then thawed, and the cells were incubated at 4°C at 5000-14000 rpm for 10 min, repeated 5 times, the supernatant was discarded, 0.1-1 ml PBS was added, and the cell membrane was disrupted by ultrasound to obtain a solution containing the cell membrane, and the protein concentration of the solution containing the cell membrane was measured.

[0015] Furthermore, in step 4), the mass molar ratio of the cell membrane to PLGA is 0.1-1 ug / ml: 0.5-5 mol / ml.

[0016] The present invention also provides the use of the above-mentioned PLGA@M2 nanomedicine in the preparation and treatment of blood inflammation.

[0017] Furthermore, the blood inflammation is blood inflammation in patients with chronic kidney disease (CKD).

[0018] The present invention also provides the use of the above-mentioned PLGA@M2 nanomedicine in the preparation of a drug for clearing blood inflammation in dialysis patients.

[0019] The present invention also provides a pharmaceutical preparation, which comprises the above-mentioned PLGA@M2 nanomedicine and one or more pharmaceutically acceptable drug carriers.

[0020] The present invention also provides an adsorption column for clearing inflammation in the blood of dialysis patients, wherein the adsorption column is loaded with the above-mentioned PLGA@M2 nanomedicine.

[0021] Furthermore, the adsorption column comprises a cellulose membrane and PLGA@M2 nanomedicine electrotransferred onto the cellulose membrane.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] 1. The present invention provides a PLGA@M2 nanomedicine formed by wrapping PLGA particles with M2 macrophage membranes, wherein the M2 macrophage membranes overexpress IL-1R, IL-6R and Tnfr1 inflammatory receptor membrane proteins.

[0024] 2. This study successfully synthesized the PLGA@M2 nanomedicine by overexpressing IL-1Ra, IL-6R, and TNFR membrane proteins on RAW cell membranes, inducing RAW polarization to M2 with IL-4 and IL-13, and then wrapping PLGA with the membranes of these M2-polarized macrophages overexpressing inflammatory receptors. The PLGA@M2 nanomedicine can precisely target and adsorb three common inflammatory factors in the blood. The PLGA@M2 nanomedicine, combined with one or more pharmaceutically acceptable drug carriers, can be used to treat blood inflammation in patients through in vivo injection or oral administration. It has good biocompatibility, low toxicity, and significant efficacy.

[0025] 3. The PLGA@M2 nanomedicine of the present invention is loaded into an adsorption column. The adsorption column developed is highly efficient and targeted in clearing blood inflammation, which can clear inflammation in the blood of dialysis patients and provide a feasible preventive measure for systemic inflammation in dialysis patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be described in detail below with reference to the accompanying drawings, in which:

[0027] Figure 1 Schematic diagram of the synthesis of PLGA@M2 nanomedicine;

[0028] Among them, A is the IL1R, IL6R and TNFR that need to be overexpressed on the cell membrane, B is a schematic diagram of RAW cells, C is a schematic diagram of IL1R, IL6R and TNFR overexpressed on the RAW cell membrane, D is a schematic diagram of IL1R, IL6R and TNFR overexpressed on the RAW cell membrane and then induced into M2 type using IL4 and IL13, E is a schematic diagram of M2 type cell membrane after overexpression of IL1R, IL6R and TNFR, F is PLGA, G is PLGA@M2 nanomedicine made by wrapping PLGA with M2 type cell membrane after expressing IL1R, IL6R and TNFR;

[0029] Figure 2 Figure 2 is the result of overexpression of IL1R, IL6R and TNFR in RAW cells;

[0030] A is a photo of immunofluorescence results of IL1R overexpression in RAW cells, B is a photo of immunofluorescence results of IL6R overexpression in RAW cells, C is a photo of immunofluorescence results of TNFR overexpression in RAW cells, D is the mRNA levels of IL1R, IL6R and TNFR after overexpression in RAW cells, and E is a graph of protein immunoblotting and quantitative analysis results after overexpression of IL1R, IL6R and TNFR in RAW cells;

[0031] Figure 3 The results of nanomedicine microstructure and stability;

[0032] A is an electron microscope photograph of the nanomedicine of the present invention, B is a nanomedicine particle size of about 73 nm (sampled 24h, 48h, and 72h after preparation), C is the difference in particle size between different batches of nanomedicine, D is the potential size of the nanomedicine (sampled 24h, 48h, and 72h after preparation), and E is the difference in potential size between different batches of nanomedicine;

[0033] Figure 4 This is the toxicity evaluation result of PLGA@M2 nanodrug;

[0034] A shows the cell viability of RAW cells after treatment with nanomedicines at different concentrations for 24 hours, B shows the hemolysis of nanomedicines at different concentrations, C shows the quantitative analysis of the hemolysis degree of nanomedicines at different concentrations, D shows the test results of kidney function indicators CRE and BUN, E shows blood indicators, F shows the test results of liver function indicators ALT and AST, and G shows HE staining of heart, liver, spleen, lung and kidney tissues 7 days after injection of nanomedicines.

[0035] Figure 5 The results of PLGA@M2 adsorbing inflammatory factors such as IL-1β, IL-6, and TNF-α in the serum of CKD patients;

[0036] A is a schematic diagram of the use of PLGA@M2 nanomedicine to treat CKD patient serum, B is the result of IL1R clearance after CKD patient serum was treated with PLGA@M2 nanomedicine, C is the result of IL6R clearance after CKD patient serum was treated with PLGA@M2 nanomedicine, and D is the result of TNFR clearance after CKD patient serum was treated with PLGA@M2 nanomedicine;

[0037] Figure 6 Schematic diagram of the preparation of inflammatory factor adsorption column using PLGA@M2 nanomedicine;

[0038] A is a schematic diagram of PLGA@M2 nanodrugs, B is a cellulose membrane, C is a schematic diagram of the electrotransfer of PLGA@M2 nanodrugs onto the cellulose membrane, and D and E are schematic diagrams of the prepared inflammatory factor adsorption columns.

[0039] Figure 7 For PLGA@M2 nanomedicine to pass through the inflammatory factor adsorption column of IL-1β, IL-6 and TNF-α;

[0040] A is the residual levels of IL-1β, IL-6 and TNF-α in the serum of CKD patients after treatment with inflammatory factor adsorption column; B is the residual levels of IL-1β, IL-6 and TNF-α in the serum of CKD patients after treatment with inflammatory factor adsorption column; C is the residual levels of IL-1β, IL-6 and TNF-α in the serum of CKD patients after treatment with inflammatory factor adsorption column. DETAILED DESCRIPTION

[0041] The following describes the embodiments of the present invention through specific examples. Those skilled in the art will readily understand the other advantages and benefits of the present invention from the disclosure herein. The present invention may also be implemented or applied through various other specific embodiments, and the details in this specification may be modified or altered based on different viewpoints and applications without departing from the spirit of the present invention.

[0042] Example 1 Preparation and physicochemical property analysis of PLGA@M2 nanomedicine

[0043] (1) PLGA@M2 nanomedicine synthesis technology roadmap (such as Figure 1 shown):

[0044] Figure 1 A represents IL1R, IL6R and TNFR that need to be overexpressed on the cell membrane. Figure 1 B is a schematic diagram of RAW cells. Figure 1 C is a schematic diagram of IL1R, IL6R and TNFR overexpressed on the RAW cell membrane. Figure 1 D is a schematic diagram of IL1R, IL6R and TNFR overexpressed on the RAW cell membrane and then induced into M2 type using IL4 and IL13. Figure 1 E is a schematic diagram of the M2 cell membrane after overexpression of IL1R, IL6R and TNFR. Figure 1 F is PLGA, Figure 1 G is PLGA@M2 nanomedicine made by wrapping PLGA with M2 cell membrane after expressing IL1R, IL6R and TNFR.

[0045] (2) Overexpression of IL-1R, IL-6R, and TNFR in RAW cells:

[0046] The IL-1R, IL-6R, and TNFR sequences were integrated into lentiviral plasmids carrying G418, puromycin, or hygromycin B, respectively. These plasmids were then transformed into competent E. coli. Positive clones were selected using ampicillin, and plasmids expressing the positive clones for IL-1R, IL-6R, and TNFR were extracted and synthesized into lentiviruses. The three lentiviruses carrying the IL-1R, IL-6R, and TNFR sequences were simultaneously transfected into RAW cells. Stable strains were selected using G418, puromycin, or hygromycin B to obtain RAW cells that stably overexpressed IL-1R, IL-6R, and TNFR.

[0047] (3) Immunofluorescence analysis of RAW cells overexpressing IL-1R, IL-6R and TNFR:

[0048] RAW cells overexpressing IL-1R, IL-6R, and TNFR were plated on 1.4 cm cell slides and fixed in 4% paraformaldehyde for 15 minutes. The slides were washed three times with polystyrene sodium bicarbonate (PSB), each for 5 minutes. Blocking was performed with blocking buffer for 30 minutes, followed by the addition of a 1:1000 primary antibody at 4°C overnight. The slides were then washed three times with PSB, each for 5 minutes. Secondary antibodies were added at a 1:2000 dilution and incubated at 37°C for 1 hour. The slides were washed three times with PSB, each for 5 minutes. DAPI was added for nuclear staining for 5 minutes, followed by three washes with PSB, each for 5 minutes. The slides were mounted with an anti-fluorescence quencher, and photographed using a confocal fluorescence microscope.

[0049] The results are as follows Figure 2 As shown in A, IL-1R was overexpressed in RAW cells, and green fluorescence showed that IL-1R was significantly expressed on the cell membrane of RAW cells. Figure 2 As shown in B, IL-6R was overexpressed in RAW cells, and as shown by red fluorescence, IL-6R was significantly expressed on the cell membrane of RAW cells. Figure 2 As shown in C, TNFR was overexpressed in RAW cells, as shown by purple fluorescence, and TNFR was significantly expressed on the cell membrane of RAW cells.

[0050] The specific overexpressed mRNA sequences are as follows:

[0051] IL-1R: The sequence is as follows:

[0052]

[0053] IL-6R: The sequence is as follows:

[0054]

[0055] TNFR: The sequence is as follows:

[0056]

[0057] (4) Detection of IL-1R, IL-6R, and TNFR mRNA expression using QPCR, as well as Western blot and immunohistochemistry for IL-1R, IL-6R, and TNFR

[0058] The specific method is as follows:

[0059] 1) QPCR detection of IL-1R, IL-6R and TNFR mRNA expression in RAW cells

[0060] Total RNA from RAW cells was extracted using a total RNA extraction kit and transcribed into cDNA using SSRTII reverse transcriptase (Beijing Qingke). The reaction system included 7.5 mL cDNA, 10 μL SYBR reverse transcriptase polymerase (Applied Biosystems, Waltham, MA), and 1.25 mL specific primers in a total volume of 20 mL.

[0061] The conditions were set as follows: 40 denaturation cycles of 98°C for 30 s, 95°C for 30 s, 95°C for 15 s, and 60°C for 1 min, with β-actin used as an internal standard.

[0062] The specific primer pairs are as follows:

[0063] IL-1R forward: GAGCGGCAGGAATGTGACAA; (SEQ ID NO. 4)

[0064] IL-1R reverse: GAGGGTGCGTCTACCTGGA; (SEQ ID NO.5)

[0065] IL-6R forward: GGTTGTGGAATCTTGCAGCC; (SEQ ID NO. 6)

[0066] IL-6R reverse: TGATGCTGGAGGTCCTTGAC; (SEQ ID NO.7)

[0067] TNFR forward: ATTGGACTGGTCCCTCACCT; (SEQ ID NO. 8)

[0068] TNFR reverse: ACCTGACCCATTTCCTTTCGG; (SEQ ID NO.9)

[0069] 2) Western blot detection of IL-1R, IL-6R and TNFR expression in RAW cells

[0070] Proteins were extracted from RAW cells overexpressing IL-1R, IL-6R, and TNFR, denatured at 95°C for 5 minutes after adding loading buffer, separated by 10% SDS-PAGE, and transferred to a 0.22 μm PVDF membrane. The membrane was blocked with 5% dried skim milk powder in TBS-Tween-20 (TBS containing 0.1% Tween 20) for 1 hour, incubated with IL-1R, IL-6R, and TNFR antibodies (1:1000) at 4°C overnight, and incubated with anti-rabbit secondary antibody (1:2000) the next day for 1 hour. ECL color development was performed, and photos were taken and analyzed using Imager J.

[0071] The results are as follows Figure 2 As shown in D to E, the expression levels of IL-1R, IL-6R and TNFR were significantly increased in RAW cells overexpressing IL-1R, IL-6R and TNFR.

[0072] Example 2 Preparation and physicochemical property analysis of PLGA@M2 nanomedicine

[0073] After overexpressing IL-1R, IL-6R, and TNFR in RAW cells, IL-4 and IL-13 induced RAW polarization to M2. The cells were harvested, frozen at -80°C for 10-30 minutes, then thawed and incubated at 4°C at 5000-14000 rpm for 10 minutes, repeated five times. The supernatant was discarded, 0.1-1 ml of PBS was added, and the cell membranes were ultrasonically mixed. The protein concentration was determined. 0.1-1 μg / ml of cell membranes and 0.5-5 mol / ml of PLGA were mixed and ultrasonically synthesized into PLGA@M2 nanomedicines. The prepared Se@BSA nanomedicines were examined by transmission electron microscopy (TEM).

[0074] The results are as follows Figure 3 As shown in A to E, the PLGA@M2 nanomedicine is spherical and uniform in size. The particle size of the PLGA@M2 nanomedicine is about 60 nm and the surface charge is about -23 mv.

[0075] Example 3 Toxicity evaluation of PLGA@M2 nanomedicine

[0076] HK-2 cells were co-cultured with PLGA@M2 nanospheres at different concentrations (0, 1, 25, 50, 100, 200 μg / mL) and cell viability was measured after 24 h. Figure 4 As shown in Figure A, 200 μg / mL had no effect on cell viability, indicating the biosafety of the prepared PLGA@M2 nanomedicine in in vitro experiments.

[0077] PLGA@M2 was dissolved in serum and the dissolution of PLGA@M2 was observed after 24 hours. Figure 4As shown in Figure BC, no hemolysis occurred after 24 hours, indicating that the nanospheres have good biocompatibility.

[0078] After 7 days of treatment with PLGA@M2 (20 mg / kg), blood was collected and analyzed for CRE, BUN, WBC, HGB, RBC, HTC, AST, and ALT. HE staining was also performed on the heart, liver, spleen, lung, and kidney. The results showed that compared with the control group, the renal function of mice treated with PLGA@M2 was not significantly impaired (e.g., Figure 4 D). Figure 4 E shows that there were no significant differences in the WBC, HGB, RBC, HTC and body weight of mice treated with PLGA@M2 compared with the control group. Figure 4 F liver index ALT and AST results showed no significant difference; Figure 4 Middle G shows HE staining of the heart, liver, spleen, lung, and kidney. Microscopic examination showed no obvious pathological changes in the organs.

[0079] Example 4 PLGA@M2 nanomedicine clears inflammatory factors in CKD patient serum and preparation of its dialysis column

[0080] (1) Effect of PLGA@M2 nanomedicine on clearing inflammatory factors IL-1β, IL-6 and TNF-α in serum of CKD patients

[0081] To test the effect of PLGA@M2 on clearing inflammatory factors in serum of CKD patients, 50ml of CKD patient blood was collected from the clinic, centrifuged at 3000 rpm for 10-30min, and two sterile 15ml EP tubes were taken. Figure 5 A, 5 ml of supernatant was aspirated and PBS and PLGA@M2 were added respectively.

[0082] The results are as follows Figure 5 The experimental process shown in A, the results reveal Figure 5 IL-1β, IL-6 and TNF-α in BD were significantly decreased under PLGA@M2 conditions.

[0083] (2) PLGA@M2 nanomedicine clears inflammatory factors in the serum of CKD patients and the preparation of its dialysis column.

[0084] Figure 6 Schematic diagram of the fabrication of an inflammatory factor adsorption column using PLGA@M2 nanoparticles. A is a schematic diagram of the PLGA@M2 nanoparticles; B is a cellulose membrane; C is a schematic diagram of the electrotransfer of the PLGA@M2 nanoparticles onto the cellulose membrane; D and E are schematic diagrams of the fabricated inflammatory factor adsorption column.

[0085] A dialysis column was prepared according to the method (2) in Example 4. 200 ml of CKD patient blood was collected clinically and centrifuged at 3000 rpm for 10-30 min. Two sterile dialysis columns were taken respectively. The serum obtained by centrifugation was dialyzed and the IL-1β, IL-6 and TNF-α inflammatory factor ELISA kits were used to determine the IL-1β, IL-6 and TNF-α inflammatory factor content.

[0086] The results are as follows Figure 7 As shown in A to C, the PLGA@M2 dialysis column significantly adsorbed IL-1β, IL-6 and TNF-α inflammatory factors in the blood of CKD patients, indicating that the PLGA@M2 dialysis column has a targeted and efficient adsorption effect on IL-1β, IL-6 and TNF-α inflammatory factors.

[0087] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions, which should all be included in the scope of the claims of the present invention.

Claims

1. A PLGA@M2 nanodrug, characterized in that: The PLGA@M2 nanomedicine is formed by wrapping PLGA particles with M2 macrophage membranes, and the M2 macrophage membranes overexpress IL1R, IL6R and TNFR inflammatory receptor membrane proteins. The M2 macrophages are polarized from RAW cells induced by IL-4 and IL-13 and overexpressing IL1R, IL6R and TNFR on the cell membrane; The preparation method of the PLGA@M2 nanomedicine comprises the following steps: 1) Overexpression of IL1R, IL6R, and TNFR in RAW cells; 2) IL-4 and IL-13 induce the RAW cells overexpressing IL1R, IL6R and TNFR to polarize to M2; 3) collecting the RAW cells polarized to M2, freezing and then thawing, centrifuging, and extracting cell membranes; 4) Mixing the extracted cell membrane with PLGA to obtain the PLGA@M2 nanomedicine comprising the M2 macrophage membrane-coated PLGA particles.

2. The PLGA@M2 nanomedicine according to claim 1, characterized in that In step 3), the RAW cells polarized to M2 were frozen at -80°C for 10-30 min and then thawed, and the cells were centrifuged at 4°C at 5000-14000 rpm for 10 min, repeated five times. The supernatant was discarded, 0.1-1 ml of PBS was added, and the cell membrane was disrupted by ultrasound to obtain a solution containing the cell membrane, and the protein concentration of the solution containing the cell membrane was measured.

3. The PLGA@M2 nanomedicine according to claim 1, characterized in that In step 4), the mass molar ratio of the cell membrane to PLGA is 0.1-1 ug / ml: 0.5-5 mol / ml.

4. Use of the PLGA@M2 nanomedicine according to claim 1 in the preparation and treatment of blood inflammation.

5. Use of the PLGA@M2 nanomedicine according to claim 4 in the preparation and treatment of blood inflammation, wherein the blood inflammation is blood inflammation in patients with chronic kidney disease (CKD).

6. Use of the PLGA@M2 nanomedicine according to claim 1 in the preparation of a drug for clearing blood inflammation in dialysis patients.

7. A pharmaceutical preparation, characterized in that The pharmaceutical preparation comprises the PLGA@M2 nanodrug according to claim 1 and one or more pharmaceutically acceptable drug carriers.

8. An adsorption column for removing inflammation from the blood of dialysis patients, characterized in that: The adsorption column is loaded with the PLGA@M2 nanodrug according to claim 1.

9. The adsorption column for removing inflammation from the blood of dialysis patients according to claim 8, characterized in that: The adsorption column comprises a cellulose membrane and a PLGA@M2 nano drug electrotransferred onto the cellulose membrane.

Citation Information

Patent Citations

  • Cell membrane coated nano bait for removing proinflammatory factors and inhibiting T cell activation as well as preparation method and application of cell membrane coated nano bait

    CN114470223A

  • Simple blood purifier

    CN203139198U