A method for rapidly obtaining nicotine-converted strains of cultivated tobacco and its application

Abstract

The present invention discloses a method for rapidly obtaining a cultivated tobacco nicotine conversion strain and its application. The method for rapidly obtaining a cultivated tobacco nicotine conversion strain is to simultaneously knock out the genes related to tobacco nicotine conversion by using the CRISPR / Cas9 system, the genes being the NtNCP1 and NtNCP2 genes, the NtNCP1 gene sequence being shown in SEQ ID No.1, and the NtNCP2 gene sequence being shown in SEQ ID No.3. The present application uses the CRISPR / Cas9-mediated gene editing technology to simultaneously knock out the tobacco NtNCP1 and NtNCP2 genes to obtain an editing material with reduced nicotine content and increased nicotine reduction content, which provides genetic materials and theoretical basis for the functional study of tobacco nicotine conversion genes and the directional improvement of new tobacco varieties for regulating nicotine content.

Description

Technical Field

[0001] The invention relates to the technical field of plant gene engineering, and in particular to a method for rapidly obtaining nicotine-transformed strains of cultivated tobacco and its application. Background Art

[0002] Tobacco alkaloids mainly include nicotine, nornicotine, anatabine and anabasine. The composition and content of tobacco alkaloids are crucial to the quality and safety of tobacco leaves. The nicotine content of tobacco is generally above 94%, and the proportion of nornicotine does not exceed 2.5%. In the tobacco plant population of cultivated varieties, some plants will form nicotine demethylase due to gene mutation. Nicotine removes methyl under the action of this enzyme to form nornicotine, resulting in a significant increase in the nornicotine content and a significant decrease in nicotine. Such plants are called transformed strains. Nornicotine is easily oxidized, acylated and nitrosated to form myosamine, acylnornicotine and nitrosonornicotine (NNN). The formation of these substances has an important adverse effect on the aroma, taste and safety of tobacco leaves.

[0003] At present, genes such as CYP82E5v2, CYP82E2, CYP82E10 and CYP82E have been isolated and identified to catalyze the conversion of nicotine to nornicotine. Under normal cultivation conditions, some tobacco plants will undergo gene mutations to obtain nicotine conversion plants, but it is difficult to determine the mutant genes of natural mutations, and the main agronomic traits do not change, making breeding more difficult. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a method for quickly obtaining nicotine conversion strains of cultivated tobacco and its application, which provides a theoretical basis for studying the function of tobacco nicotine conversion genes and the directional improvement of cultivated tobacco varieties.

[0005] The technical problem to be solved by the present invention is achieved through the following technical solutions:

[0006] A method for rapidly obtaining cultivated tobacco nicotine conversion strains, the method comprising simultaneously knocking out tobacco nicotine conversion-related genes using a CRISPR / Cas9 system, the genes being NtNCP1 and NtNCP2 genes, the NtNCP1 gene sequence being shown in SEQ ID No.1, and the NtNCP2 gene sequence being shown in SEQ ID No.3.

[0007] Preferably, after translating the sequence of the NtNCP1 gene, the protein sequence encoded thereby is shown as SEQ ID No.2.

[0008] Preferably, after translating the sequence of the NtNCP2 gene, the protein sequence encoded thereby is shown as SEQ ID No.4.

[0009] Preferably, the method comprises the following steps:

[0010] (1) Creation of T0 generation editorial materials;

[0011] (2) The T0 generation plants were self-pollinated to obtain homozygous editing materials;

[0012] (3) Planting of homozygous edited materials and observation of their traits;

[0013] (4) GC-MS was used to detect the alkaloid content of leaves of homozygous knockout materials of NtNCP1 and NtNCP2 14 days after topping, and the nicotine conversion rate was calculated.

[0014] Preferably, in step (1), the sgRNA sequence used by the CRISPR / Cas9 system is TCATAATGCATATAGGTTGGAGG, and the primer sequence used by the sgRNA sequence is:

[0015] Upstream primer sgRNA-F: GATTGTCATAATGCATATAGGTTGG;

[0016] Downstream primer sgRNA-R: AAACCCCAACCTATATGCATTATGA.

[0017] Preferably, in step (1),

[0018] The primer sequences used for NtNCP1 target editing detection are as follows:

[0019] Upstream primer NtNCP1-F: CCATCAGAAGCCACCACCAA;

[0020] Downstream primer NtNCP1-R: TGCTCTGGTTCTTCGGCTAAG;

[0021] The primer sequences used for NtNCP2 target editing detection are as follows:

[0022] Upstream primer NtNCP2-F: CCATCAGAAGCCACCACCAA;

[0023] Downstream primer NtNCP2-R: GCGTTTATTTGCTCCGGTTCTT.

[0024] Preferably, step (1) is specifically:

[0025] Design the sgRNA guide sequence, anneal the upstream primer sgRNA-F and the downstream primer sgRNA-R to form a double-stranded product, and digest the CRISPR / Cas9 vector pORE-Cas9 with the restriction endonuclease BsaI-HF; connect the double-stranded product formed by annealing with the vector backbone that has been digested by enzymes using T4 ligase; transform the ligation product into Escherichia coli competent cells, detect the positive clones, extract the recombinant plasmid, and obtain the CRISPR-Cas9 expression vector;

[0026] The tobacco leaf discs were infected with the Agrobacterium LBA4404 bacterial solution carrying the CRISPR / Cas9-sgRNA expression vector, and T0 generation plants were obtained. After target editing detection, plants in which the NtNCP1 and NtNCP2 genes were simultaneously edited were obtained, and the T0 generation seeds were harvested.

[0027] Step (2) is specifically as follows: self-pollinating the T0 generation seeds for homozygous propagation and planting, and obtaining plants with homozygous editing of the NtNCP1 and NtNCP2 genes through target editing detection, and harvesting the plants to obtain T1 generation seeds. The primer sequences used for the target editing detection of NtNCP1 and NtNCP2 are the same as those of step (1).

[0028] The invention discloses an application of tobacco nicotine conversion-related genes in the rapid preparation of nicotine conversion plants. The tobacco nicotine conversion-related genes are NtNCP1 gene and NtNCP2 gene.

[0029] A method for rapidly obtaining cultivated tobacco nicotine transformants and its application in preparing tobacco nicotine transformants.

[0030] Preferably, the total amount of various alkaloids in the leaves of the plants with simultaneous knockout of NtNCP1 and NtNCP2 genes 14 days after topping is close to that of the control plants, but the nicotine content is significantly lower than that of the control plants, the nornicotine content is significantly higher than that of the control plants, and the nicotine conversion rate is higher than 20%.

[0031] The above technical solution of the present invention has the following beneficial effects:

[0032] The present invention constructs a CRISPR / Cas9 editing vector for simultaneously knocking out tobacco NtNCP1 and NtNCP2 genes through CRISPR / Cas9-mediated gene editing technology, and obtains red flower Dajinyuan edited plants with tobacco NtNCP1 and NtNCP2 genes simultaneously knocked out after editing material creation and molecular detection and identification.

[0033] The tobacco plants with both the tobacco NtNCP1 and NtNCP2 genes knocked out provided by the present invention have no significant differences in main agronomic traits such as plant height, waist leaf length, waist leaf width, stem girth, etc. compared with the control (unedited).

[0034] The tobacco nicotine conversion-related genes NtNCP1 and NtNCP2 provided by the present invention were detected by gas chromatography-mass spectrometry and found that the total amount of various alkaloids in the leaves of plants with simultaneous knockout of NtNCP1 and NtNCP2 genes 14 days after topping was close to that of the control, but the nicotine content was extremely significantly lower than that of the control plants, the nornicotine content was extremely significantly higher than that of the control, and the nicotine conversion rate was higher than 20%.

[0035] In summary, the CRISPR / Cas9-mediated gene editing technology was used to knock out both the tobacco NtNCP1 and NtNCP2 genes and obtain edited materials with reduced nicotine content and increased nornicotine content. This provides genetic material and theoretical basis for the functional study of tobacco nicotine conversion genes and the targeted improvement of new tobacco varieties for nicotine content regulation. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate embodiments of the invention and, together with the description, serve to explain the principles of the invention.

[0037] Figure 1 Comparison of the main agronomic traits of the edited plants of the present invention and the control (unedited) plants.

[0038] Figure 2 Comparison of nicotine conversion rates between the edited plants of the present invention and the control (unedited) plants. DETAILED DESCRIPTION

[0039] Various exemplary embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be noted that the relative arrangement of components and steps, numerical expressions and numerical values ​​set forth in these embodiments do not limit the scope of the present invention unless otherwise specifically stated.

[0040] All experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0041] Example 1 Acquisition of NtNCP1 gene

[0042] The cultivated tobacco safflower Dajinyuan whole plant was used as the experimental material, and the total RNA from the tobacco root was extracted using an RNA extraction kit, and reverse transcribed into cDNA for later use:

[0043] Tobacco total RNA was extracted according to the instructions of the plant RNA extraction kit.

[0044] 1 μg of total RNA was extracted from leaves for reverse transcription, and the transcription system was as follows:

[0045] Total RNA 1 μg;

[0046] Oligo(dT) (10 μM) 1.5 μL;

[0047] dH 2 O up to 15μL.

[0048] Mix the above system and place it in PCR, keep it at 70℃ for 5 minutes, remove it and immediately place it on ice for 5 minutes, then add the following reagents to the system:

[0049]

[0050] The above system was placed in a PCR instrument, incubated at 42°C for 65 min, 65°C for 10 min, kept at 4°C, and then stored in a -20°C refrigerator for use.

[0051] By using the homology comparison method and referring to the known tobacco partial gene sequence, the amplification primer sequences were designed as follows:

[0052] F: 5'-ATGGCGTCAAAGCTCTTTTGG-3' (SEQ ID No. 5);

[0053] R: 5'-TCAAAAATAATCAACTACAGGAG-3' (SEQ ID No. 6).

[0054] Using the above prepared cDNA as template, PCR amplification was performed using the above primers:

[0055] Amplification system (50 μL):

[0056]

[0057] After mixing and centrifuging, PCR amplification was performed. The PCR reaction conditions were: 95°C for 10 sec, 52°C for 30 sec, 72°C for 2 min, for a total of 30 cycles; 72°C for 10 min; 25°C Hold.

[0058] The amplified product was purified and sequenced to obtain the gene NtNCP1 sequence related to tobacco nicotine conversion, whose base sequence is shown in SEQ ID No. 1, including 690 bases in total. After translating the gene sequence, the protein sequence encoded by it is shown in SEQ ID No. 2, including 229 amino acid residues in total.

[0059] Example 2 Acquisition of NtNCP2 gene

[0060] The cultivated tobacco safflower Dajinyuan whole plant was used as the experimental material, and the total RNA from the tobacco root was extracted using an RNA extraction kit, and reverse transcribed into cDNA for later use:

[0061] Tobacco total RNA was extracted according to the instructions of the plant RNA extraction kit.

[0062] 1 μg of total RNA was extracted from leaves for reverse transcription, and the transcription system was as follows:

[0063] Total RNA 1 μg;

[0064] Oligo(dT) (10 μM) 1.5 μL;

[0065] dH 2 O up to 15μL.

[0066] Mix the above system and place it in PCR, keep it at 70℃ for 5 minutes, remove it and immediately place it on ice for 5 minutes, then add the following reagents to the system:

[0067]

[0068] The above system was placed in a PCR instrument, incubated at 42°C for 65 min, 65°C for 10 min, kept at 4°C, and then stored in a -20°C refrigerator for use.

[0069] By using the homology comparison method and referring to the known tobacco partial gene sequence, the amplification primer sequences were designed as follows:

[0070] F: 5'-ATGGCCCAATGTATGGATGCTG-3' (SEQ ID No. 7);

[0071] R: 5'-TCAAAAATAATCAATTACAGGAG-3' (SEQ ID No. 8).

[0072] Using the above prepared cDNA as template, PCR amplification was performed using the above primers:

[0073] Amplification system (50 μL):

[0074]

[0075]

[0076] After mixing and centrifuging, PCR amplification was performed. The PCR reaction conditions were: 95°C for 10 sec, 52°C for 30 sec, 72°C for 2 min, for a total of 30 cycles; 72°C for 10 min; 25°C Hold.

[0077] The amplified product was purified and sequenced to obtain the gene NtNCP2 sequence related to tobacco nicotine conversion, the base sequence of which is shown in SEQ ID No. 3, including a total of 1083 bases. After translating the gene sequence, the protein sequence encoded by it is shown in SEQ ID No. 4, including a total of 360 amino acid residues.

[0078] Example 3 Construction of expression vector

[0079] Using the nicotine conversion-related genes NtNCP1 and NtNCP2 obtained in Example 1, the present invention further constructed a CRISPR / Cas9 vector.

[0080] (1) Design and synthesis of sgRNA sequences for NtNCP1 and NtNCP2 genes:

[0081] The online software CRISPR-P 2.0 (http: / / cbi.hzau.edu.cn / crispr / ) was used to design the sgRNA guide sequence, and the guide sequence with a high score and located at the appropriate position of the NtNCP1 and NtNCP2 gene sequences was selected. The sgRNA sequence selected in this application is: TCATAATGCATATAGGTTGGAGG (SEQ ID No. 9).

[0082] (2) Design forward and reverse primers of sgRNA sequence and hand them over to the design company for synthesis:

[0083] Upstream primer sgRNA-F: GATTGTCATAATGCATATAGGTTGG (SEQ ID No. 10);

[0084] Downstream primer sgRNA-R: AAACCCCAACCTATATGCATTATGA (SEQ ID No. 11).

[0085] (3) Primer annealing: The synthesized target sequence primers (upstream primer and downstream primer) were annealed with sterilized ddH 2 O was diluted to a concentration of 100 ng / μL, and then 5 μL of the upstream and downstream primers were taken into a PCR tube and mixed evenly, and placed on a PCR instrument for annealing, so that the upstream and downstream Oligo single chains were annealed to form double chains.

[0086] The annealing program of the PCR instrument was: 95°C for 2 min, -0.1°C / 8 s, annealing to 25°C, and the annealing product was diluted to 10 ng / μL by adding 90 μL sterile water.

[0087] (4) Enzyme digestion and ligation

[0088] a. CRISPR / Cas9 vector pORE-Cas9 (provided by Southwest University) was digested with restriction endonuclease BsaI-HF.

[0089] Enzyme digestion system (50 μL):

[0090]

[0091] The fragment was digested overnight at 37°C and subjected to 1.5% agarose gel electrophoresis to cut the target fragment band. The backbone fragment was recovered using a gel recovery kit.

[0092] b. Connection

[0093] The double-stranded product formed by annealing is connected to the vector backbone that has been cut by enzymes.

[0094] Ligation system (10 μL):

[0095]

[0096] The connection conditions were: 16°C for 2 hours.

[0097] (5) Transformation of Escherichia coli:

[0098] a. Take out the Trans-T1 competent cells from -80℃, freeze and thaw on ice, and divide into 50μL / aliquots;

[0099] b. After the competent cells melt, add 10 μL of the ligation product to the competent cells, mix gently, and place on ice for 10 minutes;

[0100] c. After ice bath, heat shock the cells in a 42°C water bath for 90 seconds, and quickly place the cells back on ice for 2 minutes.

[0101] d. Spread 60 μL of the transformation product evenly on LB solid medium containing 16 mg / L kanamycin and culture in a 37°C bacterial incubator for 12 hours.

[0102] (6) Positive clone screening:

[0103] a. After a single colony grows on the plate, pick a single colony of E. coli and place it in LB liquid medium containing 50 mg / L kanamycin, and shake it overnight at 37°C;

[0104] b. Take part of the bacterial solution for PCR and detect whether it is a positive clone by nucleic acid electrophoresis;

[0105] c. Extract the E. coli plasmid from the remaining part of the bacterial solution that was initially detected as a positive clone. Send the plasmid to Novogene for sequencing to confirm the correctness of the positive clone.

[0106] Example 4 Obtaining and Detecting T0 Generation Plants

[0107] (1) Transformation of Agrobacterium

[0108] Using the CRISPR / Cas9-NtNCP1-NtNCP2 editing vector plasmid constructed in the previous step, genetic transformation and tissue culture were carried out using Honghua Dajinyuan as an example to obtain plants with knockout editing of tobacco nicotine conversion-related genes NtNCP1 and NtNCP2. The relevant experimental process is briefly described as follows.

[0109] After the surface of tobacco seeds is disinfected, they are planted on MS medium. When they grow to 4 cotyledons (15-20 days), they are transferred to culture bottles containing MS solid medium and kept at 25±1℃ and light intensity of 30-50μmol / (m 2 ·s), and continue culturing for 35-40 days under the condition of 16h / d light intensity, and set aside.

[0110] The plasmid with the correct sequence is transformed into Agrobacterium. The specific steps are as follows:

[0111] ① Take out the LBA4404 electroporation competent Agrobacterium cells stored at -80℃ and place them on ice for freezing and thawing.

[0112] ② When the competent cells have just thawed, add 2 μL of CRISPR / Cas9-NtNCP1-NtNCP2 editing vector plasmid, mix well, and place on ice.

[0113] ③ Transfer the mixed competent cells to a pre-cooled electroporation cup, place the electroporation cup in an electroporator for transformation, add 1 mL of YEB liquid culture medium and mix with the transformation solution after transformation, and then place in a shaker at 28°C and 200 rpm for 1.5-2 hours.

[0114] ④ Centrifuge the culture medium at 8,000 rpm, discard the supernatant, and then suspend the bacteria in 200 μL of YEB liquid culture medium, apply it on YEB solid culture medium containing 50 mg / L rifampicin, 50 mg / L streptomycin and 50 mg / L kanamycin, and culture inverted in the dark at 28°C for 2-3 days.

[0115] (2) Infection of callus tissue

[0116] ① Make a tobacco leaf disc into a square leaf disc with a side length of 1 cm in a clean bench, and use MS liquid to prepare Agrobacterium colonies containing CRISPR / Cas9-NtNCP1-NtNCP2 editing vectors into a suspended bacterial liquid (OD 600 =0.6-0.8).

[0117] ② Soak the tobacco leaf discs in suspended Agrobacterium solution for 10 minutes.

[0118] ③ Place the leaf disc on MS solid culture medium containing 2.0 mg / L NAA + 0.5 mg / L 6-BA at 28°C in the dark for 3 days.

[0119] ④ Carry out subculture and place on MS solid culture medium containing 2.0 mg / L NAA + 0.5 mg / L 6-BA + 250 mg / L Cb + 50 mg / L Kan.

[0120] The culture conditions are: 28℃ light culture for 16h / d, light intensity 30-50μmol / (m2·s), 25℃ dark culture for 8h / d, culture for 45-60d, until differentiation buds are formed, change the differentiation culture medium every 7-10d, change 3-4 times; culture until differentiation buds are formed; cut the callus with differentiation buds, place it on MS medium containing 500mg / L carbenicillin and 50mg / L kanamycin for culture, wait until the differentiation buds on the callus grow to 2-4cm high, culture conditions and differentiation buds. The culture conditions were consistent with those of the differentiation culture, and the culture was carried out for 8-14 days; for rooting culture of regenerated plants, the differentiated buds were cut off and inserted into MS medium containing 500 mg / L carbenicillin and 50 mg / L kanamycin for rooting culture. The culture conditions were consistent with those of the differentiation culture, and the culture was carried out for 20-30 days. The regenerated plants were transplanted into flower pots for culture, and then the leaves of the transformed plants were sampled and sent to BGI for molecular detection. The primers for NtNCP1 target detection were: upstream primer NtNCP1-F: CCATCAGAAGCCACCACCAA (SEQ The target detection primers for NtNCP2 were: upstream primer NtNCP2-F: CCATCAGAAGCCACCACCAA (SEQ ID No. 14) and downstream primer NtNCP2-R: GCGTTTATTTGCTCCGGTTCTT (SEQ ID No. 15), and the T0 generation plants with both NtNCP1 and NtNCP2 genes knocked out were obtained and collected for future use.

[0121] Example 5 Obtaining homozygous editing material

[0122] The T0 generation seeds were self-pollinated and homozygous at 96 times. When the plants grew to 5-6 leaves, the leaves of individual plants were sampled and sent to BGI for molecular detection. The primers for NtNCP1 target detection were: upstream primer NtNCP1-F: CCATCAGAAGCCACCACCAA (SEQ ID No. 12) and downstream primer NtNCP1-R: TGCTCTGGTTCTTCGGCTAAG (SEQ ID No. 13); the primers for NtNCP2 target detection were: upstream primer NtNCP2-F: CCATCAGAAGCCACCACCAA (SEQID No. 14) and downstream primer NtNCP2-R: GCGTTTATTTGCTCCGGTTCTT (SEQ ID No. 15). Plants with homozygous editing of NtNCP1 and NtNCP2 genes were determined, and then harvested to obtain T1 generation seeds with homozygous editing of NtNCP1 and NtNCP2 genes.

[0123] Example 6 Material planting and character investigation

[0124] The seeds of the plants with homozygous knockout of NtNCP1 and NtNCP2 genes determined by molecular detection in Example 4 were propagated in potted plants, 60 plants were planted, and the plants were topped during the flowering period. Ten days after topping, the plant height, waist leaf length, waist leaf width, stem girth, and internode distance were measured and analyzed with reference to "YCT 142-2010 Survey and Measurement Methods for Agronomic Traits of Tobacco".

[0125] Now, 10 days after topping, we collected data on plant height, waist leaf length, waist leaf width, stem girth and other indicators of 10 tobacco plants, and conducted statistical analysis.

[0126] The results showed that the height, stem girth, waist leaf length, waist leaf width and other indicators of the plants with both NtNCP1 and NtNCP2 genes knocked out were close to those of the control plants, with no significant differences. Figure 1 shown.

[0127] Example 7 GC-MS Detection

[0128] Using the edited plants planted in Example 5, GC-MS was then used to detect the alkaloid content in the leaves of the homozygous knockout materials of NtNCP1 and NtNCP2 genes 14 days after topping.

[0129] Select tobacco plants 14 days after topping, collect samples from 5 control (unedited) tobacco plants, and collect leaves from the same leaf position; select tobacco plants 10 days after topping, collect samples from 5 tobacco plants homozygous for editing of NtNCP1 and NtNCP2 genes; remove the main veins of the leaves, wrap them in tin foil, store and transport them in liquid nitrogen, store them at ultra-low temperature (-70℃) in the laboratory, and freeze-dry, grind and sieve them.

[0130] Weigh 0.2 g of sample into a 15 mL centrifuge tube, accurate to 0.1 mg, add 2.0 mL of 5% sodium hydroxide solution, and then add 0.05 mL of internal standard solution A (dimethylquinoline solution, prepared in methanol, diluted to 1.0 mg / mL with dichloromethane) and internal standard solution B (2,2'-bipyridine-d2 solution, prepared in methanol, diluted to 0.5 mg / mL with dichloromethane), shake and mix, let stand for 20 min, then add 10.0 mL of extraction solution (dichloromethane and methanol are mixed in a volume ratio of 4:1), cover and seal, and place in a vortex oscillator, shake and extract at a speed of 2000 r / min for 40 min, let stand for 1 hour, centrifuge for 8 min, take the lower organic phase, transfer it to a chromatographic bottle, and analyze it by GC-MS.

[0131] The reference conditions for gas chromatography are as follows: chromatographic column: DB-35MS or equivalent capillary column, specification: 30 mm (length) × 0.25 mm (inner diameter) × 0.25 m (film thickness); injection port temperature: 250°C; column flow rate: 1.0 mL / min; nicotine injection volume: 1.0 L, split injection, split ratio of 40:1; other alkaloid injection volume: 2.0 L, split injection, split ratio of 10:1; heating program: initial temperature 100°C, hold for 3 min; increase to 260°C at a rate of 8°C / min, hold for 10 min.

[0132] Mass spectrometry reference conditions: transfer line temperature: 280°C; ionization mode: electron impact source (EI); ionization energy: 70 eV; ion source temperature: 230°C; solvent delay: 8 min; determination method: selected ion monitoring (SIM) scanning.

[0133] The nicotine content of the leaves of the control (unedited) and homozygous NtNCP1 and NtNCP2 gene edited tobacco plants 14 days after topping was compared (the results are shown in Table 1). The results showed that: by gas chromatography-mass spectrometry (GC-MS) detection, the total amount of alkaloids in the NtNCP1 and NtNCP2 gene knockout edited plants 14 days after topping was close to that of the control, but the nicotine content was significantly lower than that of the control plants, and the nornicotine content was significantly higher than that of the control. The nicotine conversion rate was 24.3% (the control was 0.5%), which exceeded the judgment standard of 2.5%, indicating that nicotine conversion strains can be quickly obtained by knocking out the NtNCP1 and NtNCP2 genes of cultivated tobacco at the same time through gene editing. This provides genetic materials and theoretical basis for the study of the function of tobacco nicotine conversion-related genes and the cultivation of new tobacco varieties for nicotine content regulation.

[0134] Table 1 shows the alkaloid content (μg / g) of fresh tobacco leaves of the edited plants of the present invention and the control (unedited) 14 days after topping

[0135]

[0136] Although the present invention has been disclosed as above by the embodiments, it is not intended to limit the present invention. Any person skilled in the art may make various choices and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention is limited by the claims and their equivalents.

Claims

1. A method for rapidly obtaining a nicotine-transformed strain of cultivated tobacco, characterized in that: The method utilizes the CRISPR / Cas9 system to simultaneously knock out genes related to tobacco nicotine conversion, wherein the genes are NtNCP1 and NtNCP2 genes, the NtNCP1 gene sequence is shown in SEQ ID No.1, and the NtNCP2 gene sequence is shown in SEQ ID No.

3.

2. The method for rapidly obtaining cultivated tobacco nicotine transformants according to claim 1, characterized in that: After translating the sequence of the NtNCP1 gene, the protein sequence encoded by the gene is shown as SEQ ID No.

2.

3. The method for rapidly obtaining cultivated tobacco nicotine transformants according to claim 1, characterized in that: After translating the sequence of the NtNCP2 gene, the protein sequence encoded by it is shown as SEQ ID No.

4.

4. The method for rapidly obtaining cultivated tobacco nicotine transformants according to claim 1, characterized in that: The following steps are involved: (1) Creation of T0 generation editorial materials; (2) The T0 generation plants were self-pollinated to obtain homozygous editing materials; (3) Planting of homozygous edited materials and observation of their traits; (4) GC-MS was used to detect the alkaloid content of leaves of homozygous knockout materials of NtNCP1 and NtNCP2 14 days after topping, and the nicotine conversion rate was calculated.

5. The method for rapidly obtaining cultivated tobacco nicotine transformants according to claim 4, characterized in that: In step (1), the sgRNA sequence used by the CRISPR / Cas9 system is TCATAATGCATATAGGTTGGAGG, and the primer sequence used by the sgRNA sequence is: Upstream primer sgRNA-F: GATTGTCATAATGCATATAGGTTGG; Downstream primer sgRNA-R: AAACCCCAACCTATATGCATTATGA.

6. The method for rapidly obtaining cultivated tobacco nicotine transformants according to claim 5, characterized in that: In step (1), The primer sequences used for NtNCP1 target editing detection are as follows: Upstream primer NtNCP1-F: CCATCAGAAGCCACCACCAA; Downstream primer NtNCP1-R: TGCTCTGGTTCTTCGGCTAAG; The primer sequences used for NtNCP2 target editing detection are as follows: Upstream primer NtNCP2-F: CCATCAGAAGCCACCACCAA; Downstream primer NtNCP2-R: GCGTTTATTTGCTCCGGTTCTT.

7. The method for rapidly obtaining cultivated tobacco nicotine transformants according to claim 6, characterized in that: Step (1) is specifically as follows: Design the sgRNA guide sequence, anneal the upstream primer sgRNA-F and the downstream primer sgRNA-R to form a double-stranded product, and digest the CRISPR / Cas9 vector pORE-Cas9 with the restriction endonuclease BsaI-HF; connect the double-stranded product formed by annealing with the vector backbone that has been digested by enzymes using T4 ligase; transform the ligation product into Escherichia coli competent cells, detect the positive clones, extract the recombinant plasmid, and obtain the CRISPR-Cas9 expression vector; The Agrobacterium LBA4404 bacterial solution carrying the CRISPR / Cas9-sgRNA expression vector was immersed in tobacco leaf discs to obtain T0 generation plants. After target editing detection, plants with simultaneous editing of NtNCP1 and NtNCP2 genes were obtained and harvested to obtain T0 generation seeds. Step (2) is specifically as follows: The T0 generation seeds are self-pollinated and homozygous for propagation. After target editing detection, plants with homozygous editing of NtNCP1 and NtNCP2 genes are obtained. The T1 generation seeds are harvested. The primer sequences used for the target editing detection of NtNCP1 and NtNCP2 are the same as those in step (1).

8. Use of the method for rapidly obtaining cultivated tobacco nicotine transformants according to any one of claims 1 to 7 in preparing tobacco nicotine transformants.

9. The use according to claim 8, characterized in that: The total amount of various alkaloids in the leaves of the plants with simultaneous knockout of NtNCP1 and NtNCP2 genes 14 days after topping was close to that of the control plants, but the nicotine content was significantly lower than that of the control plants, the nornicotine content was significantly higher than that of the control plants, and the nicotine conversion rate was higher than 20%.

Images