Recombinant SCCA monoclonal antibody and its preparation method and application
By preparing recombinant SCCA monoclonal antibodies, the immune response problem of mouse-derived antibodies in clinical applications was solved, the detection sensitivity was improved, and efficient detection of squamous cell carcinoma was achieved, which is suitable for clinical diagnosis and monitoring.
Patent Information
- Application Number
- CN202211411123.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-11
- Publication Date
- 2025-09-30
- Estimated Expiration
- 2042-11-11
AI Technical Summary
Existing mouse-derived SCCA monoclonal antibodies induce human anti-mouse antibody reactions during clinical applications, limiting their use in clinical diagnosis and treatment. In addition, existing detection methods are not sensitive enough, making them difficult to use for early diagnosis or screening of the general population.
Recombinant SCCA monoclonal antibodies are used to prepare stable recombinant antibodies by fusing the light chain variable region of a mouse antibody with the light chain constant region of human IgG1 and the heavy chain variable region with the heavy chain constant region of human IgG1. These antibodies are then used in test strips and kits for detecting squamous cell carcinoma antigens, and the recombinant antibodies are expressed and purified in mammalian cells.
The stability and high-sensitivity detection of recombinant SCCA monoclonal antibodies were achieved, and the test results were consistent with those of Abbott reagents. It is suitable for the detection of clinical serum SCCA content and for the early diagnosis and dynamic monitoring of squamous cell carcinoma.
Smart Images

Figure CN115894695B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of bioengineering technology, in particular to a recombinant SCCA monoclonal antibody. The present invention also relates to a preparation method and application of the monoclonal antibody. Background Art
[0002] Squamous cell carcinoma antigen (SCCA / SCCAg) is a subfragment of the tumor-associated antigen TA-4 (Tumor Associated-Antigen 4). It was first isolated from cervical squamous cell carcinoma tissue by Kato et al. Increased SCCA expression inhibits apoptosis in cancer cells, thereby conferring resistance to several cell suicide mechanisms within the body. SCCA type 1 is primarily localized within tumor cells and acts as an inhibitor of papain-like cysteine kinases (catL, S, and K). This inhibition promotes resistance to several cell suicide mechanisms in cancer cells, thereby enhancing the ability of tumor cells to resist programmed cell death. SCCA type 2 is released into the circulation and acts as an inhibitor of chymotrypsin-like kinase (catG). This inhibition counteracts catG-mediated inflammatory responses, thereby protecting tumor cells from degradation.
[0003] SCCA, a tumor marker for squamous cell carcinoma, has high specificity and is valuable as an auxiliary diagnosis for cancers originating from squamous epithelial cells, such as cervical cancer and lung cancer (non-small cell lung cancer). Early studies have shown that serum SCCA levels in women with cervical squamous cell carcinoma are higher than those in healthy controls. Other studies have also shown that serum SCCA levels can indicate the expansion of lesions in women with cervical squamous cell carcinoma. Therefore, SCCA levels can aid in early diagnosis, detection of recurrence, and disease monitoring. SCCA also has some auxiliary diagnostic value for other types of squamous cell carcinoma (such as those of the oral cavity, esophagus, tongue, and head and neck). However, the detection of this marker is primarily intended for dynamic monitoring of patients with malignant tumors and is not suitable for early diagnosis or general population screening.
[0004] Antibodies are a workhorse in the biological sciences. Mouse-derived monoclonal antibodies have long been widely used in scientific research, clinical diagnosis, and treatment. However, the fact that mouse-derived mAbs can trigger human anti-mouse antibody (HAMA) reactions limits their clinical application. Therefore, it is crucial to engineer mouse-derived antibodies, particularly SCCA monoclonal antibodies, to ensure their safe clinical application. Summary of the Invention
[0005] The object of the present invention is to provide a recombinant SCCA monoclonal antibody.
[0006] The present invention also provides a method for preparing the recombinant SCCA monoclonal antibody.
[0007] The present invention also provides the use of the recombinant SCCA monoclonal antibody in preparing a test paper or a kit for detecting squamous cell carcinoma antigens.
[0008] To achieve the above purpose, the present invention can adopt the following technical solutions:
[0009] The recombinant SCCA monoclonal antibody of the present invention comprises a light chain composed of the light chain variable region of an anti-SCCA mouse antibody and the light chain constant region of human IgG1, and a heavy chain composed of the heavy chain variable region of an anti-SCCA mouse antibody and the heavy chain constant region of human IgG1.
[0010] When the light chain variable region comprises the amino acid sequence shown in SEQ ID NO.1, the heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO.2;
[0011] When the light chain variable region comprises the amino acid sequence shown in SEQ ID NO. 5, the heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO. 6.
[0012] The present invention also provides a method for preparing the above-mentioned recombinant SCCA monoclonal antibody, comprising the following steps:
[0013] In the first step, hybridoma cell lines are prepared using immunogens and RNA is extracted from them, which is then reverse transcribed to obtain cDNA;
[0014] In the second step, primers were designed to amplify the genes encoding the light chain variable region containing SEQ ID NO.1 / SEQ ID NO.5 and the heavy chain variable region containing SEQ ID NO.2 / SEQ ID NO.6 using the cDNA as a template;
[0015] In the third step, the expression vectors with the signal peptide and light chain constant region and the expression vectors with the signal peptide and heavy chain constant region are double-digested. They are then recombined with the target light chain gene and the target heavy chain gene using homologous recombination. The successfully constructed plasmids are transformed into competent cells, and positive clones are selected for sequencing. The bacterial liquid corresponding to the correctly sequenced plasmids is expanded and the plasmids are extracted.
[0016] In the fourth step, the plasmids carrying the heavy chain and light chain genes are co-transfected into mammalian cells 293F cells or CHO-S cells. After 4-5 days, the cultured cell supernatant is collected for protein purification to obtain recombinant SCCA monoclonal antibodies.
[0017] When amplifying the genes encoding the light chain variable region containing SEQ ID NO.1 and the heavy chain variable region containing SEQ ID NO.2, expression vectors containing the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4 are constructed respectively, wherein the expression vector containing the nucleotide sequence shown in SEQ ID NO.3 contains the expression gene for the light chain constant region of human IgG1, and the expression vector containing the nucleotide sequence shown in SEQ ID NO.4 contains the expression gene for the heavy chain constant region of human IgG1.
[0018] Similarly, when amplifying the genes encoding the light chain variable region containing SEQ ID NO.5 and the heavy chain variable region containing SEQ ID NO.6, expression vectors containing the nucleotide sequences shown in SEQ ID NO.7 and SEQ ID NO.8 are constructed respectively, wherein the expression vector containing the nucleotide sequence shown in SEQ ID NO.7 contains the expression gene for the light chain constant region of human IgG1, and the expression vector containing the nucleotide sequence shown in SEQ ID NO.8 contains the expression gene for the heavy chain constant region of human IgG1.
[0019] In the method for preparing the recombinant SCCA monoclonal antibody of the present invention, the specific method for preparing the hybridoma cell line in the first step is as follows:
[0020] In the first step, recombinant antigens or concentrated human sweat are used as immunogens. The immunogens are first diluted to a certain concentration and then emulsified with Freund's complete adjuvant or incomplete adjuvant. Mice are then given basic immunization, booster immunization, and pre-fusion shock immunization.
[0021] In the second step, the serum of immune mice was screened by enzyme-linked immunosorbent assay;
[0022] In the third step, mouse spleen cells with a serum titer higher than 1:8000 were selected and fused with myeloma cells in vitro. After multiple subcloning, a hybridoma cell line that stably secreted anti-SCCA was obtained.
[0023] The present invention also provides a test paper for detecting squamous cell carcinoma antigens, wherein the test paper uses the recombinant SCCA monoclonal antibody as a detection reagent.
[0024] The present invention also provides a kit for detecting squamous cell carcinoma antigens, which comprises the above-mentioned test paper or the above-mentioned recombinant SCCA monoclonal antibody.
[0025] Compared with the prior art, the present invention has the following advantages:
[0026] The recombinant SCCA monoclonal antibody prepared by the present invention has a well-defined protein and gene structure, good stability, and reproducible expression. The prepared recombinant SCCA monoclonal antibody was used in a kit for detecting squamous cell carcinoma antigens, demonstrating high clinical sensitivity. Testing of Abbott samples revealed that the results of the recombinant SCCA monoclonal antibody tested using the kit were consistent with Abbott's clinical results and showed no significant difference compared to the Abbott reagent. Therefore, the recombinant SCCA monoclonal antibody prepared by the present invention can be used in clinical serological testing for serum SCCA levels. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 Agarose gel electrophoresis of total RNA from hybridoma cells fused with mouse spleen cells and NS1.
[0028] Figure 2 It is the electrophoresis diagram of the recombinant monoclonal antibody variable region gene amplification product.
[0029] Figure 3 It is PCR screening and amplification of monoclonal recombinant antibody genes.
[0030] Figure 3 Middle: Lanes 2-4 are sequencing images of the heavy chain of the monoclonal recombinant antibody gene amplified by PCR screening in Implementation Case 2; Lanes 8-10 are sequencing images of the light chain of the monoclonal recombinant antibody gene amplified by PCR screening in Implementation Case 2; Lanes 5-7 are sequencing images of the heavy chain of the monoclonal recombinant antibody gene amplified by PCR in Implementation Case 3; Lanes 11-13 are sequencing images of the light chain of the monoclonal recombinant antibody gene amplified by PCR in Implementation Case 3.
[0031] Figure 4 This is the SDS-PAGE test result of the eukaryotic expressed and purified recombinant monoclonal antibody.
[0032] In the picture: Figure 4 The middle left figure is the SDS-PAGE detection result of the recombinant SCCA antibody in Example 2. Figure 4 The middle right figure is the SDS-PAGE detection result of the recombinant SCCA-2 antibody in Example 3.
[0033] Figure 5 It is the sensitivity of the kit of Example 4 of the present invention to the quality control product and clinical samples.
[0034] Figure 6 This is a correlation diagram between the kit in Example 4 of the present invention and the Abbott reagent (linearity 0.7-59.3 ng / ml).
[0035] Figure 7 This is a correlation diagram between the kit in Example 4 of the present invention and the Abbott reagent (linearity 0.7-5.0 ng / ml). DETAILED DESCRIPTION
[0036] The present invention is described in more detail below by way of specific examples to facilitate understanding by those skilled in the art. Unless otherwise specified, the detection reagents and detection instruments used in the present invention are all commercially available products in the art, and the detection methods used are also conventional methods in the art.
[0037] Example 1 Mouse immunization and antiserum titer detection
[0038] S1. The SCCA antigen sequence was constructed into the PET-32a expression vector and a GST tag was introduced. The recombinant SCCA antigen (Gene ID: 6317) was obtained by inducing expression in E. coli. The purified recombinant SCCA antigen was used as an immune antigen and immunized in BalB / C mice (3 times). The specific immunization procedures are as follows:
[0039] The second immunization was administered 21 days after the first, and the third immunization was administered 21 days after the second. The first immunization was administered subcutaneously and intraperitoneally. For the first immunization, 100 μg of immunizing antigen was emulsified with an equal volume of Freund's complete adjuvant. For the subsequent two immunizations, 50 μg of immunizing antigen was emulsified with an equal volume of Freund's incomplete adjuvant (intraperitoneal injection). Blood was collected from the tail vein 10 days after the third immunization. After incubation at 37°C for 1 hour, the supernatant (antiserum) was collected and analyzed by ELISA. A titer of at least 1:8000 was considered satisfactory for fusion. Three days before fusion, an intraperitoneal burst immunization (50 μg / animal) was performed.
[0040] S2. Antiserum titer detection
[0041] The SCCA recombinant antigen was treated with 1% Triton and then added to 0.05 mol / L CB (pH 9.6) at a concentration of 1 μg / ml for solid-phase coating. 50 μl / well was added overnight at 4°C. The cells were washed twice with PBST, patted dry, and then blocked with Casein blocking solution (100 μl / well) at 37°C for 2 h. Test sera were serially diluted from 1:200 onwards, with 50 μl / well added. Unimmunized BalB / C negative serum was also included as a control. The cells were incubated at 37°C for 30 min. The cells were washed five times with PBST, patted dry, and a working concentration of goat anti-mouse enzyme conjugate was added (50 μl / well). The cells were incubated at 37°C for 30 min. The cells were washed five times with PBST, patted dry, and then chromogenic substrates A and B (50 μl / well each) were added. The reaction was continued for 10 min, and the signal was measured using a microplate reader. The test results are shown in Table 1.
[0042] Table 1 Antiserum titer detection
[0043]
[0044] As can be seen from the table above, the titers all exceeded 1:8000, meeting the fusion requirements. A final booster immunization was performed, and the animals were sacrificed three days later for cell fusion and clone screening.
[0045] Example 2 Construction and expression of recombinant SCCA monoclonal antibody 1
[0046] 1. Hybridoma cell RNA extraction and reverse transcription
[0047] BalB / C mice were immunized with the SCCA recombinant antigen obtained in Example 1 to obtain mouse spleen cells, which were then fused with NS1 via PEG to obtain hybridoma cells. Hybridoma cell RNA was extracted using the Trizol method, and clear 28S and 18S bands were observed by agarose gel electrophoresis (see Figure 1 ), indicating good RNA integrity. RNA concentration and purity were determined to be D(260 nm) / D(280 nm) = 1.85, meeting the requirements of this experiment. cDNA was synthesized using RNA as a template for reverse transcription.
[0048] 2. PCR amplification of the variable region of recombinant SCCA monoclonal antibody
[0049] Using cDNA as a template and the nucleotide sequences shown in SEQ ID NOs. 9-12 as primers, TaqDNA enzyme was used to amplify the heavy chain variable region gene and light chain variable region gene of the monoclonal antibody, respectively.
[0050] The nucleotide sequence shown in SEQ ID NO.9 is the light chain upstream primer. The specific sequence of SEQ ID NO.9 is: CTGCCTGGCCGGGAGAGCGCTCGCAGACATCAAGATGACCCAGTCTC;
[0051] The nucleotide sequence shown in SEQ ID NO.10 is the light chain downstream primer, specifically:
[0052] AGATGGTGCAGCCACCGTACGTTTTATTTCCAACTTTGTCCCAG;
[0053] The nucleotide sequence shown in SEQ ID NO.11 is the heavy chain upstream primer, specifically: CTGCCTGGCCGGGAGAGCGCTCGCAGAGGTCCAGTTGCAGCAGTCTGGAC;
[0054] The nucleotide sequence shown in SEQ ID NO.12 is the heavy chain downstream primer, specifically: GAAGACCGATGGGCCCTTGGTGCTAGCTGAGGAGACGGTGACTGAGGTTC
[0055] The agarose gel electrophoresis results of the amplified products showed that (i.e. Figure 2 Middle left image): The VH (heavy chain variable region) gene fragment length is approximately 350 bp, and the light chain variable region gene fragment length is approximately 340 bp, which is consistent with the target fragment length.
[0056] 3. Construction of recombinant plasmid
[0057] The heavy chain expression vector Sig-GFc-PCMV was double-digested with HindⅢ and NheⅠ (the vector contains the expression gene of the heavy chain constant region of human IgG1) and homologous recombination was carried out with the heavy chain variable region gene; the light chain expression vector Sig-LFc-PCMV3 was double-digested with HindⅢ and BsiWI (the vector contains the expression gene of the light chain constant region of human IgG1) and homologous recombination was carried out with the light chain variable region; recombinant plasmids expressing light and heavy chains were constructed; after the recombinant plasmids were transformed into competent cells, single clones were randomly picked for bacterial PCR amplification detection and sequencing, and the sequencing results were as follows Figure 3 As shown. Figure 3 In the figure, lanes 2, 3, and 4 are recombinant heavy chain expression plasmids; lanes 8, 9, and 10 are recombinant light chain expression plasmids (primers used are universal primers for the vector backbone region amplification). The results show that these clones all contain the target gene, indicating a high success rate in recombinant plasmid construction.
[0058] 4. Expression and purification of recombinant monoclonal antibodies
[0059] The bacterial solution corresponding to the correctly sequenced plasmid was expanded and the plasmid was extracted. The plasmids carrying the heavy chain and light chain genes were co-transfected into mammalian cells 293F cells or CHO-S cells. After 4-5 days, the culture cell supernatant was collected for protein purification to obtain a recombinant SCCA monoclonal antibody 1 when the light chain variable region contained SEQ ID NO.1 and the heavy chain variable region contained SEQ ID NO.2. The collected proteins were combined and analyzed by SDS-PAGE. The results were as follows: Figure 4 Left picture in .
[0060] from Figure 4 It can be seen that the purified antibody has high purity.
[0061] Example 3 Construction and expression of recombinant SCCA monoclonal antibody 2
[0062] S1, Mouse immunization and antiserum titer detection
[0063] This procedure differs from Example 1 in that human sweat was collected and concentrated by dialysis before immunization of BalB / C mice three times. The immunization intervals were the same as in Example 1, the immunization dose was 100 μg / mouse, and the immunization sites were the same as in Example 1. Ten days after the third immunization, blood was collected from the tail vein. After 1 hour of stasis at 37°C, the blood was centrifuged at 6000 rpm for 10 minutes. The supernatant (antiserum) was collected and analyzed by ELISA for immune efficacy. Once the titer reached the fusion requirement, an intraperitoneal burst immunization of 50 μg / mouse was performed three days before fusion.
[0064] Table 2 Antiserum titer detection
[0065]
[0066] As can be seen from the table above, the titers all exceeded 1:8000, meeting the fusion requirements. A final booster immunization was performed, and the animals were sacrificed three days later for cell fusion and clone screening.
[0067] S2, hybridoma cell RNA extraction and reverse transcription, same as Example 2;
[0068] S3, PCR amplification of the variable regions of the recombinant SCCA monoclonal antibody: Using cDNA as a template and the nucleotide sequences shown in SEQ ID NOs. 13-16 as primers, TaqDNA enzyme was used to amplify the heavy chain variable region gene and the light chain variable region gene of the monoclonal antibody, respectively. Wherein:
[0069] The nucleotide sequence shown in SEQ ID NO.13 is the light chain upstream primer, specifically: CTGCCTGGCCGGGAGAGCGCTCGCACGACGATTGGATACAGTTGGTGC;
[0070] The nucleotide sequence shown in SEQ ID NO. 14 is the light chain downstream primer, specifically: AGATGGTGCAGCCACCGTACGTTTCAGCTCCAGCTTGGTCCCAAC;
[0071] The nucleotide sequence shown in SEQ ID NO.15 is the heavy chain upstream primer, specifically: CTGCCTGGCCGGGAGAGCGCTCGCAGAGGTGAAGCTTCAGGAGTCAG;
[0072] The nucleotide sequence shown in SEQ ID NO. 16 is the heavy chain downstream primer, specifically: GAAGACCGATGGGCCCTTGGTGCTAGCTGAGGAGACGGTGACTGAGGTG.
[0073] The agarose gel electrophoresis results of the amplified products showed that (i.e. Figure 2Middle right image): The VH (heavy chain variable region) gene fragment length is approximately 350 bp, and the light chain variable region gene fragment length is approximately 340 bp, which is consistent with the target fragment length.
[0074] S4, construct the recombinant plasmid according to the steps in Example 2.
[0075] The heavy chain expression vector constructed in this example is an expression vector containing the nucleotide sequence shown in SEQ ID NO.8, and the expression vector contains the expression gene of the heavy chain constant region of human IgG1; the light chain expression vector constructed in this example is an expression vector containing the nucleotide sequence shown in SEQ ID NO.7, and the expression vector contains the expression gene of the light chain constant region of human IgG1.
[0076] Single clones were randomly picked for bacterial PCR amplification and sequencing. Figure 3 Lanes 5-7 are recombinant heavy chain expression plasmids; lanes 11-13 are recombinant light chain expression plasmids (primers used are universal primers for the vector backbone region amplification). The results show that these clones all contain the target gene, indicating a high success rate of recombinant plasmid construction.
[0077] S5, purify the recombinant monoclonal antibody expression and purification steps in Example 2
[0078] In this example, the purified product was a recombinant SCCA monoclonal antibody 2 containing a light chain variable region as shown in SEQ ID NO. 5 and a heavy chain variable region as shown in SEQ ID NO. 6. The collected proteins were combined and subjected to SDS-PAGE analysis. The results were as follows: Figure 4 As shown in the middle right picture, Figure 4 The right panel shows the high purity of the purified antibody.
[0079] Example 4
[0080] The recombinant SCCA monoclonal antibody 1 prepared in Example 2 and the recombinant SCCA monoclonal antibody 2 prepared in Example 3 were used in a kit for detecting squamous cell carcinoma antigens. The kit used a double antibody sandwich method to detect squamous cell carcinoma antigens and specifically included a squamous cell carcinoma antigen calibrator, a quality control, a magnetic bead suspension coated with the recombinant SCCA monoclonal antibody 1, and an enzyme marker 2 coated with the recombinant SCCA monoclonal antibody 2.
[0081] 1. Minimum detection limit
[0082] Prepare a series of five clinical samples with concentrations ranging from 1 to 4 times the LoB. Each sample was replicated three times over four days, yielding 60 data points. Data validation and analysis were performed according to the EP17 method to calculate the LoD. If quality control samples derived from non-authentic clinical samples are used in routine work (e.g., a positive LoD control sample diluted with zero calibrator diluent), the LoD for the control sample should also be established (using the same method as above). The higher concentration value obtained from the two methods was used as the LoD for the batch. The highest LoD value across the three kit batches was used as the declared LoD for the kit. The results are shown in Tables 3 and 4.
[0083] Table 3 LoD of the evaluation kit for real clinical serum / plasma specimens
[0084]
[0085] Table 4 LoD of quality control sample evaluation kit
[0086]
[0087] According to the EP17-A calculation method (using MVS software), the LoDs for clinical specimens from three batches of the kit were 0.21 ng / ml, 0.19 ng / ml, and 0.20 ng / ml, respectively; the LoDs for quality control specimens from three batches of the kit were 0.15 ng / ml, 0.19 ng / ml, and 0.18 ng / ml, respectively. The LoD achieved during the pilot test phase of this kit was 0.21 ng / ml.
[0088] 2. Functional sensitivity
[0089] Using the data from the LoD experiment, 5 concentration samples were tested 3 times a day for a total of 4 days, and 12 results were obtained for each sample. The mean, SD, and CV% of each sample were calculated, and the concentration closest to 20% was the functional sensitivity; the two test samples and three batches of kits were calculated separately, and the maximum concentration value was taken as the functional sensitivity (FS) of this project. The two matrices were tested according to the sample concentration and CV%, and the results are shown in Figure 5 .
[0090] Depend on Figure 5 It can be seen that when CV=20%, the FS of clinical specimens of the three batches of test kits are: 0.15ng / ml, 0.20ng / ml, 0.18ng / ml; the FS of quality control specimens of the three batches of test kits are: 0.20ng / ml, 0.25ng / ml, 0.15ng / ml; the FS obtained in the pilot test stage of this test kit is: 0.25ng / ml.
[0091] 3. Clinical compliance rate
[0092] In a clinical evaluation of 590 samples, the positive coincidence rate between the reagent of the present invention and Abbott was 95.12%, the negative coincidence rate was 91.09%, and the overall coincidence rate was 93.74%. The specific analysis results are shown in Table 5.
[0093] Table 5 Statistics of Yin-Yang Coincidence Rate
[0094]
[0095] 4. Clinical Relevance
[0096] Clinical assessment of 591 samples (excluding one high-value super-linear dilution sample, the remaining 590 samples) in the range of 0.7-59.3ng / ml, clinical relevance as Figure 6 shown.
[0097] Since the reference value of this experiment is 1.5ng / ml, the correlation of the low value area is more worthy of attention. In the range of 0.7-5.0ng / ml, 471 samples were tested, and the clinical correlation is as follows Figure 7 As shown in the figure, in the low value range of 0.7-5.0ng / ml, the clinical correlation between the improved reagent and Abbott (R 2 =0.92076) is better.
[0098] Through specific detection, it was found that 271 cases of Abbott serum values in E01 Hospital were in the range of 1.3-66.8 ng / ml, and the correlation with Abbott clinical values was y=0.8681x+0.4262, R 2 =0.9903, the positive coincidence rate was 99.26%, the negative coincidence rate was 100%, and the total coincidence rate was 99.26%; 140 samples of Abbott fixed-value plasma from Hospital A13 were within the range of 1.2-42.4 ng / , and the correlation with Abbott clinical practice was y=1.129x-0.5051, R 2 =0.9933, the positive coincidence rate was 100%, the negative coincidence rate was 87.765, and the total coincidence rate was 91.43%.
[0099] Testing of Abbott samples revealed that the results of the recombinant SCCA monoclonal antibody of the present invention when used in the kit were consistent with Abbott's clinical results, and showed no significant difference compared with the Abbott reagent. Therefore, the recombinant SCCA monoclonal antibody prepared by the present invention can be used for clinical serological detection of serum SCCA levels.
Claims
1. A recombinant SCCA monoclonal antibody, characterized in that: It includes a light chain composed of the light chain variable region of an anti-SCCA murine antibody and the light chain constant region of human IgG1, and a heavy chain composed of the heavy chain variable region of an anti-SCCA murine antibody and the heavy chain constant region of human IgG1; wherein, when the amino acid sequence of the light chain variable region is as shown in SEQ ID NO.1, the amino acid sequence of the heavy chain variable region is as shown in SEQ ID NO.2; when the amino acid sequence of the light chain variable region is as shown in SEQ ID NO.5, the amino acid sequence of the heavy chain variable region is as shown in SEQ ID NO.
6.
2. The method for preparing the recombinant SCCA monoclonal antibody according to claim 1, characterized in that: The preparation method comprises the following steps: co-transfecting a mammalian cell 293F cell or a CHO-S cell with a plasmid carrying heavy chain and light chain genes, collecting the culture cell supernatant 4-5 days later for protein purification, and obtaining a recombinant SCCA monoclonal antibody.
3. Use of the recombinant SCCA monoclonal antibody according to claim 1 in a test paper for detecting squamous cell carcinoma antigens.
4. Use of the recombinant SCCA monoclonal antibody according to claim 1 in a kit for detecting squamous cell carcinoma antigens.