Philipp cyst nematode HfSvG434 protein, encoding gene and application

Abstract

The present invention relates to a Philip cyst nematode HfSvG434 protein, a coding gene and an application. The Philip cyst nematode HfSvG434 protein has an amino acid sequence as shown in SEQ ID NO: 2, and a gene sequence encoding the protein as shown in SEQ ID NO: 1. The HfSvG434 gene provided by the present invention is expressed in two sub-abdominal esophageal glands of nematodes, and the expression level gradually increases in the second, third and fourth instars after parasitism of Philip cyst nematodes. The function of the HfSvG434 gene was analyzed by in vitro RNAi silencing technology, and it was found that the gene had a significant effect on the pathogenicity of nematodes after silencing, and the number of white female Philip cyst nematodes in wheat roots was significantly lower than that of the control. The test results confirmed that the gene plays an important role in the parasitic process of Philip cyst nematodes and can be used as a target gene for anti-nematode engineering. The present invention has great significance for the study and prevention of the pathogenic mechanism of Philip cyst nematodes.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a HfSvG434 protein derived from Philipp cyst nematode, a coding gene and an application thereof. Background Art

[0002] Cereal cyst nematodes (CCN) are an important class of plant parasitic nematodes that mainly infect cereal crops such as wheat, barley and oats. They are a complex population consisting of 12 effective species and intraspecific pathotypes. Cereal cyst nematodes damage the roots of host plants, causing the formation of fibrous root masses at the roots of the affected plants. In severe cases, the aboveground parts become weak and yellow, the tillering rate decreases, and the plants even dry up and die, causing economic losses [Handoo Z AA key and compendium to species of the Heterodera avenae group (Nematoda: Heteroderidae). Journal of Nematology. 2002, 34(3): 250]. Among them, the economic losses caused by cereal cyst nematode (Heterodera avenae), Philip cyst nematode (H. filipjevi) and wheat cyst nematode (H. latipons) are the most serious [Subbotin SA, Mundo-Ocampo M, Baldwin JG. Systematics of cyst nematodes (Nematodes: Heteroderinae), Volume 8, Part B. Brill Academic Publishers. 2010. 1-83; Nicol JM, Rivoal R. Global knowledge and its application for the integrated control and management of nematodes on wheat [M] / / Integrated management and biocontrol of vegetable and grain crops nematodes. Springer, Dordrecht. 2008: 251-294]. CCN generally causes 20% to 30% yield loss, and in severe cases can reach more than 70% [Rivoal R, Nicol J M. Past research on the cereal cyst nematode complex and future needs [C] / / Riley IT, Nicol JM, Dababa A A. Cereal cyst nematodes: status, research and outlook. Ankara: CIMMYT, 2009: 3-1].Philip cyst nematode causes an average yield loss of 42% in Turkey and 48% in Iran, and also poses a huge threat to my country's wheat [Nicol JM, Bolat N, Sahin E, Tülek A, Yιldιrιm AF, Yorgancιlar A, Kaplan A, and Braun H J. The cereal cystnematode is causing economic damage on rain-fed wheat production systems of Turkey. (Abstr.) Phytopathology. 2006, 96: S169; Nicol JM,. IH,Bolat N,andRivoal R.The global importance of the cereal cyst nematode(Heterodera spp.)onwheat and international approaches to its control.Commun.Agric.Appl.Biol.Sci.2007,72:677-686]

[0003] Studies have shown that more than 4 million hectares of wheat-producing areas in my country are harmed by CCN, with annual losses of about 1.9 billion yuan [Peng DL, Nicol JM, Li H, Hou S, Li H, Chen S, Ma P, Li H, and Riley IT. Current knowledge of cereal cyst nematode (Heterodera avenae) on wheat in China. In′Cereal cyst nematodes: status, research and outlook.′Edited by ITRiley, JM Nicol and AA Dababat. 2009: 29-34]. The cereal cyst nematodes that cause wheat cyst nematode disease in my country are mainly cereal cyst nematodes and Philip cyst nematodes. Compared with cereal cyst nematodes, Philip cyst nematodes are more virulent, have a longer infection cycle, and cause more serious damage to wheat. Since the first discovery of Philipp cyst nematode in Xuchang City, Henan Province in 2010, it has spread to Shandong, Anhui, Xinjiang Uygur Autonomous Region, Hebei Province, etc., and the damage is becoming more and more serious [Cui JK, Ren HH, Zhou B, Chen KY, Peng DL, Li MM, Meng HG, Jiang S J. First report of Heterodera filipjevi on winter wheat from Hebei Province in North China. Plant Disease. 2021, 105, 1861]. Planting disease-resistant and disease-tolerant varieties is currently the most economical, effective and safe means of prevention and control of Philipp cyst nematode, but the spread of resistant germplasm resources will also produce new pathogenic groups that overcome variety resistance, which has become a major problem in the prevention and control of cyst nematodes. In addition, agricultural measures such as crop rotation are difficult to implement in my country's wheat-growing areas for a long time, and are not economical and effective. Although chemical control is currently the main prevention and control measure, nematicides are prone to cause a series of environmental problems. Therefore, in response to the problem of the ever-expanding occurrence and severity of Philipp cyst nematode in my country, it is imperative to promptly and effectively carry out relevant research on the endogenous target genes of Philipp cyst nematode, so as to deeply analyze the pathogenicity and damage mechanism of Philipp cyst nematode and lay a theoretical foundation for exploring safe and efficient prevention and control methods. Summary of the invention

[0004] The present invention provides a HfSvG434 protein derived from Philipp cyst nematode, which is specifically expressed in two sub-abdominal esophageal glands, and the expression level gradually increases in the second, third and fourth instar stages after Philipp cyst nematode parasitism. Experiments show that the gene is related to the pathogenicity of Philipp cyst nematode and can be used as a target gene for plant resistance to nematodes.

[0005] A HfSvG434 protein derived from Philipp cyst nematode, whose amino acid sequence is shown in SEQ ID NO:2.

[0006] The gene encoding the HfSvG434 protein of Philipp cyst nematode.

[0007] The gene encoding the HfSvG434 protein of Philipp cyst nematode is named HfSvG434, and its nucleotide sequence is shown in SEQ ID NO:1.

[0008] dsRNA fragments designed against the above genes.

[0009] The dsRNA fragment is synthesized from a DNA fragment targeting the gene according to claim 3, and the nucleotide sequence of the DNA fragment is shown in SEQ ID NO: 3 or SEQ ID NO: 5.

[0010] The application of HfSvG434 protein in inhibiting the parasitism and damage of Philipp cyst nematode to plants, and / or inhibiting the pathogenicity of Philipp cyst nematode to plants, and / or inhibiting the development of Philipp cyst nematode.

[0011] The application is to design a dsRNA fragment for the gene encoding the HfSvG434 protein, and introduce the dsRNA fragment into the plant nematode, resulting in a reduction in the infectivity of the Philip cyst nematode to the plant, thereby achieving the purpose of preventing and controlling the Philip cyst nematode.

[0012] The dsRNA fragment is synthesized from a DNA fragment targeting the gene according to claim 3, and the nucleotide sequence of the DNA fragment is shown in SEQ ID NO: 3 or SEQ ID NO: 5.

[0013] The introduction is to feed the food containing the dsRNA fragment so that the Philip cyst nematode can take the dsRNA fragment into the body.

[0014] The Philip cyst nematodes are the second instar, third instar and fourth instar stages of Philip cyst nematodes.

[0015] The plants are wheat and / or barley.

[0016] The present invention finds HfSvG434 protein in the second-instar larvae of Philipp cyst nematode, and its sequence is shown in SEQ ID NO: 2, and the gene sequence encoding the protein is shown in SEQ ID NO: 1. Nematode effector proteins are a class of small molecule polypeptide substances produced by esophageal gland cells, head chemosensitive organs, tail chemosensitive organs, epidermis, intestinal cells, excretory pores, etc., and then secreted into host plant cells by lateral organs or stylets of nematodes, thereby facilitating their own invasion, establishing and maintaining the formation of feeding sites, and inhibiting the host's defense mechanism [Abad P, Williamson V M. Plant nematode interaction: asophisticated dialogue [M] / / Advances in botanical research. Academic Press. 2010, 53: 147-192; Mitchum MG, Hussey RS, Baum TJ, Wang X, Elling AA, Wubben M, Davis E L. Nematode effector proteins: an emerging paradigm of parasitism. New Phytologist. 2013, 199(4): 879-894; Yao Ke, Zheng Jingwu, Huang Wenkun, Peng Deliang, Peng Huan. Research progress on the molecular mechanism of plant parasitic nematode effector proteins regulating host defense response. Acta Phytopathologica Sinica. 2020, 50(05): 517-530; Luo Shujie, Peng Deliang. Research methods of plant parasitic nematode effector proteins. Chinese Journal of Nematology. 2016, Vol. 6: 251-253], among which the effector proteins secreted by esophageal gland cells account for the vast majority, and most of these proteins have signal peptides and do not contain transmembrane domains. The HfSvG434 gene provided by the present invention is expressed in the two subabdominal esophageal glands of Philipp cyst nematode, and the expression level gradually increases in the second, third and fourth instars after parasitism of Philipp cyst nematode.

[0017] The expression vector or transgenic individual containing the gene can be obtained by conventional methods, including recombinant expression vectors, interference vectors, recombinant viruses, dsRNA, transgenic plants or tissues, and recombinant bacteria. The recombinant expression vector containing the HfSvG434 gene includes Agrobacterium vectors, viral vectors, bacterial expression vectors, and yeast expression vectors. The vector may include resistance screening markers for antibiotics or chemical agents. The constructed vector can transform bacteria, plant cells, and monocotyledonous and dicotyledonous plants, specifically Escherichia coli, protoplasts, yeast, tobacco, Arabidopsis, and wheat.

[0018] The present invention protects the use of HfSvG434 protein in inhibiting the parasitism and damage of Philip cyst nematodes to plants, and / or inhibiting the pathogenicity of cyst nematodes to plants, and / or inhibiting the development of cyst nematodes. The substance that inhibits the expression of the HfSvG434 gene can specifically be an interference vector, a viral vector and RNA that inhibits the expression of HfSvG434. The host plant can specifically be wheat and barley, such as wheat Wenmai 19 and barley Morex.

[0019] After silencing the HfSvG434 gene by dsRNA treatment, the number of second-instar larvae in the roots was significantly reduced compared with the water control group 7 days after inoculation. The survey data of white female worms in wheat roots at 40 days showed that the number of white female worms produced by ingesting dsRNA double-stranded nematodes was significantly lower than that of the control, but the content of single cyst eggs was not significantly different from that of the control. Multiple test results confirmed that the HfSvG434 gene is related to the pathogenicity of Philip cyst nematode, plays an important role, and can be used as a target gene for plant anti-nematode engineering. The present invention has important research value for the pathogenic mechanism of Philip cyst nematode and its prevention and control. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 For PCR amplification of HfSvG434 gene,

[0021] Figure 2 In situ hybridization analysis of HfSvG434 gene in the second instar larvae of Philipp cyst nematode;

[0022] In the figure, A: the results of antisense chain hybridization analysis showed that the HfSvG434 gene was secreted by two sub-esophageal glands; B: the results of positive chain hybridization analysis were negative controls.

[0023] Figure 3 The effect of in vitro RNAi silencing of HfSvG434 gene on nematode pathogenicity;

[0024] In the figure, A: relative expression of HfSvG434 gene at different time, C: effect of different treatments on nematode infectivity 7 days after inoculation, B: effect of different treatments on the number of white female worms 40 days after inoculation, D: effect of different treatments on the content of single cyst eggs. The data in the figure are mean ± standard error, and different lowercase letters on the bars indicate significant differences at the 0.05 level. DETAILED DESCRIPTION

[0025] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified. The applicant's experimental materials can be distributed to the public. The quantitative tests in the following examples were repeated three times, and the results were averaged.

[0026] Example 1

[0027] The cloning of the HfSvG434 gene includes the following steps:

[0028] 1. Place a large number of Philipp cyst nematodes cysts on a 100-mesh gauze, spread them flat in a 9 cm glass dish, add an appropriate amount of sterile water, and incubate them in a 16°C incubator for 3 days. Collect a large number of second-instar larvae at the bottom of the glass dish, wash them repeatedly with DEPC water for 5 times, collect them in a 1.5 mL RNase-free centrifuge tube, and immediately use TRIzol to extract nematode RNA. Use SuperScript TM cDNA was obtained by reverse transcription using IV First-Strand Synthesis System kit.

[0029] 2. Using cDNA as template, PCR amplification was performed using the upstream primer HfSvG434-F: 5'-ATGCCCTTTTTTATTACCAATTTGG-3'; downstream primer HfSvG434-R: 5'-GTTGTGGTGCCAAAGATGACGAC-3'. The amplification system is: KOD OneTM PCR Master Mix, 25μL; forward primer (10mM), reverse primer (10mM) 1μL each; cDNA first-strand template, 4μL; ddH2O 19μL, total volume 50μL. Amplification procedure: pre-denaturation at 98℃ for 5min; then 35 cycles of 98℃, 10s, 60℃, 5s, and extension at 68℃ for 15s; finally extension at 72℃ for 5min, and storage at 4℃. Take 5μL of PCR product and detect it by agarose gel electrophoresis (see Figure 1 ), the amplified fragment size was 1116 bp.

[0030] 3. Use an agarose gel DNA recovery kit to recover DNA, then connect the T vector, transform into E. coli DH5α competent cells, pick positive colonies for testing, see SEQ ID NO: 1. The sequencing results show that the amplified product has an open reading frame shown in SEQ ID NO: 1 of the sequence list, and encodes the protein shown in SEQ ID NO: 2 of the sequence list. Sequence 2 of the sequence list is named HfSvG434 protein, and its encoding gene is named HfSvG434 gene.

[0031] Example 2

[0032] The original hybridization localization analysis of HfSvG434 gene includes the following steps:

[0033] The HfSvG434 gene cloning vector plasmid was used as a template. The upstream primer YZ-434-T7S: 5'-GGATCCTAATACGACTCACTATAGGGCGCAGATTGAACAGTTACGC-3'; the downstream primer YZ-434-A: 5'ATTTCATCAGTTGCCGAGTGT-3' was used for PCR amplification to prepare the sense probe template. The primer YZ-434-S: 5'-CGCAGATTGAACAGTTACGC-3'; the downstream primer YZ-434-T7A: 5'-GGATCCTAATACGACTCACTATAGGGATTTCATCAGTTGCCGAGTGT-3' was used for PCR amplification to prepare the antisense probe template. The amplification system was: KOD OneTM PCR Master Mix, 25 μL; forward primer (10 mM), reverse primer (10 mM), 1 μL each; plasmid, 4 μL; ddH2O 19μL, total volume 50μL. Amplification procedure: 98℃ pre-denaturation for 5min; then 35 cycles of 98℃, 10s, 60℃, 5s, 68℃ extension for 15s; finally 72℃ extension for 5min, stored at 4℃. Hybridization was performed according to the instructions of DIG RNA labeling kit (Roche). Results (see Figure 2 ) showed that the antisense probe had hybridization signals, and the hybridization signals were located in the two sub-abdominal esophageal glands, indicating that the HfSvG434 gene was expressed in the sub-abdominal esophageal glands.

[0034] Example 3

[0035] In vitro RNAi silencing of the HfSvG434 gene validated its application as a target in anti-nematode activities.

[0036] Primer Premier 5.0 software was used to design three pairs of HfSvG434 gene-specific primers at 219 bp, 629 bp, and 767 bp of the HfSvG434 gene, respectively.

[0037] Hf-T7-1F:AGGTGAAATACCCCGGCGACC;

[0038] Hf-T7-1R:CATTTTCCACGCGTAACTGTTC;

[0039] Hf-T7-2F: TACTGCACATGGCATGAACATT;

[0040] Hf-T7-2R: ATCAAATGTTTGCCCAATTGGC;

[0041] Hf-T7-3F:TCACAAAACAGAGCACACTCGG;

[0042] Hf-T7-3R:GCTTTTCTGTTCTGATTCGCCA;

[0043] EGFP-T7F: CAGAAGAACGGCATCAAGGTG;

[0044] EGFP-T7R:TTTCCGTTGGGGTCTTTGCTC;

[0045] The T7 promoter sequence TAATACGACTCACTATAGGG was introduced into the 5′ end of the primer to synthesize the dsRNA template. According to the instructions of Hiscribe T7 Quick High Yield RNA synthesis kit, the dsRNA fragments of HfSvG434 gene and eGFP were synthesized (the gene fragment sequences for the designed dsRNA fragments are shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6), and MEGAclear TM Purification Kit was used to purify the synthesized dsRNA. Octopamine and spermidine were used to stimulate the second-instar larvae of Philip cyst nematodes to ingest dsRNA. The newly hatched second-instar larvae of Philip cyst nematodes were immersed in 2 mg / mL dsRNA in the dark for 36 hours. About 2,000 nematodes were taken after 12 hours, 24 hours and 36 hours, respectively. After washing with DEPC water for 3 to 4 times, RNA extraction and lysis solution were added and stored at -80°C for the detection of HfSvG434 gene transcription level. The second-instar larvae of Philip cyst nematodes treated for 36 hours were taken, washed with sterile water several times, and 100 mL of sterilized sand (V) was added to a PVC tube with a height of 15 cm and a diameter of 3 cm. 沙 :V 土 =1:3), sow one Wenmai 19 with a root length of 2-3 cm in each tube, add 1 mL of nematode suspension (200 nematodes / mL) to the root, cover with 2 cm of sand, and culture in a light incubator (day: night = 16h:8h) at 18 / 14℃ for 7 days, 20 / 16℃ for 7 days, 25 / 18℃ for 21 days, and 30 / 22℃ for 7 days [Cui Jiangkuan. Identification of effector proteins of cereal cyst nematodes and analysis of resistance mechanisms of wheat carrying different Cre genes. Chinese Academy of Agricultural Sciences. 2017]. After 7 days of inoculation, three wheat plants from each treatment were taken for acid fuchsin staining [Feng Zhixin. Plant Nematology. Beijing: China Agricultural Press. 2001], and the number of J2 in the roots was counted under a microscope. After 40 days, the white females were collected using a simple floating method to determine the effect of target gene silencing on the infection and development of Philip cyst nematodes.

[0046] The results showed that 7 days after inoculation, the wheat roots of each treatment were stained with acid fuchsin to investigate the early stage of nematode infection. There was no significant difference in the nematode infection rate between the dsT7-2 treatment and the CK and dsGFP treatments. The dsT7-1 and dsT7-3 treatments significantly reduced the nematode infection rate compared with the CK, decreasing by 31.91% and 25.53%, respectively ( Figure 3 After 40 days, the number of white females in each treatment was investigated, and it was found that there was no significant difference in the number of white females between the dsT7-2 treatment and the CK and dsEGFP treatments. Compared with the CK, the dsT7-1 and dsT7-3 treatments significantly reduced the number of white females, which decreased by 54.50% and 70.90%, respectively. Figure 3 There was no significant difference in the content of single cyst eggs among the treatments ( Figure 3 (D) in the middle, indicating that interfering with this gene had no effect on the single cyst egg content.

Claims

1. A HfSvG434 protein of Philipp cyst nematode, the amino acid sequence of which is shown in SEQ ID NO:

2.

2. A gene encoding the HfSvG434 protein of Philipp cyst nematode according to claim 1.

3. The gene according to claim 2, named as HfSvG434, and its nucleotide sequence is shown in SEQ ID NO:

1.

4. A synthetic dsRNA fragment, which is designed and synthesized for the DNA fragment of the gene according to claim 3, wherein the nucleotide sequence of the DNA fragment is shown in SEQ ID NO: 3 or SEQ ID NO:

5.

5. Use of the synthetic dsRNA fragment according to claim 4 in inhibiting the parasitism and damage of Philipp cyst nematode to plants, and / or inhibiting the pathogenicity of Philipp cyst nematode to plants, and / or inhibiting the development of Philipp cyst nematode; The application is to introduce the dsRNA fragment into the plant nematode, resulting in a reduction in the infectivity of the Philip cyst nematode to the plant, thereby achieving the purpose of preventing and controlling the Philip cyst nematode.

6. The use according to claim 5, wherein the dsRNA fragment is synthesized from a DNA fragment targeting the gene according to claim 3, and the nucleotide sequence of the DNA fragment is shown in SEQ ID NO: 3 or SEQ ID NO:

5.

7. The use according to claim 6, wherein the introduction is feeding food containing dsRNA fragments so that Philipp cyst nematodes can take in the dsRNA fragments into the body.

8. The use according to any one of claims 5-7, wherein the Philip cyst nematode is the second instar, third instar and fourth instar of Philip cyst nematode, and the plant is wheat and / or barley.

Images