Application of rice OsRHD1-3 gene in regulating rice pollen fertility
By knocking out the OsRHD1-3 gene in rice and using the CRISPR/Cas9 system for genetic transformation, the shortcomings in the regulation of rice pollen fertility were solved, and rice varieties with reduced pollen fertility were bred, thus promoting rice breeding and yield improvement.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ZHEJIANG UNIV
- Filing Date
- 2022-01-18
- Publication Date
- 2026-04-17
AI Technical Summary
In the current technology, the function of rice pollen fertility regulatory genes is not fully understood, leading to abnormal pollen fertility or abortion, which affects rice yield and variety breeding.
By knocking out the OsRHD1-3 gene in rice, constructing a gene knockout vector using the CRISPR/Cas9 system, and performing genetic transformation, pollen fertility was reduced, thereby cultivating rice varieties with reduced pollen fertility.
Successfully breeding rice varieties with reduced pollen fertility will help in the selection of new male-sterile lines, improve rice yield and quality, and provide important biological resources.
Smart Images

Figure CN115896084B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioengineering technology, specifically to the application of the rice OsRHD1-3 gene in regulating rice pollen fertility. Background Technology
[0002] Rice is an important food crop worldwide. With the continuous growth of the population, how to increase rice yield and ensure food security has become an important scientific issue. Many factors influence rice yield, including intrinsic genetic factors such as tiller number, number of grains per panicle, and grain weight; environmental factors such as abiotic stresses (light, temperature, water, and salinity) and biotic stresses (diseases and pests); and human cultivation management, fertilization methods, and pest and disease control methods also play a significant role in rice yield.
[0003] The core method for increasing rice yield is to select and breed superior varieties, which requires efficient and reliable breeding methods. Currently, rice breeding methods include conventional breeding and molecular breeding. Hybrid breeding, a type of conventional breeding, is widely used and has greatly increased rice yield in my country. Currently, hybrid breeding methods include the three-line method and the two-line method. The three-line method includes male-sterile lines (nuclear-cytoplasmic male-sterile lines and male-sterile lines), maintainer lines, and restorer lines; the two-line method includes male-sterile lines (thermothermic male-sterile lines and photoperiodic male-sterile lines) and restorer lines. The cultivation of male-sterile lines plays a crucial role in the development of the hybrid rice industry. Developing male-sterile lines with good grain quality, strong stress resistance, and good combining ability is also an urgent problem to be solved.
[0004] The development of rice anthers is complex, involving eight stages: microsporocyte formation, microsporocyte meiosis, early microsporogenesis, mid-microsporogenesis, late microsporogenesis, early bicellular pollen development, late bicellular pollen development, and mature pollen development. Abnormalities at any stage can lead to decreased pollen fertility or even pollen abortion. Pollen development involves numerous genes; elucidating the specific functions of these genes in pollen development will have significant theoretical and practical value.
[0005] Recently, Wang et al. (D.Wang, J.Li, L.Sun, Y.Hu, J.Yu, C.Wang, F.Zhang, H.Hou, W.Liang and D.Zhang. 2021. Two rice MYB transcription factors maintain male fertility in response to photoperiod by modulating sugar partitioning. New Phytol, 231:1612-1629.) found that two MYB transcription factors, CSA1 and CSA2, can affect pollen fertility by regulating sugar partitioning, and this is regulated by photoperiod. Shim et al. (SH Shim, B. Mahong, SK Lee, M. Kongdin, C. Lee, YJ Kim, G. Qu, D. Zhang, JRK Cairns, JS Jeon. 2021. Rice β-glucosidase Os12BGlu38 is required for synthesis of intine cell wall and pollen fertility. Journal of Experimental Botany.) found that the gene Os12BGlu38, which encodes rice β-glucosidase, can regulate pollen fertility. Loss of function of this gene causes pollen shriveling and emptying. Metabolic analysis revealed that mutations in this gene lead to increased content of anther cuticle monomers and waxes. Histochemical staining and TEM analysis showed that the pollen intine of the mutant pollen was missing.
[0006] In Arabidopsis thaliana, Schiefelbein et al. (JWSchiefelbein and C. Somerville. 1990. Genetic Control of Root Hair Development in Arabidopsis thaliana. Plant Cell, 2(3): 235-243.) reported that the AtRHD1 (At1g64440) gene plays an important regulatory role in root hair development, and the Atrhd1 mutant exhibits abnormal root hair initiation.
[0007] Protein sequence alignment analysis revealed four homologous genes in rice that are functionally similar to AtRHD1, encoding UDP-glucose / galactose epimerases. However, the function of these genes in regulating pollen development in rice has not been reported. Summary of the Invention
[0008] The results of this study indicate that the OsRHD1-3 gene (Os09g0526700) plays a crucial role in pollen development, which helps to elucidate the mechanism of rice pollen sterility and facilitates the breeding of male-sterile rice lines. Knocking out this gene in rice leads to a decrease in pollen fertility.
[0009] The specific application provided by this invention is the application of the rice OsRHD1-3 gene in regulating rice pollen fertility, and the base sequence of the rice OsRHD1-3 gene is shown in SEQ ID NO.1.
[0010] This invention also provides the application of the rice OsRHD1-3 gene in the selection of rice varieties with reduced pollen fertility, the base sequence of which is shown in SEQ ID NO.1.
[0011] The present invention also provides a method for cultivating rice with reduced pollen fertility by knocking out the OsRHD1-3 gene in rice with the base sequence shown in SEQ ID NO.1.
[0012] A method for cultivating rice with reduced pollen fertility specifically includes the following steps:
[0013] (1) Construct a gene knockout vector, wherein the gene knockout vector is a plant expression vector containing a sequence for knocking out the OsRHD1-3 gene with a base sequence as shown in SEQ ID NO.1;
[0014] (2) The gene knockout vector from step (1) was introduced into rice cells to knock out the OsRHD1-3 gene with the base sequence shown in SEQ ID NO.1. After culturing, rice with reduced pollen fertility was obtained.
[0015] Preferably, the plant expression vector is pYLCRISPR / Cas9Pubi-H.
[0016] When transforming recipient plants, Agrobacterium-mediated transformation can be used. Specifically, Agrobacterium can be Agrobacterium EHA105. In step (2), after the gene knockout vector is transferred into Agrobacterium, it infects rice cells.
[0017] The recipient plant is rice. The rice variety can be Nipponbare, but is not limited to Nipponbare.
[0018] Genetic transformation of rice using the aforementioned gene knockout method revealed that the loss of function of the OsRHD1-3 gene can lead to a decrease in pollen fertility.
[0019] Preferably, the cells infected by Agrobacterium are derived from rice seed-induced callus. In addition to rice seed-induced callus, callus induced from tissue samples obtained from rice plants, or other methods that can cultivate plants after transgenic treatment, are also acceptable.
[0020] Preferably, the target base sequence for gene knockout is shown in SEQ ID NO.2. The target for gene knockout is not limited to this base sequence, as long as it can cause the loss of gene function after the OsRHD1-3 gene is knocked out.
[0021] Based on the close relationship between rice and other monocotyledonous plants, the loss of function of the OsRHD1-3 gene in this invention can lead to a decrease in pollen fertility and can also be applied to other monocotyledonous plants to cause a decrease in pollen fertility.
[0022] The beneficial effects of this invention are as follows:
[0023] This invention constructs a gene knockout vector by designing a knockout target site for the OsRHD1-3 gene and performs genetic transformation in rice. It was found that loss of OsRHD1-3 gene function leads to decreased pollen fertility, which is beneficial for the development of novel male-sterile lines. The OsRHD1-3 gene can be used for rice hybrid seed production and fertility regulation; therefore, this invention is of great significance in rice breeding and can provide important biological resources for increasing rice yield and improving rice quality. Attached Figure Description
[0024] Figure 1 A diagram showing the OsRHD1-3 genome sequence editing for the Osrhd1-3-1 and Osrhd1-3-2 knockout lines.
[0025] Figure 2 Comparison of florets between wild-type (NIP) and rice knockout lines (Osrhd1-3-1 and Osrhd1-3-2).
[0026] Figure 3 A comparison of pollen fertility between wild-type (NIP) and rice knockout lines (Osrhd1-3-1 and Osrhd1-3-2).
[0027] Figure 4 Statistical comparison of pollen fertility between wild-type (NIP) and rice knockout lines (Osrhd1-3-1 and Osrhd1-3-2); each data point includes 6 biological replicates, and measurements are shown as mean and standard deviation; **P<0.01. Detailed Implementation
[0028] Example 1
[0029] Construction of rice OsRHD1-3 gene knockout vector and rice genetic transformation.
[0030] (1) Based on the website "http: / / skl.scau.edu.cn / targetdesign / ", a specific knockout target for the OsRHD1-3 gene (the base sequence of the rice OsRHD1-3 gene is shown in SEQ ID NO.1) was designed, and the sequence is as follows:
[0031] Knockout target: GGGGTACATCGGGACGCACA.
[0032] Based on the knockout target sequence, an expression sequence corresponding to the sgRNA sequence is designed.
[0033] (2) The pYLCRISPR / Cas9Pubi-H vector was double-digested with BsaI restriction enzyme from NEB.
[0034] The system is as follows:
[0035] 2 μL buffer; 1 μL vector; 1 μL BsaI endonuclease; ddH2O to a total volume of 10 μL.
[0036] The enzyme digestion conditions were: 37℃ for 30 minutes.
[0037] (3) Target knockout synthesis
[0038] The synthesized primer target sequence is as follows:
[0039] 0526700-aFP:5'-GCCGGGGGTACATCGGGACGCACA-3';
[0040] 0526700-aRP:5'-AAACTGTGCGTCCCGATGTAACCC-3'.
[0041] The primer annealing system is as follows:
[0042] 0526700-aFP: 9 μL; 0526700-aRP: 9 μL; add ddH2O to a total volume of 20 μL.
[0043] Annealing conditions: 95℃ for 5 minutes, then remove and place at room temperature.
[0044] (4) Knockout of the link between the target site and the enzyme digestion vector
[0045] The ligation reaction was performed using Taraka's T4 ligase, and the system is as follows:
[0046] Knockout target: 1 μL; Enzyme digestion vector: 1.5 μL; T4 ligase buffer: 0.5 μL; T4 ligase: 0.5 μL; ddH2O added to total volume 5 μL.
[0047] The connection reaction conditions were: 10℃ for 3 minutes; 6℃ for 6 seconds (increase by 0.2℃ per cycle); 16℃ for 3 minutes; 18℃ for 1 minute, 19 cycles from step one to step four; 65℃ for 15 minutes; and stored at 12℃.
[0048] The ligation product was transformed into E. coli DH5α, positive clones were selected for PCR verification and sequenced, and plasmids were extracted for later use.
[0049] (5) Take out EHA105 competent cells from the -80℃ freezer and transform Agrobacterium using liquid nitrogen freeze-thaw method.
[0050] The competent cells were thawed on ice. 5 μL of the target plasmid was added to the competent cells, mixed well, and placed on ice for about 30 min. Then, all the mixture in the centrifuge tube was placed in liquid nitrogen for 1 minute to freeze. After that, it was placed in a 37°C water bath for 2 minutes to thaw. Then, 1 mL of antibiotic-free LB liquid nutrient medium was added to resuspend the cells. The cells were then placed on a shaker at 28°C and 200 rpm for 2 hours to recover. After that, the cells were plated on YEP plates containing the corresponding antibiotics (Rif (rifampicin) 50 mg / L, Kan (kanamycin sulfate) 50 mg / L) and incubated upside down at 28°C for 2 days until single colonies grew.
[0051] (7) Select the Agrobacterium tumefaciens clones that have grown out and identify the positive clones by colony PCR.
[0052] (8) Transform rice seed-induced callus using the rapid genetic transformation method of rice.
[0053] (9) Hygromycin was used to screen resistant callus and induce differentiation into seedlings. DNA was extracted from the leaves of the differentiated seedlings, and the target genome sequence was amplified and sequenced to identify target mutations. The primers used are as follows:
[0054] RHD1-3CAS-F:CGTCCGCTGCGAACTACTAA;
[0055] RHD1-3CAS-R: TGCTCTTGAGATCCCCCTGA.
[0056] Example 2
[0057] Gene editing status of rice OsRHD1-3 gene knockout lines.
[0058] To detect pollen development in florets of rice OsRHD1-3 gene knockout lines, DNA was extracted from gene-edited seedlings, and the amplified fragments were sent to Hangzhou Shangya Company for sequencing.
[0059] like Figure 1 As shown, the sequencing results revealed that both DNA single strands of the two sequenced strains had mutated, and these were homozygous mutations.
[0060] Example 3
[0061] Observation of anther characteristics in rice OsRHD1-3 gene knockout lines.
[0062] The anthers in the florets of rice OsRHD1-3 knockout lines are smaller.
[0063] The floret traits of the rice OsRHD1-3 gene knockout lines obtained in Example 2 were observed, such as... Figure 2 As shown, the anthers in the florets of rice OsRHD1-3 gene knockout lines are smaller.
[0064] Example 4
[0065] Pollen observation of rice OsRHD1-3 gene knockout lines.
[0066] To detect pollen development in florets of rice OsRHD1-3 gene knockout lines, pollen was observed using the iodine staining method.
[0067] The results are as follows Figure 3 As shown, pollen fertility is reduced in florets of rice OsRHD1-3 gene knockout lines.
[0068] Example 5
[0069] Statistics on pollen fertility of rice OsRHD1-3 gene knockout lines.
[0070] To detect pollen development in florets of rice OsRHD1-3 gene knockout lines, pollen fertility was statistically analyzed using the iodine staining method. The software used was Image Pro Plus image processing software and SPSS 25.0 statistical software.
[0071] The results are as follows Figure 4 As shown, the pollen fertility of rice OsRHD1-3 gene knockout lines was significantly reduced compared to wild-type NIP.
[0072] Our experimental results, using Nipponbare rice as a background, demonstrate that the rice OsRHD1-3 gene plays a crucial role in pollen development, and its loss of function leads to a significant reduction in pollen fertility. sequence list <110> Zhejiang University <120> Application of rice OsRHD1-3 gene in regulating rice pollen fertility <160> 6 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 1122 <212> DNA <213> Rice (Oryza sativa) <400> 1 atggtgagcg gcggaggagt agcggcggag aacggcgaga tggtggggaa cggggagggg 60 aggaagggtg cgggggcgag cgtgctggtg acggggggag cggggtacat cgggacgcac 120 acggtgctgc ggctgctgga gaaggggttc gcggtcaccg tcgtcgacaa cttccacaac 180 tccgtcccgg aggcgctcga ccgcgtccgc ctcatcgccg gcgccgccct ctccgcccgc 240 ctcgacttca tcgccgggga tctcaagagc aaggacgaca tggagaaggt gttcgccgcc 300 aagaggtatg acgccgtgat ccacttcgcc gggctgaagg cggtggggga gagcgtcgcg 360 cacccgcaga tgtactacga gaacaacgtc gccggcacca tgaacctcta ctccgccatg 420 accaagtacg gctgcaagaa gatagtgttc tcgtcgtcgg cgacggtgta cggccagccg 480 gagaagaccc cctgcgtcga ggattccaag ctgagcgctc tcaacccata cggcaccacc 540 aagctcgtcc tggagaacta cttccggcag gtgcaggccg ccgacccgga gatgagggtg 600 ]>atcctgctca ggtacttcaa ccccatcggc gctcaccgga gcggcgacat cggggaggac 660 cccaggggca tccccaacaa ccttcttccg tacatccagc aggtcgccgt cggccgccgc 720 cccgagctca acgtctacgg cgtcgactac ccaaccaggg acggcaccgc gatcagggat 780 tacatacatg tagtggacct tgccgatggc cacattgccg cactggagaa gctcttcgct 840 actcctgaca ttggttgtgt ggcttacaat ctaggaacag ggtgtggaac aacggtgctc 900 gaggtggtga aggcgttcga ggaggcgtcc ggaaagaaaa ttcctatcaa gatttgcccc 960 agaagacctg gagattgcac tgaggtttac gcttccactg acaaggccaa gaaggagctc 1020 ggatggagtg ctcggtttgg aatagaggac atgtgcaggg accagtggaa ttgggccaag 1080 aagaatccgt acggatacag cgccaatgct gagcagaatt ag 1122 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 ggggtacatc gggacgcaca 20 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <400> 3 gccgggggta catcgggacg caca 24 <210> 4 <211> twenty four <212> DNA <213> Artificial Sequence <400> 4 aaactgtgcg tcccgatgta cccc 24 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 cgtccgctgc gaactactaa 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 tgctcttgag atccccctga 20
Claims
1. Rice OsRHD1-3 The application of the gene in regulating rice pollen fertility; knocking out the gene leads to a decrease in rice pollen fertility. OsRHD1-3 The base sequence of the gene is shown in SEQ ID NO.
1.
2. A method for cultivating rice with reduced pollen fertility, characterized in that, The base sequence of rice is shown in SEQ ID NO.
1. OsRHD1-3 Gene knockout.
3. The method as described in claim 2, characterized in that, Includes the following steps: (1) Construct a gene knockout vector, wherein the gene knockout vector is a vector containing a base sequence as shown in SEQ ID NO.
1. OsRHD1-3 Plant expression vectors containing gene knockout sequences; (2) Introduce the gene knockout vector from step (1) into rice cells with the base sequence shown in SEQ ID NO.
1. OsRHD1-3 Gene knockout resulted in rice with reduced pollen fertility after culturing.
4. The method as described in claim 3, characterized in that, The plant expression vector is pYLCRISPR / Cas9Pubi-H.
5. The method as described in claim 3, characterized in that, Step (2) After the gene knockout vector is transferred into Agrobacterium, it infects rice cells.
6. The method as described in claim 5, characterized in that, The cells infected by Agrobacterium were derived from callus induced by rice seeds.
7. The method as described in claim 3, characterized in that, The target base sequence for gene knockout is shown in SEQ ID NO.2.
Citation Information
Patent Citations
Plants having enhanced yield-related traits and a method for making the same
CN102027120A
Application of rice OsRHD1-1 gene in rice male sterile line cultivation
CN113322266A
An OsUGE3 gene mutant and its application in breeding dual-purpose sterile rice lines
CN118185956B