Ancheta elizabethii strain jx2021 from chinese soft-shelled turtle and application thereof

Abstract

The application discloses an anopheles elizabethkingia JX2021 strain from Chinese soft-shelled turtles, and the anopheles elizabethkingia JX2021 strain has been preserved in the China Center for Type Culture Collection (Wuhan) on April 28, 2022, and the preservation number is CCTCC NO: M 2022507. The anopheles elizabethkingia JX2021 strain has strong pathogenicity to Chinese soft-shelled turtles, can cause different degrees of lesions in tissues such as liver, spleen, lung and intestinal tract of the Chinese soft-shelled turtles, causes bacterial septicemia of the Chinese soft-shelled turtles, and can even cause death. The anopheles elizabethkingia JX2021 strain can also be used for breeding of Chinese soft-shelled turtle seedlings against the anopheles elizabethkingia, construction of an animal model, and preparation of drugs and vaccines.

Description

Technical Field

[0001] This invention relates to the field of microbial application technology, and in particular to a strain of Elizabethan bacterium from the Chinese soft-shelled turtle, JX2021, and its application. Background Technology

[0002] Elizabethkingia anophelis, belonging to the Flavobacterium family and the Elizabethella genus, is a pathogenic bacterium isolated from the spleen of a pathogenic Chinese soft-shelled turtle. The main symptoms include neck swelling and redness, difficulty in movement, lethargy, and loss of appetite, diagnosed as "bacterial septicemia." This bacterium can spread widely in Chinese soft-shelled turtle farming and exhibits strong drug resistance, resulting in a high mortality rate. Based on the complete genome of Elizabethkingia anophelis and comparison with the NFDB virulence factor database, virulence genes were predicted to include 16 classes and 246 genes, among which 12 are exotoxin-related genes. These genes involve arylsulfatase, which promotes bacterial crossing of the blood-brain barrier, and hemolysin, which can cause lesions in the liver, spleen, and intestines.

[0003] In recent years, the scale of Chinese soft-shelled turtle farming has been expanding year by year. Under the intensive farming model, factors such as increased stocking density and deterioration of the aquatic environment have led to a decrease in the disease resistance of Chinese soft-shelled turtles, resulting in frequent outbreaks and rapid spread of various diseases. No research has been reported on the pathogenicity of *Elizabethanella anopheles* in Chinese soft-shelled turtles, and farmers lack sufficient understanding of this pathogen, leading to serious misuse of drugs in production. Therefore, only by accurately isolating and identifying this pathogen and conducting sensitivity analyses of antibiotics and traditional Chinese medicines can appropriate drugs and reasonable concentrations be selected for prevention and control.

[0004] Although there are currently no reports of *Elizabeth Anopheles* bacteria from aquatic animals infecting humans, the genetic sequence similarity between *Elizabeth Anopheles* from turtles and *Elizabeth Anopheles* from humans is high. It has been found that *Elizabeth Anopheles* from humans can cause various diseases in humans, including meningitis, pneumonia, myelitis, endocarditis, skin and soft tissue infections, urinary tract infections, and abdominal infections. Therefore, further research is needed on the pathogenic mechanism and drug susceptibility of *Elizabeth Anopheles* from turtles. Summary of the Invention

[0005] 1. Technical problems to be solved

[0006] The purpose of this invention is to address the problem that there are no reports on the pathogenicity of Anopheles al-Elizabeth in Chinese soft-shelled turtles in the prior art, and that farmers have insufficient knowledge of this pathogen, leading to serious misuse of drugs in production. The invention proposes a strain of Anopheles al-Elizabeth JX2021 derived from Chinese soft-shelled turtles and its application.

[0007] 2. Technical Solution

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] A strain of Elizabethkingia anophelis JX2021 from Anopheles sinensis was deposited on April 28, 2022, at the China Center for Type Culture Collection (Wuhan), China, accession number: CCTCC NO: M2022507, and classified as Elizabethkingia anophelis.

[0010] This invention also proposes a method for isolating a strain of Elizabethan bacterium JX2021 from the Chinese soft-shelled turtle, comprising the following steps:

[0011] Step 1: Preparation of culture media: LB liquid medium: 10g peptone, 5g yeast extract, 10g NaCl, dissolved in 1000mL ultrapure water, sterilized at 121℃ for 15min, and stored at 4℃ after cooling to room temperature; LB solid medium: 10g peptone, 5g yeast extract, 10g NaCl, 20g agar powder, dissolved in 1000mL ultrapure water, sterilized at 121℃ for 15min, the culture medium was cooled to 50℃ and poured into disposable bacterial culture dishes, and stored at 4℃ after solidification.

[0012] Step 2: Isolation and culture of bacterial strains: Aseptically collect the spleen of diseased turtles, streak it onto LB solid medium, and incubate at 28.5℃ for 24 hours to grow single colonies; inoculate the grown single colonies onto LB solid medium and incubate at 30℃ for 24 hours to observe whether the colony morphology is consistent; repeat the above operation again; after confirming that it is a single colony, inoculate it into LB liquid medium and incubate it in a shaker at 30℃ and 180rpm for 24 hours.

[0013] This invention also proposes the application of a strain of Elizabethan bacterium from the Chinese soft-shelled turtle, JX2021, in the preparation of a reagent that induces bacterial septicemia in animals.

[0014] This invention also proposes the application of a strain of Elizabethan bacterium *Anopheles sinensis* JX2021, derived from the Chinese soft-shelled turtle, in animal seedling breeding.

[0015] This invention also proposes the application of a strain of Elizabethan bacillus from the Chinese soft-shelled turtle, JX2021, in the construction of an animal model of "bacterial sepsis".

[0016] This invention also proposes the application of a strain of Elizabethan bacterium from the Chinese soft-shelled turtle, JX2021, in the preparation of animal drugs and vaccines.

[0017] The animals used in this invention include the Chinese soft-shelled turtle.

[0018] 3. Beneficial effects

[0019] Compared with the prior art, the advantages of this invention are:

[0020] In this invention, the Elizabethan Anopheles bacterium JX2021 strain exhibits strong pathogenicity against Chinese soft-shelled turtles; simultaneously, the Elizabethan Anopheles bacterium JX2021 strain can be used to prepare reagents for inducing "bacterial septicemia," construct an animal model of "bacterial septicemia," and develop drugs against turtle-derived Elizabethan Anopheles bacterium. Attached Figure Description

[0021] Figure 1 Colony morphology of the Elizabethan Anopheles bacterium JX2021 strain proposed in this invention on LB medium;

[0022] Figure 2 Gram staining morphology of the Elizabethan Anopheles bacillus JX2021 strain proposed in this invention;

[0023] Figure 3 The scanning electron microscope morphology of the Elizabethan Anopheles bacterium JX2021 strain proposed in this invention;

[0024] Figure 4 Sequence diagram of the Elizabethan bacterium Anopheles JX2021 strain proposed in this invention in the NCBI database;

[0025] Figure 5 The phylogenetic tree diagram of the Elizabethan Anopheles bacterium JX2021 strain proposed in this invention, constructed based on the 16S rRNA gene sequence;

[0026] Figure 6 The hemolysis test of the Elizabethan bacterium Anopheles JX2021 strain proposed in this invention was observed.

[0027] Figure 7 The following are histopathological observation images of pathogenic Chinese soft-shelled turtles caused by the Elizabethanella anopheles JX2021 strain proposed in this invention: a. Liver, lung, spleen, and intestinal tissues of healthy Chinese soft-shelled turtles; b. Liver, lung, spleen, and intestinal tissues of Chinese soft-shelled turtles pathogenic with the Elizabethanella anopheles JX2021 strain.

[0028] Figure 8 The antibiotic susceptibility observation of the Elizabethan Anopheles bacterium JX2021 strain proposed in this invention;

[0029] Figure 9 Drug sensitivity observation of the sensitive herbal extract of the Elizabethan Anopheles bacterium JX2021 strain proposed in this invention. Detailed Implementation

[0030] The technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments.

[0031] Example 1:

[0032] A strain of Elizabethanella anopheles JX2021, originating from the Chinese soft-shelled turtle, was deposited on April 28, 2022, at the China Center for Type Culture Collection (Wuhan), with accession number CCTCC NO:M 2022507.

[0033] In this invention, the Elizabethan Anopheles bacterium JX2021 strain exhibits strong pathogenicity against Chinese soft-shelled turtles; simultaneously, the Elizabethan Anopheles bacterium JX2021 strain can be used to prepare reagents for inducing "bacterial septicemia," construct an animal model of "bacterial septicemia," and develop drugs against turtle-derived Elizabethan Anopheles bacterium.

[0034] Example 2:

[0035] It has the implementation content of the above embodiments, wherein the specific implementation methods of the above embodiments can be referred to the above description, and the embodiments here will not be described in detail again; however, the difference between the embodiments in this application and the above embodiments is that:

[0036] The screening and identification of strains specifically includes the following steps:

[0037] Step 1: Isolation of strains

[0038] 1) Preparation of culture medium:

[0039] LB liquid medium: 10g peptone, 5g yeast extract, 10g NaCl, dissolved in 1000mL ultrapure water, sterilized at 121℃ for 15min, and stored at 4℃ after cooling to room temperature for later use.

[0040] LB solid medium: 10g peptone, 5g yeast extract, 10g NaCl, 20g agar powder, dissolved in 1000mL ultrapure water, sterilized at 121℃ for 15min, the culture medium was cooled to 50℃ and poured into disposable bacterial culture dishes, and stored at 4℃ for later use after solidification.

[0041] 2) Isolation and culture of bacterial strains:

[0042] Spleens of diseased turtles were aseptically collected and streaked onto LB solid medium. The culture was carried out at 28.5℃ for 24 hours until single colonies grew. The single colonies were then inoculated onto fresh LB solid medium and incubated at 30℃ for 24 hours. The colony morphology was observed to ensure consistency. The above steps were repeated. Once single colonies were confirmed, they were inoculated into LB liquid medium and incubated on a shaker at 30℃ and 180 rpm for 24 hours.

[0043] Step 2: Identification of the strain:

[0044] 1) Morphological characteristics and Gram staining

[0045] On LB agar plates, colonies are 2.5-3.0 mm in diameter, round, milky white, with a smooth, opaque, glossy surface, slightly raised in the center, with neat edges, no halo, and a relatively soft texture (see...). Figure 1 Gram-negative bacteria (see) Figure 2 ).

[0046] 2) 16S rDNA sequence analysis:

[0047] The 16S rDNA of the isolated *Elizabethanella anopheles* JX2021 was identified. The primer sequences were the universal 16S rDNA primers 27f (SEQ ID NO.1: 5'—AGAGTTTGATCCTGGCTCAG—3') and 1492r (SEQ ID NO.2: 5'—GGTTACCTTGTTACGACTT—3'). Total DNA from the screened strain was used as a template for PCR amplification. The amplification reaction system (50 μL) consisted of: 5 μL 10× buffer, 4.0 μL dNTPs, 1.0 μL each of forward and reverse primers, 0.5 μL Taq enzyme, 1.0 μL template, and 37.5 μL ddH2O. The reaction program was: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 30 s, 32 cycles; and 72℃ extension for 10 min. The sequencing results of the target fragment were compared with the NCBI database. Based on morphological characteristics and 16S rDNA sequence analysis, the selected strain was identified as Elizabethkingia anophelis, named Elizabethkingia anophelis JX2021, and its sequence was submitted to the NCBI database (GenBank: OL989210.1) (see...). Figure 4 ); by constructing a phylogenetic tree (see Figure 5 The selected strain was further identified as Elizabethanella anopheles.

[0048] 3) Pathogen hemolysis test and virulence gene comparison

[0049] Hemolysis test of Elizabethan bacillus Anopheles JX2021 strain: The Elizabethan bacillus Anopheles JX2021 strain was inoculated onto blood agar plates and incubated at 28.5℃ for 48 hours. The presence of a clear hemolytic area around the colony was then observed. Results showed a transparent hemolytic area around the colony (see...). Figure 6 ).

[0050] Comparative analysis of virulence genes in *Anopheles albopictus* strain JX2021: After whole-genome sequencing of *Anopheles albopictus* strain JX2021, virulence factors were screened using the VFanalyzer online tool of the CAMS & PUMC Institute of Pathogenic Biology Virulence Factor Database (VFDB) (http: / / www.mgc.ac.cn / cgi-bin / VFs / v5 / main.cgifunc=VFanalyzer). A total of 246 genes in 16 classes were predicted to be related to virulence. The classification is shown in Table 1.

[0051] Table 1. Potential virulence genes of Elizabethanella anopheles strain JX2021

[0052]

[0053]

[0054]

[0055] 4) Artificial infection of pathogens

[0056] The isolated Elizabethan bacterium Anopheles japonicus JX2021 was used at a concentration of 1×10⁻⁶. 9 Healthy turtles were challenged with a CFU / mL concentration via intraperitoneal injection at a rate of 0.1 mL per turtle, with sterile phosphate-buffered saline (PBS) at pH 7.2 serving as a control. After 15 days of routine management, disease and mortality were recorded. Bacterial isolation was performed again on infected turtles exhibiting typical symptoms of bacterial septicemia. 16S rDNA identification showed that the isolated bacteria were 100% homologous to *Elizabeth Anopheles*. Lesion tissue was examined using HE staining (see...). Figure 7 ).

[0057] Example 2:

[0058] It has the implementation content of the above embodiments, wherein the specific implementation methods of the above embodiments can be referred to the above description, and the embodiments here will not be described in detail again; however, the difference between the embodiments in this application and the above embodiments is that:

[0059] Drug susceptibility test of Elizabethan bacillus JX2021 in Anopheles mosquitoes:

[0060] 1. Antibiotic drug susceptibility study

[0061] The antimicrobial susceptibility testing method was used: 0.2 mL of bacterial culture was evenly spread onto agar medium. Antimicrobial susceptibility testing discs for 20 common antibiotics were selected, with 3 discs placed on each medium. Results were observed and recorded after 24 hours. The experimental results were evaluated according to the interpretation criteria for inhibition zone size (see [link to relevant documentation]). Figure 8 ).

[0062] Table 2 shows the susceptibility of Elizabethan Anopheles bacillus JX2021 to 20 antimicrobial agents. The table reveals that only 4 of the 20 antibiotics were effective (doxycycline, minocycline, kanamycin, and piperacillin), 2 were moderately effective (ceftriaxone and cefoperazone), and 14 were resistant. Therefore, in actual production, medication should be selected based on the drug susceptibility results.

[0063] Table 2. Antibacterial activity of different antimicrobial agents against Elizabethanella anopheles JX2021

[0064]

[0065]

[0066]

[0067] Note: S: Sensitive; I: Moderately Sensitive; R: Drug-Resistant

[0068] 2. Sensitivity studies of plant extracts

[0069] Twenty-seven plant extracts were selected (tea polyphenols, puerarin, quercetin, emodin, rutin, arbutin, resveratrol, epimedium, ginsenosides, ellagic acid, chlorogenic acid, silymarin, baicalin, curcumin powder, hesperidin, osthol, berberine, piperine, glycyrrhizic acid, astragalus polysaccharide, Panax notoginseng leaf saponins, aloe-emodin, hydroxycitric acid, matrine, tribulus terrestris saponins, proanthocyanidins, and luteolin). 1g of each extract was dissolved in 5mL of double-distilled water (poorly soluble extracts could be dissolved more quickly in a 50℃ water bath). After filtration through filter paper, the open end of the test tube containing the filtrate was placed in a 70℃ water bath to concentrate the solution. The solution was evaporated and concentrated to 1mL, yielding a solution with a drug concentration of 1g / mL.

[0070] The susceptibility of pathogens to plant extracts was determined using the disk diffusion method. 6mm perforations were made in filter paper to prepare circular disks, which were then autoclaved in petri dishes and dried at 37°C. After drying, various drug solutions were absorbed using the disks, dried again, and stored in sterile test tubes at 4°C for later use. 0.2 mL of overnight bacterial culture was evenly spread onto agar medium, with three disks placed on each medium. Results were observed and recorded after 24 hours, and the results were evaluated according to the inhibition zone size interpretation criteria (see [reference]). Figure 9 Three plant extracts were found to have antibacterial effects against Elizabethan bacterium JX2021 in Anopheles mosquitoes, as shown in Table 3.

[0071] Table 3. Plant extracts with antibacterial activity against Elizabethanella anopheles strain JX2021

[0072]

[0073] Note: S: Sensitive, inhibition diameter > 15mm; I: Moderately sensitive, inhibition diameter ≥ 10mm (15mm ≥ I).

[0074] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A strain of Elizabethkingia anophelis JX2021, derived from the Chinese soft-shelled turtle, is characterized by: The Elizabethan bacterium Anopheles strain JX2021 was deposited at the China Center for Type Culture Collection on April 28, 2022, with accession number CCTCC NO: M 2022507.

Images