A crRNA target and crisper-cas13a system for detecting yellow fever virus

Abstract

The application discloses a crRNA target point and a CRISPR-Cas13a system for detecting yellow fever virus. The application provides a CRISPR-Cas13a system for detecting yellow fever virus, which comprises a Cas13a protein and a crRNA, or a complex formed by the two; the crRNA comprises an anchor sequence for being combined with the Cas13a protein and a guide sequence for targeting a target point sequence of the yellow fever virus. Based on the CRISPR-Cas13a nucleic acid detection technology, through design, construction and screening, the application finally provides an RT-RAA amplification primer pair for detecting the yellow fever virus, a target point sequence to be detected and a specific crRNA capable of targeting the target point sequence. The crRNA can realize high-sensitivity and high-specificity detection of the nucleic acid of the yellow fever virus site by activating the Cas13a, and the sensitivity reaches a single copy. The application has important application value.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular diagnosis, and relates to a crRNA target point and a CRISPR-Cas13a system for detecting yellow fever virus. BACKGROUND

[0002] Yellow fever virus (YFV) belongs to the Flavivirus genus of the Flaviridae family and is the pathogen causing human yellow fever. The disease mainly prevails in Africa and South America and is one of the three infectious diseases (the other two are cholera and plague) regulated by the International Health Regulations, is transmitted by mosquitoes, and is generally sensitive to the virus regardless of age, gender and race. The disease generally occurs in an epidemic manner, and if the medium mosquitoes breed in large quantities, the infection can cause an outbreak in the population, which is extremely harmful. Generally speaking, the isolation of viruses by using animals or cell culture is the most reliable, but it is time-consuming and laborious, and the commonly used serological method has insufficient sensitivity for the detection of a small amount of viral antigen. At present, there have been reports on the detection of yellow fever virus by using molecular biology methods such as nucleic acid hybridization technology and polymerase chain reaction technology. Although these two technologies play a crucial role in identifying new variants, they both depend on professional instruments and equipment, laboratory facilities and detection personnel, and it is difficult to achieve rapid on-site detection in primary medical and health institutions, remote areas and developing countries and regions such as Africa and South America. In order to improve the detection capability of variants in primary front-line and underdeveloped areas and promote the front and downward movement of detection technology, it is urgent to develop a rapid, convenient, sensitive and specific detection method for yellow fever virus.

[0003] In April 2017, American researchers established a nucleic acid detection technology with a sensitivity of angstrom level (single copy) and a specificity of single base - a nucleic acid detection platform SHERLOCK (Specific High Sensitivity Enzymatic Reporter UnLOCKing) based on CRISPR-Cas13a, which uses the non-specific cleavage activity of Leptotrichia wadei Cas13a protein (LwCas13a) and combines with recombinase polymerase amplification technology (Recombinase Polymerase Amplification, RPA) that can efficiently amplify the target fragment, to realize rapid, inexpensive and highly sensitive detection of trace nucleic acids. Studies have shown that Cas13a can be used to identify Zika and dengue viruses in biological samples (blood or urine), and further distinguish the gene sequences of African and American strains, and can also be used to identify specific types of bacteria. After identifying viral or bacterial nucleic acids, it can be directly used for pathogen typing by designing specific crRNA, and its ultra-high sensitivity avoids a large number of complex upstream experimental work, that is, it can directly amplify biological samples for detection, shortening the sample pretreatment process. Therefore, this technology has great application prospects in the fields of basic research, diagnosis and treatment. SUMMARY

[0004] The first object of the present application is to provide a CRISPR-Cas13a system for detecting yellow fever virus.

[0005] The present application provides a CRISPR-Cas13a system for detecting yellow fever virus, which comprises a Cas13a protein and a crRNA, or a complex formed by the two.

[0006] The crRNA comprises an anchor sequence for binding to the Cas13a protein and a guide sequence targeting a yellow fever virus target sequence.

[0007] The yellow fever virus target sequence is sequence 1.

[0008] In the above-mentioned CRISPR-Cas13a system, the crRNA sequence is sequence 2. The 1st-38th of sequence 2 is an anchor sequence for binding to the Cas13a protein; the 39th-66th of sequence 2 is a guide sequence targeting a yellow fever virus target sequence.

[0009] In the above-mentioned CRISPR-Cas13a system, the Cas13a protein is LwCas13a protein.

[0010] The second object of the present application is to provide a kit for detecting yellow fever virus.

[0011] The kit for detecting yellow fever virus provided by the application comprises the CRISPR-Cas13a system for detecting yellow fever virus.

[0012] Further, the kit further comprises a primer pair for specifically amplifying the target sequence of the yellow fever virus; the primer pair comprises a single-stranded DNA molecule shown in sequence 4 and a single-stranded DNA molecule shown in sequence 5.

[0013] Still further, the kit further comprises other reagents for specifically amplifying the target sequence of the yellow fever virus and other reagents for detecting the amplification product. The other reagents for specifically amplifying the target sequence of the yellow fever virus comprise buffer and / or ddH2O; the other reagents for detecting the amplification product comprise all or part of the following reagents: LwCas13a protein, NTP (such as NTP Mix), T7 RNA polymerase, RNAse inhibitor, reporter RNA (fluorescent reporter RNA with signal reporting function or reporter RNA for test paper detection), RNase free water.

[0014] The kit can further comprise a carrier recording the determination standard A or the determination standard B as follows:

[0015] The determination standard A of the CRISPR-Cas13a fluorescent detection system: if the fluorescence intensity value of the detection system of the sample to be tested is 3 times higher than the fluorescence intensity value of the negative control (ddH2O) (including the case that the fluorescence intensity value of the detection system of the sample to be tested is 3 times higher than the fluorescence intensity value of the negative control) within the same detection time, or the fluorescence intensity value of the detection system of the sample to be tested is greater than or equal to 0.3 a.u. at any time, then the sample to be tested contains or is suspected to contain the yellow fever virus, otherwise the sample to be tested does not contain or is suspected not to contain the yellow fever virus.

[0016] The determination standard B of the CRISPR-Cas13a test paper system: the system is dropped on the test paper after the reaction, and the reading is performed 2-5 minutes later; if the test paper does not show the "T" line and shows the "C" line, then the sample to be tested contains or is suspected to contain the yellow fever virus; if the test paper shows the "T" line and shows the "C" line, then the sample to be tested does not contain or is suspected not to contain the yellow fever virus; if the test paper does not show the "C" line, then the test paper is invalid, and the test paper needs to be replaced for retesting.

[0017] A third object of the application is to provide any of the following substances:

[0018] A1) the above-mentioned crRNA;

[0019] A2) the above-mentioned Cas13a protein and crRNA, or a complex formed by the two;

[0020] A3) the above-mentioned primer pair.

[0021] A third object of the present application is to provide any of the following applications:

[0022] B1) the use of the above-mentioned system or the above-mentioned kit or the above-mentioned substance in the detection or aid detection of yellow fever virus;

[0023] B2) the use of the above-mentioned system or the above-mentioned kit or the above-mentioned substance in the preparation of a product for the detection or aid detection of yellow fever virus;

[0024] B3) the use of the above-mentioned system or the above-mentioned kit or the above-mentioned substance in the detection or aid detection of whether the test sample contains yellow fever virus;

[0025] B4) the use of the above-mentioned system or the above-mentioned kit or the above-mentioned substance in the preparation of a product for the detection or aid detection of whether the test sample contains yellow fever virus;

[0026] B5) the use of the above-mentioned system or the above-mentioned kit or the above-mentioned substance in the screening or aid screening of yellow fever virus prevention and treatment drugs;

[0027] B6) the use of the above-mentioned system or the above-mentioned kit or the above-mentioned substance in the preparation of a product for the screening or aid screening of yellow fever virus prevention and treatment drugs;

[0028] B7) the use of the above-mentioned substance in the preparation of the above-mentioned kit.

[0029] A last object of the present application is to provide a method for the detection or aid detection of yellow fever virus.

[0030] The method for the detection or aid detection of yellow fever virus provided by the present application comprises the following steps:

[0031] C1) using the nucleic acid of the test sample as a template, performing RT-RAA amplification with a primer pair composed of a single-stranded DNA molecule represented by sequence 4 and a single-stranded DNA molecule represented by sequence 5 to obtain an RT-RAA product;

[0032] C2) preparing a CRISPR-Cas13a detection system containing the following components: the RT-RAA product, Cas13a protein, the above-mentioned crRNA, reporter RNA, NTP, T7 RNA polymerase, and RNAase inhibitor; at the same time, replacing the PCR product with water (ddH2O) as a negative control; and reacting;

[0033] C3) reacting the CRISPR-Cas13a detection system, detecting the reaction product, and thereby determining whether the test sample contains yellow fever virus.

[0034] The above-mentioned reaction is a fluorescent system reaction C3)-1 or a test strip system reaction C3)-2:

[0035] C3)-1: the CRISPR-Cas13a detection system is reacted, and the RNA in the CRISPR-Cas13a detection system is a fluorescent reporter RNA; the CRISPR-Cas13a detection system is placed in a fluorescent quantitative PCR instrument for reaction, the fluorescence intensity is detected, and whether the sample to be detected contains yellow fever virus is determined according to the size of the fluorescence intensity: if the fluorescence intensity value of the sample to be detected is more than 3 times (including the case that the fluorescence intensity value of the sample to be detected is 3 times that of the negative control) the fluorescence intensity value of the negative control (ddH2O) within the same detection time, or the fluorescence intensity value of the sample to be detected is greater than or equal to 0.3 a.u. at any time, then the sample to be detected contains or is suspected to contain yellow fever virus, otherwise the sample to be detected does not contain or is suspected not to contain yellow fever virus;

[0036] C3)-2: the CRISPR-Cas13a detection system is reacted, and the RNA in the CRISPR-Cas13a detection system is a reporter RNA for test paper detection; the reaction product is detected by test paper, and whether the sample to be detected contains yellow fever virus is determined according to whether the "T" line disappears and the "C" line appears: if the "T" line of the sample to be detected disappears and the "C" line appears within the same detection time, then the sample to be detected contains or is suspected to contain yellow fever virus, otherwise the sample to be detected does not contain or is suspected not to contain yellow fever virus.

[0037] Further, in step C1), the reaction condition of the RT-RAA amplification is: 40-44℃ (such as 40-42℃, 42-44℃, 40℃, 42℃ or 44℃) for 20-40min (such as 20-30min, 30-40min, 20min, 30min or 40min).

[0038] In the above step C3)-1, the reaction condition is: 35-39℃, and the fluorescence intensity value is read once every 1-3min, and more than 20 times.

[0039] In the above step C3)-2, the reaction condition is: 37℃, and the reaction is performed for 30min.

[0040] Further, any of the above-mentioned samples to be detected can be a blood sample, urine, organ (such as liver, spleen, kidney, etc.) tissue sample or cell, etc.

[0041] The method for detecting or assisting in detecting yellow fever virus provided by the application can be a non-disease diagnosis and treatment method, or a disease diagnosis and treatment method. Among them, the non-disease diagnosis and treatment method can be used to detect whether the cell contains yellow fever virus before and after the drug is used when screening yellow fever virus prevention and treatment drugs at the cell level.

[0042] In any of the above-mentioned systems or kits or RT-RAA primer pairs or applications or methods, the target of the yellow fever virus can be various targets of the yellow fever virus.

[0043] The RT-RAA detection technology based on the application has the technical advantages of simple operation, stable system and wide application in the field of clinical molecular diagnosis. The RT-RAA technology is combined with the CRISPR based on Cas13a protein. Through design, construction and screening, a crRNA capable of targeting the sequence of the yellow fever virus and activating the CRISPR-Cas13a system is finally provided. The RT-RAA-CRISPR system constructed by using the target can specifically detect the yellow fever virus.

[0044] Based on the CRISPR-Cas13a nucleic acid detection technology, through design, construction and screening, a RT-RAA amplification primer pair for the detection of the yellow fever virus, a target sequence to be detected and a specific crRNA capable of targeting the target sequence are finally provided. The crRNA can activate Cas13a to achieve high sensitivity and high specificity detection of the nucleic acid of the yellow fever virus site, and the sensitivity reaches single copy (1 copy / test). The application has important application value. BRIEF DESCRIPTION OF DRAWINGS

[0045] Figure 1 Figure is the result diagram of agarose gel electrophoresis screening of candidate 16 pairs of RT-RAA primers.

[0046] Figure 2 Figure is the result diagram (fluorescence diagram) of CRISPR fluorescence method screening of candidate 2 pairs of RT-RAA primers.

[0047] Figure 3 Figure is the screening result (30 min) of 4 yellow fever virus site crRNAs.

[0048] Figure 4 Figure is the CRISPR-Cas13a detection sensitivity result (fluorescence diagram) of the yellow fever virus containing-crRNA-2.

[0049] Figure 5 Figure is the CRISPR-Cas13a detection sensitivity result (30 min) of the yellow fever virus containing-crRNA-2.

[0050] Figure 6 Figure is the CRISPR-Cas13a detection sensitivity result (test paper diagram) of the yellow fever virus containing-crRNA-2.

[0051] Figure 7 Figure is the CRISPR-Cas13a for the site of the yellow fever virus does not appear cross reaction when detecting other pathogens (fluorescence diagram).

[0052] Figure 8 The CRISPR-Cas13a targeting the site of yellow fever virus did not show cross-reaction in detecting other pathogens (strip chart). DETAILED DESCRIPTION

[0053] The application will be further described in conjunction with the specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0054] The experimental methods in the following examples are all routine methods, unless otherwise specified, according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially.

[0055] In the quantitative test in the following examples, three repeated experiments were set up, and the average value was taken.

[0056] The reagents involved in the following examples and their sources are as follows: NTP mix (NEB, N0466S), 2*Super pfx Master Mix (Kangwei 07984 / 30425), LwCas13a protein (Genscript Z03486-100), Agarose gel electrophoresis DNA purification and recovery kit (Tiangen Biochemical, DP219-03), T7 transcription kit (T7 Quick High Yield RNA Synthesis kit, NEB, E2050S), RNAase inhibitor (Murine RNAse inhibitor, NEB, M0314L), T7 RNA polymerase (NEB, M0251S), RNA purification magnetic beads (Agencourt RNA Clean XP, Beckman Coulter, A63987), ExTaq Mix (TaKaRa, RR001Q), Tris balanced phenol (Haoyang Bio, TBD0001HY), RT-RAA amplification kit (Hangzhou Zhongce, S003ZC), fluorescent reporter RNA (RNase Alert TM QC System v2, Thermo, 4479769), strip reporter RNA (Tianyi Huiyuan, 203130347), HEPES buffer (Solebao, YZ-B-HEPES250), MgCl2solution (Tiangen Biochemical, RP107), CRISPR detection strip (Hangzhou Zhongce, 211108004).

[0057] Plasmids were constructed based on Yellow fever virus (YFV, GenBank ID: NC_002031), Benazia coxiella (Cb, GenBank ID: NZ-CP040059.1), Ebola virus (EBOV, GenBank ID: AF086833.2), Junin virus (JV, GenBank ID: 2943089) and Hepatitis B virus (HBV, GenBank ID: NC-003977.2), respectively.

[0058] Example 1, Yellow fever virus nucleic acid detection kit and detection method based on CRISPR-Cas13a system

[0059] (I) Yellow fever virus nucleic acid detection kit based on CRISPR-Cas13a system

[0060] I. Preparation of crRNA

[0061] 1. Synthesis of primer sequence

[0062] The crRNA was designed in the conserved sequence of yellow fever virus (sequence 3). The 5' end of the crRNA has a 39 nt repeat sequence, which can be combined with the LwCas13a protein, 5'-GGGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC-3', the single-stranded DNA sequence designed as a template is the repeat sequence + target sequence, T7 sequence (5'-TAATACGACTCACTATAGGG-3') + partial repeat sequence (5'-GATTTAGACTACCCCAA-3') as the upstream primer, and the reverse complementary sequence of the target sequence downstream about 20bp as the downstream primer (Table 1). Synthesize each sequence in Table 1.

[0063] Table 1 is the template sequence for preparing crRNA for YFV detection and PCR amplification primer sequence

[0064]

[0065] 2. PCR amplification

[0066] The sequences shown in Table 1 were synthesized by Beijing Tianyi Huiyuan Company. According to the research method in the literature, after the steps of DNA synthesis, annealing, transcription and purification, the corresponding crRNA was synthesized (J.T. Huang, et al. Clinical chemistry 61, 290-296 (2015)).

[0067] The above sequences were diluted to 10 μM with ddH2O. The PCR reaction system was prepared as follows: the upstream primer was T7-crRNA-F, the templates were YFV-crRNA1, 2, 3, and 4 (as shown in Table 1), and the corresponding downstream primers were YFV-crRNA1, 2, 3, and 4-R (as shown in Table 1).

[0068] Table 2 shows the PCR amplification system used to prepare the template sequence for crRNA.

[0069] Name Volume Template for XX-crRNA 2 μL Upstream primer: T7-crRNA-F 2 μL Downstream primer: XX-crRNA-R (corresponding to crRNA) 2 μL 2x Ex Taq Mix 25 μL ddH2O 19 μL Total volume 50 μL

[0070] XX-crRNA represent the templates for YFV-crRNA1, YFV-crRNA2, YFV-crRNA3, and YFV-crRNA4, respectively.

[0071] The PCR reaction system was subjected to PCR amplification to obtain the PCR product.

[0072] PCR reaction conditions: 95℃ for 5 min for heat denaturation; 38 cycles of 95℃ for 30 s, 55℃ for 30 s, and 72℃ for 15 s; automatic extension at 72℃ for 10 min; storage of PCR products at 4℃, resulting in four PCR products amplified by the gRNA-MPXV primer pairs shown in Table 1.

[0073] 3. Purification of PCR products

[0074] The PCR products obtained in step 2 were purified using Tris-balanced phenol, as follows: 500 μL of Tris-balanced phenol (from Haoyang Biotechnology) was added to an equal volume of chloroform, vortexed, and briefly centrifuged, discarding the supernatant. 150 μL of a phenol-chloroform mixture was added to the PCR products, mixed, and centrifuged at 12,000 rpm for 1 min. The supernatant was transferred to a new 1.5 mL centrifuge tube, and anhydrous ethanol was added to maintain a supernatant-to-ethanol ratio of 3:7. The tube was centrifuged at 12,000 rpm for 10 min, and the supernatant was discarded. 200 μL of 75% ethanol was added, and the tube was centrifuged at 12,000 rpm for 10 min, discarding the supernatant (this step was repeated three times). The resulting precipitate was air-dried at room temperature (approximately 10 min) to obtain 16 purified PCR products.

[0075] Add the above four purified PCR products to 50 μL of RNase-free water, detect the concentration using Nanodrop, and store at -20℃.

[0076] 4. Transcription

[0077] Take 1 μg of each of the four purified PCR products obtained in step 3 and use the T7 transcription kit (NEB) to transcribe crRNA. The crRNA transcription system is shown in Table 3.

[0078] Table 3 shows the crRNA transcription system.

[0079]

[0080] Note: *X is the volume of the purified PCR product (DNA template).

[0081] After mixing the above crRNA transcription system, transcribe overnight at 37°C to obtain the transcription product. Use DNase I to remove excess DNA: Add 20 μL of RNase-free water and 2 μL of DNase I to the transcription product obtained in the previous step, mix well, and incubate at 37°C for 15 min to obtain crRNA.

[0082] The transcribed crRNA sequences were named YFV-crRNA1, YFV-crRNA2, YFV-crRNA3, and YFV-crRNA4. The YFV-crRNA2 sequence is as follows: GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACaaauuaauccaaauguguuuauugccua (Sequence 2). In Sequence 2, positions 1-38 are anchoring sequences for binding to the Cas13a protein, and positions 39-66 are guide sequences for targeting the MPXV target sequence.

[0083] The target sequence of YFV-crRNA2 is as follows: taggcaataaacacatttggattaattt (sequence 1), located at positions 51-78 of the YFV genome (GeneID:NC_002031). The prepared YFV-crRNA2 was used for subsequent CRISPR-Cas13a detection.

[0084] 5. crRNA purification

[0085] Purify the crRNA obtained from transcription in step 4 according to the Agencourt RNA Clean XP instructions (Beckman Coulter). The specific steps are as follows: Mix the magnetic beads by vortexing. Add 1.8 times the volume of magnetic beads to the transcription product, and mix by pipetting 10 times or vortexing for 30 seconds to ensure thorough mixing. Incubate at room temperature for 5 minutes. Place the reaction system on a magnetic rack and incubate for 5-10 minutes to separate the magnetic beads. Gently aspirate the liquid from the system, avoiding aspirating the magnetic beads. Add 200 μL of 70% ethanol (prepared with RNase-free water) to the magnetic beads and incubate at room temperature for 30 seconds. Aspirate the ethanol. Repeat this process to wash the magnetic beads three times. Air dry the system at room temperature to remove ethanol, approximately 10 minutes. Add 50 μL of RNase-free water, vortex for 30 seconds or pipette 10 times, aspirate the supernatant, and transfer it to an RNase-free 1.5 mL centrifuge tube. Measure the concentration of the purified crRNA using Nanodrop and aliquot at -80℃ for later use.

[0086] Four types of crRNA were prepared: YFV-crRNA1, YFV-crRNA2, YFV-crRNA3, and YFV-crRNA4 (the RNA encoded by each crRNA template is shown in Table 1).

[0087] The above crRNA sequence was used for the following CRISPR-Cas13a detection of yellow fever virus.

[0088] II. Preparation of Template Standards

[0089] 1. Plasmid sequence

[0090] PUC57-YFV is a recombinant plasmid obtained by inserting the following sequence from the yellow fever virus genome (agtaaatcctgtgtgctaattgaggtgcattggtctgcaaatcgagttgctaggcaataaacacatttggatta attttaatcgttcgttgagcgattagcagagaactgaccagaacatgtctggtcgtaaagctcagggaaaaaccctgggcgtcaatatggtacgacgaggagttcgctccttgtcaaacaaaataaaacaaaaaacaaaaaaaaatgg aa (sequence 3)) into the pUC57 vector (Beijing Tianyi Huiyuan Company).

[0091] PUC57-YFV was transferred into Escherichia coli TOP10 to obtain recombinant bacteria, which is the glycerol bacteria used below.

[0092] 2. Plasmid extraction (full gold)

[0093] Take the glycerol bacteria obtained in step 1 (1:500) and add them to liquid LB medium (ampicillin antibiotic) (take 10 μL of glycerol bacteria + 5 ml of LB). Incubate overnight at 37°C and 200 rpm. Take the overnight culture and centrifuge at 10000g for 1 min, discarding the supernatant (try to remove as much as possible). If the volume of the culture is too large, it can be collected by centrifugation in multiple batches. Add 250 μL of colorless solution RB (containing RNase A), and shake to suspend the bacterial pellet, ensuring no small bacterial clumps remain. Add 250 μL of blue solution LB, and gently mix by inverting the container 4-6 times to fully lyse the bacteria, forming a clear blue solution. The color changes from semi-clear to clear blue, indicating complete lysis (do not exceed 5 min). Add 350 μL of yellow solution NB, and gently mix 5-6 times (the color changes completely from blue to yellow, indicating thorough mixing and neutralization), until a firm yellow aggregate forms. Let stand at room temperature for 2 min. Centrifuge at 12000g for 5 min, carefully aspirate the supernatant and add it to the centrifuge column. Centrifuge at 12000g for 1 min, discard the effluent. If the supernatant volume is greater than 800 μL, it can be added to the column in multiple portions, centrifuged as above, and the effluent discarded. Add 650 μL of WB solution, centrifuge at 12000g for 1 min, discard the effluent. Centrifuge at 12000g for 1-2 min to completely remove residual WB. Place the centrifuge column in a clean centrifuge tube, add 30-50 μL of EB or deionized water (pH>7.0) to the center of the column, and incubate at room temperature for 1 min. Centrifuge at 10000g for 1 min to elute the DNA, measure the concentration, and store at -20℃ to obtain plasmid PUC57-YFV.

[0094] The concentration of purified PUC57-YFV was calculated using the following formula: copies / μL = 6.02 × 10⁻⁶ 23 ×(concentration ng / μL)×10 -9 / DNA length × 660.

[0095] The plasmid PUC57-YFV has a length of 2934 bp.

[0096] The copy number of plasmid PUC57-YFV is 1×10⁻⁶. 10 copies / μL.

[0097] 4. Dilution

[0098] Add 10 μL of PUC57-YFV to the corresponding volume of enzyme-free water to obtain a concentration of 1 × 10⁻⁶. 9 Copies / μL of PUC57-YFV standard.

[0099] III. Design of RT-RAA Amplification Primers

[0100] 1. Design of RT-RAA amplification primers

[0101] Primers for RT-RAA amplification of the yellow fever virus detection target sequence were designed and synthesized. These primers contain a T7 transcription sequence at the 5' end, allowing the double-stranded DNA (dsDNA) obtained from RT-RAA amplification to be recognized and transcribed by T7 RNA polymerase (see Table 4). The DNA sequence was synthesized by Beijing Tianyi Huiyuan Co., Ltd.

[0102] Table 4 lists the RT-RAA amplification primers used for detecting YFV.

[0103]

[0104]

[0105] 2. Obtaining RT-RAA amplification products

[0106] Using plasmid standards as templates, RT-RAA amplification was performed using primers designed in step 1 to obtain RT-RAA amplification products. The RT-RAA amplification system is shown in Table 5.

[0107] Table 5 shows the RT-RAA amplification system.

[0108] Name Volume Template 18.5 μL RT-RAA-F (10 μM) 2 μL RT-RAA-R (10 μM) 2 μL A Buffer (component in RT-RAA Amplification Kit) 25 μL Total volume 47.5 μL

[0109] Add 47.5 μL of the mixed solution to the basic reaction unit containing the lyophilized powder, allowing the lyophilized powder to fully redissolve and homogenize. Add 2.5 μL of magnesium acetate aqueous solution (B Buffer) to the cap of each reaction tube, close the cap, briefly collect and mix thoroughly. Incubate the reaction tubes at 42°C for 30 minutes. The RT-RAA amplification product is obtained.

[0110] (II) A method for detecting yellow fever virus nucleic acid based on the CRISPR-Cas13a system

[0111] I. Preparation of CRISPR-Cas13a Fluorescence Detection System

[0112] This study utilized RT-RAA technology to amplify target nucleic acids, using the aforementioned crRNAs: YFV-crRNA1, YFV-crRNA2, YFV-crRNA3, and YFV-crRNA4 for detection. The signal intensity of different crRNAs was compared, and the crRNA with the strongest fluorescence signal and highest sensitivity was selected for subsequent detection. The specific steps and principles are as follows: First, the target sequence was amplified using specific primers (through denaturation, annealing, and extension processes). The 5' end of the primers contains a T7 transcription sequence, allowing the PCR-amplified double-stranded DNA (dsDNA) to be recognized and transcribed by T7 RNA polymerase. Second, a portion of the amplification product was taken and added to T7 RNA polymerase, LwCas13a protein, crRNA capable of recognizing the target sequence, and reporter RNA for target sequence detection (performed at 37℃). Quantitative real-time PCR was used, with the FAM channel detection cycle: 37℃ for 15s, 37℃ for 1 min 45s (fluorescence collection), for a total of 30 cycles.

[0113] The specific steps are as follows:

[0114] Extract the nucleic acid from the sample to be tested, and use the primers YFV-RT-RAA-F5 and YFV-RT-RAA-R8 from section 3.1 of (I) above to perform RT-RAA amplification on the nucleic acid of the sample to be tested, and obtain the RT-RAA amplification product.

[0115] Take 5 μL of the RT-RAA amplification product obtained above as a template and prepare the CRISPR-Cas13a detection system according to Table 6 below.

[0116] The negative control is to replace the RT-RAA product in Table 6 with ddH2O while keeping other reagent components unchanged.

[0117] Table 6 shows the RT-RAA-CRISPR fluorescence detection system.

[0118] Name Amount RT-RAA product 5 μL LwCas13a protein 45 nM NTP Mix 2.5 mM T7 RNA polymerase 0.5 IU RNAse inhibitor (Murine RNAse inhibitor) 1.6 IU MgCl2solution 10 mM HEPES buffer 20 mM YFV-crRNA2 22.5 nM RNaseAlert TM QC System v2 (fluorescent reporter RNA) 2 nM RNase free water Up to 25 μL Total volume 25 μL

[0119] Place the PCR tube containing the reaction system shown in Table 6 into a real-time PCR instrument. Use the FAM channel to detect changes in fluorescence signal. Set the channel excitation wavelength to 490 nm and the emission wavelength to 520 nm. React at 37°C for 15 s, then at 37°C for 1 min 45 s (collect fluorescence). Repeat this process for 20-40 cycles, reading 40 times for a total of 80 minutes, and detect changes in fluorescence intensity in the system.

[0120] Result Interpretation: Within the same detection time, if the fluorescence intensity value of the experimental group is more than 3 times higher than that of the negative control (ddH2O), it is considered a positive result. Alternatively, if the fluorescence intensity is greater than or equal to 0.3au at any time, it is considered a positive result, meaning that the sample contains or is a candidate for containing yellow fever virus or yellow fever virus nucleic acid. Conversely, if the fluorescence intensity is less than or equal to 0.3au, it is considered a negative result, meaning that the sample does not contain or is a candidate for containing yellow fever virus or yellow fever virus nucleic acid.

[0121] II. Preparation of the CRISPR-Cas13a test strip detection system

[0122] Extract the nucleic acid from the sample to be tested, and use the primers YFV-RT-RAA-F5 and YFV-RT-RAA-R8 from section 3.1 of (I) above to perform RT-RAA amplification on the nucleic acid of the sample to be tested, and obtain the RT-RAA amplification product.

[0123] Take 5 μL of the RT-RAA amplification product obtained above as a template and prepare the CRISPR-Cas13a detection system according to Table 7 below.

[0124] The negative control is to replace the RT-RAA product in Table 7 with ddH2O while keeping other reagent components unchanged.

[0125] Table 7 shows the CRISPR-Cas13a detection system.

[0126] Name Amount RT-RAA product 5 μL LwCas13a protein 45 nM NTP Mix 2.5 mM T7 RNA polymerase 0.5 IU RNAse inhibitor (Murine RNAse inhibitor) 1.6 IU MgCl2solution 10 mM HEPES buffer 20 mM YFV-crRNA2 22.5 nM Reporter RNA (Test paper reporter RNA) 2 nM RNase free water Up to 50 μL Total volume 50 μL

[0127] Cap the reaction tube containing the reaction system shown in Table 7, invert it 5-6 times to mix, and centrifuge at low speed for 10 seconds. Place the reaction tube at 37°C for 30 minutes. After the reaction is complete, add the entire reaction system (50 μL) to the sample well of the CRISPR test paper.

[0128] Result Interpretation: Read the results 2-5 minutes after the test strip is applied. If no "T" line appears but a "C" line does, the sample contains or is a candidate for yellow fever virus. If both a "T" line and a "C" line appear, the sample does not contain or is a candidate for yellow fever virus. If no "C" line appears, the test strip is invalid and needs to be replaced and the test repeated.

[0129] (III) Optimization of the conditions for detecting yellow fever virus nucleic acid based on the CRISPR-Cas13a system

[0130] I. Selection of Optimal Primers

[0131] The concentration prepared using (I) is 1×10 9Using copies / μL of PUC57-YFV standard as a template, RT-RAA amplification was performed using the method described in section (II) above. The primers were the primer combinations shown in Table 4 (the combination format is as follows). Figure 1 As shown in the figure, the RT-RAA amplification product was obtained.

[0132] Amplification products using water as a template were set as negative controls.

[0133] Take 20 μL of the amplification product, add 20 μL of chloroform:Tris-balanced phenol = 1:1 (volume ratio) and mix with an equal volume of the reaction product. After shaking, centrifuge for 10 min, discard the supernatant, and mix again. Centrifuge at 10000 rpm for 10 min, take 10 μL of the supernatant, add 3 μL of 6*Loading Buffer, mix well, and then perform agarose gel electrophoresis.

[0134] Prepare a 1.5% agarose gel, set the voltage U = 150V, the current I = 150mA, and the time T = 30min, and perform electrophoresis to detect and observe the electrophoretic bands.

[0135] The results are as follows Figure 1 As shown, Y1:F5R3 indicates that YFV-RT-RAA-F5 & YFV-RT-RAA-R3 were used to amplify PUC57-YFV standard (+) and water (-) using RT-RAA, and the others are represented in the same manner. Compared with other cross-combination primer pairs, YFV-RT-RAA-F5 & YFV-RT-RAA-R5 and YFV-RT-RAA-F5 & YFV-RT-RAA-R8 have higher amplification efficiency and exhibit distinct bands.

[0136] Then, CRISPR fluorescence screening was performed: the method in Example 1(II)1 was used, wherein the RT-RAA amplification primers were YFV-RT-RAA-F5&YFV-RT-RAA-R5 and YFV-RT-RAA-F5&YFV-RT-RAA-R8, the crRNA was YFV-crRNA2, and the template was 1×10 9 The PUC57-YFV standard (10 μL / opies) was serially diluted with water to obtain DNA solutions containing different concentrations of YFV gene fragments: 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL.

[0137] The results are as follows Figure 2 As shown in the figure, F5R5-10 5 This indicates that RT-RAA amplification was performed using YFV-RT-RAA-F5 & YFV-RT-RAA-R8 primers, with a template of 10. 5 copies / μL, others indicate the same; the fluorescence values ​​corresponding to primers F5 and R8 are higher and the peaks are earlier, so YFV-RT-RAA-F5 and YFV-RT-RAA-R8 were used as primers for subsequent RT-RAA detection in subsequent experiments.

[0138] II. Optimal crRNA Screening

[0139] 1) Synthesis of crRNA primer sequences

[0140] Four types of YFV-crRNA were synthesized and prepared using the method in Example 1(a).

[0141] 2) The concentration obtained by the method in step two of Example 1(a) is 1×10⁻⁶. 9 The PUC57-YFV standard (10 μL / opies) was serially diluted with water to obtain DNA solutions containing different concentrations of the YFV gene fragment: 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL.

[0142] Using the DNA solutions containing different concentrations of YFV gene fragments as templates, RT-RAA amplification was performed according to the method in step 2 of section (I) of Example 1. The primers used were YFV-RT-RAA-F5 and YFV-RT-RAA-R8 (optimal primers), and RT-RAA amplification products were obtained.

[0143] 3) Take 5 μL of RT-RAA amplification product and detect different crRNA yellow fever virus nucleic acids according to the method in (II) of Example 1. At the same time, set up the amplification product with water as a template as a negative control. In the method in (II) above, the crRNAs are the above four MPXV-crRNAs.

[0144] Test results Figure 3 As shown, when using the same concentration of detection template, the fluorescence value of YFV-crRNA2 detected at 30 min is higher than that of the other three crRNAs. Therefore, YFV-crRNA2 is the preferred crRNA for YFV detection.

[0145] Example 2: Sensitivity detection of yellow fever virus nucleic acid based on CRISPR-Cas13a system

[0146] The DNA template obtained in step two of Example 1 was serially diluted to obtain DNA solutions containing different concentrations of gene fragments, and YFV-crRNA2 was used for detection to test the sensitivity of the method of the present invention. The specific steps are as follows:

[0147] 1. The concentration obtained in step (a) of Example 1 is 1×10⁻⁶. 9 The PUC57-YFV standard was serially diluted with water to obtain DNA standard solutions containing different concentrations of YFV gene fragments, with concentrations of 10 and 10 μL respectively. 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL, 10 -1 copies / μL, 10 -2 copies / μL.

[0148] 2. Perform RT-RAA amplification according to the method in step (I) of Example 1, using primers YFV-RT-RAA-F5 and YFV-RT-RAA-R8 (optimal primers) to obtain RT-RAA amplification products.

[0149] 3. CRISPR fluorescence detection:

[0150] Take 5 μL of RT-RAA amplification product and detect yellow fever virus nucleic acid using the CRISPR-Cas13a fluorescence system according to the method in step (II) of Example 1. At the same time, set up the amplification product with water as template as a negative control. The crRNA is YFV-crRNA2.

[0151] CRISPR-Cas13a detection results showed that when using YFV-crRNA2 to detect YFV templates, although the fluorescence signal was at 10... 6 -10 0 The concentration of YFV-crRNA2 decreased continuously at different copies / μL, but all values ​​showed significant differences from those detected with negative templates. Therefore, YFV-crRNA2 can be used to detect YFV sites with a sensitivity reaching a single copy (1 copy / μL). Figure 4 It also boasts a fast detection speed, effectively detecting 10 within 30 minutes of the reaction starting. -1YFV concentration at copies / test ( Figure 5 ).

[0152] 4. CRISPR test strip detection:

[0153] After completing step 2, take 5 μL of RT-RAA amplification product and detect YFV nucleic acid using the RT-RAA-CRISPR / Cas13a system according to the method in section 2 of Example 1 (II). Simultaneously, use the amplification product with ddH2O as a template as a negative control. The crRNA is YFV-crRNA2, and the primers are YFV-RT-RAA-F5 and YFV-RT-RAA-R8.

[0154] RT-RAA-CRISPR test strip results are as follows Figure 6 As shown in the figure, the 3rd row represents 3 replicates. When detecting YFV template using YFV-crRNA2, at 10 4 -10 0 The "T" line disappears and the "C" line appears in the copies / μL group, 10 -1 copies / μL, 10 - 2 Both the T and C lines were visible in the negative control group and the YFV-crRNA2 assay, indicating that the YFV site can be detected using YFV-crRNA2 with a sensitivity of 1 copy / μL, allowing for the determination of 10 copies / μL. 4 -10 0 The copy / μL group was positive, 10 -1 copy / μL group, 10 -2 The negative results in the 1 copy / μL group and the negative control group indicate that the sensitivity of this method is 1 copy / μL.

[0155] Example 3: Specific detection of yellow fever virus nucleic acid based on CRISPR-Cas13a system

[0156] 1. Specificity of CRISPR-Cas13a at the YFV site in detecting nucleic acids of other pathogens.

[0157] The specificity of the method of the present invention was verified by using the nucleic acids of yellow fever virus (YFV), Ebola virus (EBOV, denoted as EBV in the figure), Coxsella benjamini (Cb, denoted as CB or Rickettsia in the figure), Junin virus, Venezuelan equine encephalitis virus (VEEV), and dengue virus (DENV) as detection templates, respectively, according to the method in Example 1 (II). The specific steps are as follows:

[0158] 1. Using Ebola virus (EBOV), Coxiella benjamin (Cb), Junin virus, Venezuelan equine encephalitis virus (VEEV), and dengue virus (DENV) as detection templates, RT-RAA amplification was performed according to the method in step (I) of Example 1 to obtain RT-RAA amplification products.

[0159] 2. Take 5 μL of RT-RAA amplification product and detect the viral nucleic acids using the method in Example 1 (II) using the CRISPR-Cas13a system. Simultaneously, set up an amplification product with water as a template as a negative control. The crRNA is YFV-crRNA2, and the primers are YFV-RT-RAA-F5 and YFV-RT-RAA-R8.

[0160] The results are as follows Figure 7 As shown, the fluorescence signal in the experimental group containing the YFV gene began to increase after the reaction started, while the fluorescence intensity in the negative control group (ddH2O) and the experimental group containing its nucleic acid did not increase over time. The fluorescence intensity of the experimental group containing the YFV gene was significantly higher than that of the negative control and other pathogen experimental groups. This indicates that the method for detecting yellow fever virus sites based on the CRISPR-Cas13a system of the present invention has high specificity and no cross-reaction occurs during the detection process.

[0161] 3. After completing step 1, take 5 μL of RT-RAA amplification product and detect the viral nucleic acids using the CRISPR-Cas13a system test strip according to the method in section (II) of Example 1. At the same time, set up the amplification product with water as a template as a negative control. The crRNA is YFV-crRNA2, and the primers are YFV-RT-RAA-F5 and YFV-RT-RAA-R8.

[0162] The results are as follows Figure 8 As shown, the "T" line disappeared and the "C" line appeared in the experimental group containing the YFV gene, while both the "T" line and the "C" line appeared in the negative control group (ddH2O) and the experimental group containing its nucleic acid. Figure 8 This demonstrates that the method for detecting yellow fever virus sites based on the CRISPR-Cas13a system of the present invention has high specificity and no cross-reaction occurs during the detection process.

[0163] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

[0164] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A CRISPR-Cas13a system for detecting yellow fever virus, comprising a Cas13a protein and a crRNA, or a complex formed by the two; the crRNA comprises an anchor sequence for binding with the Cas13a protein and a guide sequence targeting a yellow fever virus target sequence; the yellow fever virus target sequence is sequence 1; the sequence of the crRNA is sequence 2; and the Cas13a protein is an LwCas13a protein. 2.A kit for detecting yellow fever virus, comprising the CRISPR-Cas13a system for detecting yellow fever virus according to claim 1. The kit further comprises RT-RAA amplification primers for specifically amplifying the yellow fever virus target sequence; the RT-RAA amplification primers are composed of a single-stranded DNA molecule shown as sequence 4 and a single-stranded DNA molecule shown as sequence 5. 4.Any of the following: A1) the crRNA described in claim 1; A2) the Cas13a protein and the crRNA described in claim 1, or a complex formed by the two.

3. The kit of claim 2, wherein: 5.Any of the following applications: B1) application of the system described in claim 1 or the kit described in claim 2 or 3 or the substance described in claim 4 in a non-disease diagnosis purpose for detecting or assisting in detecting yellow fever virus or nucleic acid thereof; B2) application of the system described in claim 1 or the kit described in claim 2 or 3 or the substance described in claim 4 in preparing a product for detecting or assisting in detecting yellow fever virus or nucleic acid thereof; B3) application of the system described in claim 1 or the kit described in claim 2 or 3 or the substance described in claim 4 in a non-disease diagnosis purpose for detecting or assisting in detecting whether a to-be-tested sample contains yellow fever virus or nucleic acid thereof; B4) application of the system described in claim 1 or the kit described in claim 2 or 3 or the substance described in claim 4 in preparing a product for detecting or assisting in detecting whether a to-be-tested sample contains yellow fever virus or nucleic acid thereof; B5) application of the system described in claim 1 or the kit described in claim 2 or 3 or the substance described in claim 4 in a non-disease diagnosis purpose for screening or assisting in screening a yellow fever virus prevention and treatment drug; B6) application of the system described in claim 1 or the kit described in claim 2 or 3 or the substance described in claim 4 in preparing a product for screening or assisting in screening a yellow fever virus prevention and treatment drug; B7) application of the substance described in claim 4 in preparing the kit described in claim 2 or 3. 6.A method for detecting or assisting in detecting yellow fever virus in a non-disease diagnosis purpose, comprising the following steps: C1) performing RT-RAA amplification on nucleic acid of a to-be-tested sample by using a primer pair composed of a single-stranded DNA molecule shown as sequence 4 and a single-stranded DNA molecule shown as sequence 5, to obtain an RT-RAA product; ​ ​ ​ ​ C2) preparing a CRISPR-Cas13a detection system containing the following components: the RT-RAA product, the Cas13a protein as claimed in claim 1, the crRNA as claimed in claim 1, the reporter RNA, NTP, T7 RNA polymerase, RNase inhibitor; and replacing the PCR product with water as a negative control; C3) reacting the CRISPR-Cas13a detection system, detecting the reaction product, and determining whether the sample to be tested contains the yellow fever virus.

7. The method of claim 6, wherein: In step C1), the reaction conditions of the RT-RAA amplification are as follows: 40-44℃ for 20-40 min.

Images