A gene sequence encoding P450 enzyme and cytochrome P450 reductase from Fusarium graminearum and its recombinant strain

Abstract

The invention discloses a gene sequence encoding a P450 enzyme and a cytochrome P450 reductase from Fusarium graminearum and a recombinant strain thereof, belonging to the field of bioengineering technology, wherein the gene sequence in the invention has a nucleotide sequence at positions 1-1542 in SEQ ID NO.1 or an amino acid sequence in SEQ ID NO.3 and a nucleotide sequence shown at positions 1-2079 in SEQ ID NO.2 or an amino acid sequence shown in SEQ ID NO.4. The gene sequence encoding a P450 enzyme from Fusarium graminearum provided by the invention realizes heterologous expression of the P450 enzyme from Fusarium graminearum using Saccharomyces cerevisiae INVSc1 and Pichia pastoris GS115 as expression hosts, respectively. The recombinant strain can hydroxylate progesterone to obtain 12β-hydroxyprogesterone, 15α-hydroxyprogesterone and 12β, 15α-dihydroxyprogesterone.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to a gene sequence encoding a P450 enzyme and a cytochrome P450 reductase derived from Fusarium graminearum and a recombinant strain thereof. Background Art

[0002] Steroid drugs are widely used in anti-inflammatory, anti-allergic, anti-toxic, regulating sexual function, and maintaining life. They have become the second largest class of drugs after antibiotics. There are about 400 steroid hormone drugs in use, with market sales exceeding US$100 billion. Their application range is becoming more and more extensive, and the further development of new drugs often requires specific modification of the parent nucleus of steroid drugs. The use of chemical synthesis of steroid drug intermediates often has many steps, consumes a large amount of chemical raw materials, and is often accompanied by the generation of non-green products in the process. The use of microbial specific enzymes to transform steroid compounds not only has fewer reaction steps and mild reaction conditions, but also has less pollution and avoids the problem of poor product selectivity and the generation of a large number of by-products caused by the many enzymes in the microorganisms when using microorganisms alone for transformation. It is an important trend in the sustainable development of the chemical industry.

[0003] The hydroxylation of steroidal substances by steroidal microorganisms can be regarded as being catalyzed by the P450 enzyme system contained in microorganisms. Cytochrome P450 enzymes are widely available, and P450 is found in animals, plants, fungi and bacteria. It can catalyze various types of reactions, such as hydroxylation, peroxidation, epoxidation, dehalogenation, deamination, etc. The large number of cytochrome P450 contained in fungi makes it possible for fungi to catalyze a large number of steroidal hydroxylation reactions. The catalytic activity of the hydroxylation of P450 is that the P450 enzyme binds to oxygen molecules in the air, obtains electrons from NADPH and introduces oxygen atoms into the substrate to hydroxylate the steroid molecules.

[0004] Hydroxylated steroids can be further chemically synthesized as intermediates to obtain other steroidal drugs with diverse structures. In addition, the hydroxylated products of carbon atoms at different positions usually show different pharmacological activities. Among them, 12β- and 15α-hydroxylated steroids play antifungal, anti-inflammatory, anticancer, contraceptive, and neuroprotective effects. For example, 12β-hydroxy-diocholic acid is a key precursor of deoxycholic acid, which has antifungal, anti-inflammatory, and bile secretion-promoting effects; 15α-hydroxy-nandrolone can be used to prepare estradiol, which is an important estrogen used for contraception, neuroprotection, and treatment of breast tumors; 7α,15α-diOH-dehydroepiandrosterone can be used to synthesize a variety of steroid hormone drugs, such as the fourth-generation contraceptive drospirenone, which has anti-mineralocorticoid and anti-androgen effects and has a huge market share.

[0005] It has been determined that the fungal steroid hydroxylase involved in the hydroxylation of steroid substances is a P450 enzyme located in the endoplasmic reticulum and requires electron transfer through cytochrome P450 reductase (CPR).

[0006] In the prior art, it is difficult to determine the function of fungal P450 and achieve heterologous expression, and there is no report of fungal P450 enzyme genes that can catalyze progesterone to produce 12β-hydroxyprogesterone, 15α-hydroxyprogesterone and 12β, 15α-dihydroxyprogesterone, which hinders the research and development and production of steroid drugs such as deoxycholic acid and estradiol. Summary of the invention

[0007] The purpose of the present invention is to overcome the above-mentioned technical deficiencies, provide a gene sequence encoding P450 enzyme and cytochrome P450 reductase from Fusarium graminearum and a recombinant strain thereof, solve the technical problems in the prior art that it is difficult to determine the function and achieve heterologous expression of P450 from fungi, and catalyze progesterone to produce 12β-hydroxyprogesterone, 15α-hydroxyprogesterone and 12β,15α-dihydroxyprogesterone.

[0008] In order to achieve the above technical objectives, the technical solution of the present invention provides a gene sequence encoding a P450 enzyme derived from Fusarium graminearum, having a nucleotide sequence shown at positions 1-1542 in SEQ ID NO.1.

[0009] The protein encoded by the gene sequence encoding the P450 enzyme derived from Fusarium graminearum as described above has the amino acid sequence shown in SEQ ID NO.3.

[0010] The expression plasmid 1 containing the gene encoding the P450 enzyme derived from Fusarium graminearum contains the nucleotide sequence in SEQ ID NO.1.

[0011] A gene sequence encoding a cytochrome P450 reductase derived from Fusarium graminearum, having the nucleotide sequence shown at positions 1-2079 in SEQ ID NO.2.

[0012] The protein encoded by the gene sequence encoding the cytochrome P450 reductase derived from Fusarium graminearum mentioned above has the amino acid sequence shown in SEQ ID NO.4.

[0013] The expression plasmid 2 encoding the gene of cytochrome P450 reductase derived from Fusarium graminearum contains the nucleotide sequence shown in SEQID NO.4.

[0014] A recombinant strain based on the gene of the fungal P450 enzyme of Fusarium graminearum as described above, the recombinant strain contains an expression plasmid 1 or a nucleotide sequence contained in SEQ ID NO.1 on the genome, or contains an expression plasmid 2 or a nucleotide sequence contained in SEQ ID NO.2 on the genome. The recombinant strain can convert progesterone into 12β-hydroxyprogesterone, 15α-hydroxyprogesterone and 12β,15α-dihydroxyprogesterone.

[0015] The invention obtains cDNA from total RNA of Fusarium graminearum by reverse transcription PCR, amplifies target coding genes SEQ ID NO.1 and SEQ ID NO.2 by taking cDNA sequence as template, constructs recombinant expression plasmids pYES2-CYP68J5_fg and pPICZ-CYP68J5_fg-fgCPR by taking pYES2 or pPICZ as plasmid, takes cerevisiae INVSc1 and Pichia pastoris GS115 as expression hosts respectively, and realizes heterologous expression of CYP68J5_Fusarium graminearum in cerevisiae and Pichia pastoris.

[0016] The amino acid sequence of CYP68J5_Fusarium graminearum deduced from the complete target gene is SEQ ID NO.3.

[0017] The amino acid sequence of fgCPR derived from the complete target gene is SEQ ID NO: 4

[0018] Cloning and expression method of P450 oxidase gene CYP68J5_Fusariumgraminearum and cytochrome P450 reductase fgCPR of Fusarium graminearum strain:

[0019] (1) Extraction of total RNA from Fusarium graminearum

[0020] The Fusarium graminearum strain was first cultured in a seed medium at 28°C for 48 hours, and then transferred to a fermentation medium at a 1% inoculum amount and continued to be cultured at 28°C for 36 hours. The cells were collected by centrifugation and washed twice with sterile water. The wet mycelium was placed in a mortar, liquid nitrogen was added to quickly freeze the mycelium, and the total RNA of Fusarium graminearum was extracted after the mycelium was crushed into powder in the mortar. The extracted RNA was quickly subjected to 0.8% agarose gel electrophoresis to detect whether the RNA was successfully extracted.

[0021] (2) Reverse transcription reaction to obtain cDNA sequence

[0022] cDNA was synthesized using total RNA from Fusarium graminearum as a template, and the entire operation process was carried out according to the instructions.

[0023] (3) Cloning of P450 oxidase from Fusarium graminearum

[0024] The nucleotide sequences of P450 enzymes and cytochrome P450 reductase in Fusarium graminearum were obtained by transcriptome sequencing. Primers were designed to amplify the target gene based on the obtained information. The primer sequences are as follows:

[0025] Upstream primer P1 for connecting P450 enzyme to pYES2 plasmid:

[0026]

[0027] Downstream primer P2 for connecting P450 enzyme to pYES2 plasmid:

[0028]

[0029] The bold part indicates the homologous fragment to the pYES2 plasmid.

[0030] Upstream primer P3 for connecting P450 enzyme to pPICZ plasmid:

[0031]

[0032] Downstream primer P4 for connecting P450 enzyme to pPICZ plasmid:

[0033]

[0034] The bold part indicates the homologous fragment to the pPICZ plasmid.

[0035] Upstream primer P5 for ligation of cytochrome P450 reductase with pPICZ plasmid:

[0036]

[0037] Downstream primer P6 for ligation of cytochrome P450 reductase with pPICZ plasmid:

[0038]

[0039] The bold part indicates the homologous fragment to the pPICZ plasmid.

[0040] PCR system (50 μL): Use reverse transcribed cDNA as template, 1 μL (10 μM) of each primer pair, 25 μL PrimeSTAR Max DNA polymerase, and add sterile distilled water to make up to 50 μL.

[0041] The PCR products were subjected to 1.2% agarose gel electrophoresis and then recovered.

[0042] (4) Construction of pYES2-CYP68J5_fg plasmid and transformation of Saccharomyces cerevisiae

[0043] After ligating with pYES2 using T5 EXO exonuclease, the strain was transformed into E. coli DH5α and evenly spread on LB agar plates containing 100 mg / L ampicillin. After overnight culture at 37°C, positive transformants were screened on the plates, and single clones were picked and cultured in 3 mL of LB liquid medium containing 100 mg / L ampicillin, and then sequenced. The sequencing results were compared with the P450 monooxygenase sequence obtained by transcriptome sequencing using SnapGene software. Plasmids were extracted from the strains with correct sequencing, and the plasmid was named pYES2-CYP68J5_fg.

[0044] (5) Screening and induced expression of recombinant Saccharomyces cerevisiae

[0045] The expression plasmid pYES2 used in the present invention is a shuttle vector that can be replicated and amplified in Escherichia coli and Saccharomyces cerevisiae. The constructed plasmid pYES2-CYP68J5_fg was transformed into Saccharomyces cerevisiae INVSc1 competent cells using the lithium acetate transformation method, and positive transformants were screened on a uracil (URA3) auxotrophic plate (SC-Ura). A single clone was picked and inoculated in 3mL of SC-Ura (2% glucose as a carbon source) liquid culture medium at 30°C for 24 hours, and then Saccharomyces cerevisiae colony PCR verification was performed. The primer pair used for PCR was the above-mentioned P1 and P2:

[0046] PCR system (25 μL): add 1 μL of monoclonal bacterial solution (after high-temperature boiling) as template, 0.5 μL of each primer pair (10 μM), 12.5 μL of 2×T5 Super PCR Mix polymerase, and add sterile distilled water to make up to 25 μL.

[0047] The PCR product was detected by 0.8% agarose gel electrophoresis to confirm that the expression plasmid pYES2-CYP68J5_fg was successfully transferred into Saccharomyces cerevisiae INVSc1. The verified correct strain INVSc1-pYES2-CYP68J5_fg was transferred to SC-U (glucose as carbon source) liquid culture medium at 1% inoculation, and the cells were collected after culturing at 30°C for 36 hours, and then SC-U (galactose as carbon source) liquid culture medium was added to induce the expression of P450 enzyme CYP68J5_fg.

[0048] (6) Analysis of steroidal substrate transformation by recombinant Saccharomyces cerevisiae

[0049] When the recombinant strain is replaced with SC-U medium with galactose as the carbon source, progesterone dissolved in N, N-dimethylformamide (DMF) at a final concentration of 1 mM is added for transformation. After 24-72 hours of transformation, samples are taken for HPLC analysis. Progesterone belongs to the estrogen class and is an important precursor of corticosteroids such as hydrocortisone, cortisone, dexamethasone, prednisone, etc., and has a high economic value.

[0050] (7) Construction of pPICZ-CYP68J5_fg-fgCPR plasmid and transformation of Pichia pastoris

[0051] CYP68J5_fg and fgCPR were connected to pPICZ using T5 EXO exonuclease and transformed into Escherichia coli DH5α, and evenly spread on half-salt LB agar plates containing 25 mg / L bleomycin. After overnight culture at 37°C, positive transformants were screened on the plates, and single clones were picked and cultured in 3 mL of half-salt LB liquid medium containing 25 mg / L bleomycin, and then sequenced. The sequencing results were compared with the P450 monooxygenase and cytochrome P450 reductase sequences obtained by transcriptome sequencing using SnapGene software. Plasmids were extracted from the strains with correct sequencing, and the plasmids were named pPICZ-CYP68J5_fg and pPICZ-fgCPR, respectively.

[0052] At this time, the expression frame containing P450 enzyme on the pPICZ-CYP68J5_fg plasmid was amplified and connected with the pPICZ-fgCPR plasmid using T5 EXO. Similarly, DH5α was coated on a half-salt LB agar plate containing 25 mg / L bleomycin. After overnight culture at 37°C, positive transformants were screened on the plate, and single clones were picked and cultured in 3 mL of half-salt LB liquid culture medium containing 25 mg / L bleomycin, and then sequenced. The plasmid with correct sequencing was named pPICZ-CYP68J5_fg-fgCPR.

[0053] (8) Screening and induced expression of Pichia pastoris recombinant strains

[0054] The expression plasmid pPICZ used in the present invention is a Pichia pastoris integration vector, which needs to be linearized and then transferred into Pichia pastoris and then integrated into a specific site on the genome. The constructed plasmid pPICZ-CYP68J5_f-fgCPR is linearized using SalⅠ restriction endonuclease, and the system is as follows:

[0055] 25 μL restriction enzyme system, 2.5 μL 10× buffer, 0.5 μL SalⅠ endonuclease, 1 μg plasmid pPICZ-CYP68J5_f-fgCPR, water-filled, and restriction enzyme digestion at 37°C overnight.

[0056] The digested product was transferred into Pichia pastoris GS115 competent cells by electroporation, and positive transformants were screened on YPD plates containing 100 mg / L bleomycin. A single clone was picked and inoculated into 3 mL of YPD liquid medium and cultured at 30°C for 24 hours, and then Pichia pastoris colony PCR verification was performed. The primer pair used for PCR was P3 and P6 as mentioned above:

[0057] PCR system (25 μL): add 1 μL of monoclonal bacterial solution (after high-temperature boiling) as template, 0.5 μL of each primer pair (10 μM), 12.5 μL of 2×T5 Super PCR Mix polymerase, and add sterile distilled water to make up to 25 μL.

[0058] The PCR product was tested by 0.8% agarose gel electrophoresis to confirm that the expression frame of CYP68J5_f-fgCPR was successfully integrated into the genome of Pichia pastoris GS115. The verified strain GS115-CYP68J5_f-fgCPR was transferred to BMGY liquid culture medium at a 1% inoculation rate and cultured at 30°C for 48 hours, and then the cells were collected and added to BMMY liquid culture medium to induce the expression of P450 enzyme CYP68J5_fg, and 1% methanol was added every 24 hours for continuous induction for several days.

[0059] (9) Analysis of the transformation of steroidal substrates by recombinant Pichia pastoris

[0060] When the recombinant strain was replaced with BMMY medium, progesterone dissolved in N,N-dimethylformamide (DMF) was added at a final concentration of 1 mM for transformation. After 24-72 hours of transformation, samples were taken for HPLC analysis.

[0061] The present invention provides a gene sequence encoding a P450 enzyme derived from Fusarium graminearum, a plasmid containing the gene of the present invention and a host cell containing the expression plasmid of the gene of the present invention, and the host cell can transform progesterone to generate 12β-hydroxyprogesterone (12β-Hydroxyprogesterone), 15α-hydroxyprogesterone (15α-Hydroxyprogesterone) and 12β, 15α-dihydroxyprogesterone (12β, 15α-Dihydroxyprogesterone) after expressing the P450 enzyme in the host cell. The amino acid sequence of the P450 is submitted to the International Nomenclature Committee of Cytochrome P450 ( http: / / drnelson.uthsc.edu / CytochromeP450.html ) was named CYP68J5_Fusariumgraminearum (abbreviated as CYP68J5_fg). The sequence has a homology of 68% with CYP68J3 Fusarium oxysporum. The acquisition of this gene laid a theoretical foundation for the study of hydroxylation at positions 12 and 15 of steroids and the exploration of P450 in Fusarium graminearum.

[0062] Compared with the prior art, the beneficial effects of the present invention include that the gene sequence encoding the P450 enzyme from Fusarium graminearum provided by the present invention is 1542 bp in length and encodes 513 amino acids, and the gene sequence encoding cytochrome P450 reductase is 2079 bp in length and encodes 692 amino acids. Using pYES2 and pPICZ as expression plasmids and Saccharomyces cerevisiae INVSc1 and Pichia pastoris GS115 as expression hosts, the heterologous expression of CYP68J5_Fusarium graminearum was achieved. The recombinant strains INVSc1-CYP68J5_fg and GS115-CYP68J5_fg-fgCPR can hydroxylate progesterone at the C12 and C15 positions to obtain 12β-hydroxyprogesterone (12β-Hydroxyprogesterone), 15α-hydroxyprogesterone (15α-Hydroxyprogesterone) and 12β, 15α-dihydroxyprogesterone (12β, 15α-Dihydroxyprogesterone), respectively. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 This is a schematic diagram of the 12β, 15α hydroxylation reaction of progesterone by the P450 enzyme encoded by the gene CYP68J5_fg provided in a specific embodiment of the present invention;

[0064] Figure 2This is a schematic diagram of the construction of the recombinant plasmid pYES2-CYP68J5_fg provided in a specific embodiment of the present invention;

[0065] Figure 3 A schematic diagram of the construction of the recombinant plasmid pPICZ-CYP68J5_fg-fgCPR provided in a specific embodiment of the present invention;

[0066] Figure 4 This is the HPLC analysis chart of 12β-hydroxyprogesterone standard sample;

[0067] Figure 5 This is the HPLC analysis chart of 15α-hydroxyprogesterone standard sample;

[0068] Figure 6 This is the HPLC analysis chart of 12β,15α-dihydroxyprogesterone standard sample;

[0069] Figure 7 HPLC analysis chart of the conversion of substrate progesterone by the recombinant strain INVSc1-CYP68J5_fg provided in Example 1 in the specific embodiment provided by the present invention;

[0070] Figure 8 This is a HPLC analysis chart of the substrate progesterone converted by the INVSc1-pYES2 strain in the comparative example in the specific embodiment of the present invention;

[0071] Fig. 9 HPLC analysis chart of the conversion of substrate progesterone by the recombinant strain GS115-CYP68J5_fg-fgCPR provided in Example 2 in the specific embodiment provided by the present invention;

[0072] Fig.10 This is the HPLC analysis chart of the substrate progesterone converted by the GS115 strain. DETAILED DESCRIPTION

[0073] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0074] The invention obtains cDNA from total RNA of Fusarium graminearum by reverse transcription PCR, amplifies target coding genes SEQ ID NO:1 and SEQ ID NO:2 by using cDNA sequences as templates, constructs recombinant expression plasmids pYES2-CYP68J5_fg and pPICZ-CYP68J5_fg-fgCPR with pYES2 or pPICZ as plasmids, respectively uses cerevisiae INVSc1 and Pichia pastoris GS115 as expression hosts, and realizes heterologous expression of CYP68J5_Fusarium graminearum in cerevisiae and Pichia pastoris.

[0075] The amino acid sequence of CYP68J5_Fusarium graminearum deduced from the complete target gene is SEQ ID NO: 3.

[0076] The amino acid sequence of fgCPR derived from the complete target gene is SEQ ID NO: 4

[0077] Cloning and expression method of P450 oxidase gene CYP68J5_Fusariumgraminearum and cytochrome P450 reductase fgCPR of Fusarium graminearum strain:

[0078] (1) Extraction of total RNA from Fusarium graminearum

[0079] The Fusarium graminearum strain was first cultured in a seed medium at 28°C for 48 hours, and then transferred to a fermentation medium at a 1% inoculum amount and continued to be cultured at 28°C for 36 hours. The cells were collected by centrifugation and washed twice with sterile water. The wet mycelium was placed in a mortar, liquid nitrogen was added to quickly freeze the mycelium, and the total RNA of Fusarium graminearum was extracted after the mycelium was crushed into powder in the mortar. The extracted RNA was quickly subjected to 0.8% agarose gel electrophoresis to detect whether the RNA was successfully extracted.

[0080] (2) Reverse transcription reaction to obtain cDNA sequence

[0081] cDNA was synthesized using total RNA from Fusarium graminearum as a template, and the entire operation process was carried out according to the instructions.

[0082] (3) Cloning of P450 oxidase from Fusarium graminearum The nucleotide sequences of P450 enzyme and cytochrome P450 reductase in Fusarium graminearum were obtained by transcriptome sequencing. Primers were designed based on the obtained information to amplify the target gene. The primer sequences are as follows:

[0083] Upstream primer P1 for connecting P450 enzyme to pYES2 plasmid:

[0084] 5'-GAATTCTGCAGATATCCAATGTTAACCAAGCTGGATACTATTCTGG-3'

[0085] Downstream primer P2 for connecting P450 enzyme to pYES2 plasmid:

[0086] 5'-CTCTAGATGCATGCTCGACTAGGATTCCACAGAATCAATATCC-3'

[0087] The bold part indicates the homologous fragment to the pYES2 plasmid.

[0088] Upstream primer P3 for connecting P450 enzyme to pPICZ plasmid:

[0089] ACAACTAATTATTCGAAACGATGTTGACTAAGTTGGATACAATCTTGG

[0090] Downstream primer P4 for connecting P450 enzyme to pPICZ plasmid:

[0091] GCATTCTGACATCCTCTTGATTAAGATTCAACAGAATCAATATCCAATTC

[0092] The bold part indicates the homologous fragment to the pPICZ plasmid.

[0093] Upstream primer P5 for ligation of cytochrome P450 reductase with pPICZ plasmid:

[0094] AACTAATTATTCGAAACGATGGCTGAATTGGATACTTTGGATGTTATTG

[0095] Downstream primer P6 for ligation of cytochrome P450 reductase with pPICZ plasmid:

[0096] ATTCTGACATCCTCTTGATTAAGACCAAACATCTTCTTTGATATTG

[0097] The bold part indicates the homologous fragment to the pPICZ plasmid.

[0098] PCR system (50 μL): Use reverse transcribed cDNA as template, 1 μL (10 μM) of each primer pair, 25 μL PrimeSTAR Max DNA polymerase, and add sterile distilled water to make up to 50 μL.

[0099] The PCR products were subjected to 1.2% agarose gel electrophoresis and then recovered.

[0100] Example 1

[0101] The technical solution of the present invention provides a gene sequence encoding a P450 enzyme derived from Fusarium graminearum, which has a nucleotide sequence shown at positions 1-1542 in SEQ ID NO.1.

[0102] The protein encoded by the gene sequence encoding the P450 enzyme derived from Fusarium graminearum as described above has the amino acid sequence shown in SEQ ID NO.3.

[0103] The expression plasmid 1 containing the gene encoding the P450 enzyme derived from Fusarium graminearum contains the nucleotide sequence in SEQ ID NO.1.

[0104] A recombinant strain based on the gene of the fungal P450 enzyme of Fusarium graminearum as described above, the recombinant strain contains an expression plasmid 1, and the recombinant strain can convert progesterone to produce 12β-hydroxyprogesterone, 15α-hydroxyprogesterone and 12β,15α-dihydroxyprogesterone.

[0105] Preparation of recombinant strains;

[0106] (1) Construction of pYES2-CYP68J5_fg plasmid and transformation of Saccharomyces cerevisiae

[0107] After ligating with pYES2 using T5 EXO exonuclease, the strain was transformed into E. coli DH5α and evenly spread on LB agar plates containing 100 mg / L ampicillin. After overnight culture at 37°C, positive transformants were screened on the plates, and single clones were picked and cultured in 3 mL of LB liquid medium containing 100 mg / L ampicillin, and then sequenced. The sequencing results were compared with the P450 monooxygenase sequence obtained by transcriptome sequencing using SnapGene software. Plasmids were extracted from the strains with correct sequencing, and the plasmid was named pYES2-CYP68J5_fg.

[0108] (2) Screening and induced expression of recombinant Saccharomyces cerevisiae

[0109] The expression plasmid pYES2 used in the present invention is a shuttle vector that can be replicated and amplified in Escherichia coli and Saccharomyces cerevisiae. The constructed plasmid pYES2-CYP68J5_fg was transformed into Saccharomyces cerevisiae INVSc1 competent cells using the lithium acetate transformation method, and positive transformants were screened on a uracil (URA3) auxotrophic plate (SC-Ura). A single clone was picked and inoculated in 3mL of SC-Ura (2% glucose as a carbon source) liquid culture medium at 30°C for 24 hours, and then Saccharomyces cerevisiae colony PCR verification was performed. The primer pair used for PCR was the above-mentioned P1 and P2:

[0110] PCR system (25 μL): add 1 μL of monoclonal bacterial solution (after high-temperature boiling) as template, 0.5 μL of each primer pair (10 μM), 12.5 μL of 2×T5 Super PCR Mix polymerase, and add sterile distilled water to make up to 25 μL.

[0111] The PCR product was detected by 0.8% agarose gel electrophoresis to confirm that the expression plasmid pYES2-CYP68J5_fg was successfully transferred into Saccharomyces cerevisiae INVSc1. The verified correct strain INVSc1-pYES2-CYP68J5_fg was transferred to SC-U (glucose as carbon source) liquid culture medium at 1% inoculation, and the cells were collected after culturing at 30°C for 36 hours, and then SC-U (galactose as carbon source) liquid culture medium was added to induce the expression of P450 enzyme CYP68J5_fg.

[0112] (3) Analysis of steroidal substrate transformation by recombinant Saccharomyces cerevisiae

[0113] When the recombinant strain was replaced with SC-U medium with galactose as the carbon source, progesterone dissolved in N, N-dimethylformamide (DMF) was added at a final concentration of 1 mM for conversion. After 24-72 hours of conversion, samples were taken for HPLC analysis. The test results of substrate conversion of the INVSc1-pYES2-CYP68J5_fg strain were shown in the figure below. Figure 7 Among them, the peaks at 3.8min, 6.8min and 8.2min are 12β,15α-dihydroxyprogesterone, 15α-hydroxyprogesterone and 12β-hydroxyprogesterone respectively, and the peak at 13min is progesterone.

[0114] like Figure 1 FIG. 1 is a schematic diagram of the 12β, 15α hydroxylation reaction of progesterone by the P450 enzyme encoded by the gene CYP68J5_fg in this embodiment. Figure 2 This is a schematic diagram of the construction of the recombinant plasmid pYES2-CYP68J5_fg in this example; Figure 4 This is the HPLC analysis chart of 12β-hydroxyprogesterone standard sample; Figure 5This is the HPLC analysis chart of 15α-hydroxyprogesterone standard sample; Figure 6 This is the HPLC analysis chart of 12β, 15α-dihydroxyprogesterone standard sample. Figure 7 By comparison, it can be seen that the recombinant strain in this example can achieve the conversion of progesterone after gene expression.

[0115] Progesterone belongs to the estrogen class and is an important precursor of corticosteroids such as hydrocortisone, cortisone, dexamethasone, prednisone, etc. It has high economic value.

[0116] Example 2

[0117] The technical solution of the present invention provides a gene sequence encoding cytochrome P450 reductase derived from Fusarium graminearum, having the nucleotide sequence shown at positions 1-2079 in SEQ ID NO.2.

[0118] The protein encoded by the gene sequence encoding the cytochrome P450 reductase derived from Fusarium graminearum mentioned above has the amino acid sequence shown in SEQ ID NO.4.

[0119] The expression plasmid 2 encoding the gene of cytochrome P450 reductase derived from Fusarium graminearum contains the nucleotide sequence shown in SEQID NO.4.

[0120] A recombinant strain based on the gene of the fungal P450 enzyme of Fusarium graminearum as described above, the recombinant strain contains an expression plasmid 2, and the recombinant strain can convert progesterone to produce 12β-hydroxyprogesterone, 15α-hydroxyprogesterone and 12β,15α-dihydroxyprogesterone. Figure 3 This is a schematic diagram of the construction of the recombinant plasmid pPICZ-CYP68J5_fg-fgCPR in this embodiment;

[0121] Preparation process of recombinant strains;

[0122] (1) Construction of pPICZ-CYP68J5_fg-fgCPR plasmid and transformation of Pichia pastoris

[0123] CYP68J5_fg and fgCPR were connected to pPICZ using T5 EXO exonuclease and transformed into Escherichia coli DH5α, and evenly spread on half-salt LB agar plates containing 25 mg / L bleomycin. After overnight culture at 37°C, positive transformants were screened on the plates, and single clones were picked and cultured in 3 mL of half-salt LB liquid medium containing 25 mg / L bleomycin, and then sequenced. The sequencing results were compared with the P450 monooxygenase and cytochrome P450 reductase sequences obtained by transcriptome sequencing using SnapGene software. Plasmids were extracted from the strains with correct sequencing, and the plasmids were named pPICZ-CYP68J5_fg and pPICZ-fgCPR, respectively.

[0124] At this time, the expression frame containing P450 enzyme on the pPICZ-CYP68J5_fg plasmid was amplified and connected with the pPICZ-fgCPR plasmid using T5 EXO. Similarly, DH5α was coated on a half-salt LB agar plate containing 25 mg / L bleomycin. After overnight culture at 37°C, positive transformants were screened on the plate, and single clones were picked and cultured in 3 mL of half-salt LB liquid culture medium containing 25 mg / L bleomycin, and then sequenced. The plasmid with correct sequencing was named pPICZ-CYP68J5_fg-fgCPR.

[0125] (2) Screening and induced expression of Pichia pastoris recombinant strains

[0126] The expression plasmid pPICZ used in the present invention is a Pichia pastoris integration vector, which needs to be linearized and then transferred into Pichia pastoris and then integrated into a specific site on the genome. The constructed plasmid pPICZ-CYP68J5_f-fgCPR is linearized using SalⅠ restriction endonuclease, and the system is as follows:

[0127] 25μL restriction enzyme system, 2.5μL 10×buffer, 0.5μL SalⅠ endonuclease, 1μg plasmid pPICZ-CYP68J5_f-fgCPR, water-filled, and digested at 37℃ overnight. The digested products were transferred into Pichia pastoris GS115 competent cells by electroporation, and positive transformants were screened on YPD plates containing 100mg / L bleomycin. A single clone was picked and inoculated in 3mL of YPD liquid medium and cultured at 30℃ for 24 hours, and then Pichia pastoris colony PCR verification was performed. The primer pairs used for PCR were P3 and P6 mentioned above:

[0128] PCR system (25 μL): add 1 μL of monoclonal bacterial solution (after high-temperature boiling) as template, 0.5 μL of each primer pair (10 μM), 12.5 μL of 2×T5 Super PCR Mix polymerase, and add sterile distilled water to make up to 25 μL.

[0129] The PCR product was tested by 0.8% agarose gel electrophoresis to confirm that the expression frame of CYP68J5_f-fgCPR was successfully integrated into the genome of Pichia pastoris GS115. The verified strain GS115-CYP68J5_f-fgCPR was transferred to BMGY liquid culture medium at a 1% inoculation rate and cultured at 30°C for 48 hours, and then the cells were collected and added to BMMY liquid culture medium to induce the expression of P450 enzyme CYP68J5_fg, and 1% methanol was added every 24 hours for continuous induction for several days.

[0130] (3) Analysis of the transformation of steroidal substrates by recombinant Pichia pastoris

[0131] When the recombinant strain was replaced with BMMY medium, progesterone dissolved in N,N-dimethylformamide (DMF) was added at a final concentration of 1 mM for transformation. After 24-72 hours of transformation, samples were taken for HPLC analysis.

[0132] Fig. 9 HPLC analysis of the substrate progesterone converted by the recombinant strain GS115-CYP68J5_fg-fgCPR provided in this example; Fig.10 The HPLC analysis chart of the substrate progesterone converted by the GS115 strain. Fig. 9 As shown, the peaks at 3.8min, 6.8min and 8.2min are 12β,15α-dihydroxyprogesterone, 15α-hydroxyprogesterone and 12β-hydroxyprogesterone respectively, and the peak at 13min is progesterone.

[0133] Comparative Example

[0134] This comparative example is the same as Example 1, except that the expression plasmid in the comparative example does not contain the CYP68J5_fg gene, and the obtained recombinant strain is the INVSc1-pYES2 strain. The analysis of the transformation of the steroidal substrate by the recombinant bacteria is also performed, and the obtained Figure 8 The result graph

[0135] The specific implementation of the present invention described above does not constitute a limitation on the protection scope of the present invention. Any other corresponding changes and modifications made based on the technical concept of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A gene encoding a P450 enzyme derived from Fusarium graminearum, characterized in that: The nucleotide sequence is shown in positions 1 to 1542 of SEQ ID NO.

1.

2. The protein encoded by the gene encoding the P450 enzyme derived from Fusarium graminearum according to claim 1, characterized in that The amino acid sequence is shown in SEQ ID NO.

3.

3. The expression plasmid of the gene encoding the P450 enzyme derived from Fusarium graminearum according to claim 1, characterized in that: Containing the nucleotide sequence of claim 1.

4. A recombinant strain containing a gene encoding a fungal P450 enzyme of Fusarium graminearum, characterized in that It is a recombinant strain containing the expression plasmid described in claim 3, or the recombinant strain contains both the expression plasmid described in claim 3 and an expression plasmid whose nucleotide sequence is shown at positions 1-2079 in SEQ ID NO.2 and encodes a gene of cytochrome P450 reductase derived from Fusarium graminearum.

Images