A gene editing plasmid of Thermus thermophilus and its application in producing superoxide dismutase

Abstract

The present invention discloses a gene editing plasmid of Thermus thermophilus and its application in the production of superoxide dismutase, belonging to the field of genetic engineering and applied microorganisms. The gene editing plasmid of Thermus thermophilus comprises: 5'-promoter-repeat sequence-spacer sequence-repeat sequence-donor DNA-3'; wherein the repeat sequence is derived from the CRISPR-Cas system of subtype I-B, subtype I-C or subtype III-A and III-B on the Thermus thermophilus genome; the spacer sequence is a target fragment. The gene editing technology disclosed in the present invention has a simple process and higher editing efficiency, and a short time period, which provides a tool for the excavation of the gene function of Thermus thermophilus and the construction of high-performance engineering strains. The Thermus thermophilus engineered bacteria constructed by the present invention can produce superoxide dismutase with a specific enzyme activity of up to 121-157U / mg, which is nearly 2.2 times that of the control bacteria, significantly improving the active ingredients of Thermus thermophilus.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering and applied microorganisms, and in particular to a Thermus thermophilus gene editing plasmid and its application in producing superoxide dismutase. Background Art

[0002] Thermophiles are a type of microorganisms that live in high-temperature environments. They are widely distributed in hot springs, composts, geothermal soils, volcanic areas, and submarine volcanic areas. They are considered to be one of the sources of industrially relevant thermostable enzymes. Generally, enzymes or proteins are considered to be thermostable when they unfold their structures at extremely high temperatures or have a long half-life at a specific high temperature. Thermophilic enzymes in thermophiles can be used to catalyze high-temperature chemical reactions that are difficult for room-temperature enzymes to achieve. This uniqueness paves the way for their widespread application in industry. Thermus thermophilus is one of the model species for studying extreme thermophilic microorganisms. It has efficient natural transformation capabilities and a short growth cycle. Scientists have been trying to maximize the use of these advantages to genetically modify Thermus thermophilus, and then obtain the target strains for use in scientific research and industry.

[0003] Although Thermus thermophilus has efficient natural transformation ability and a short growth cycle, researchers have been editing its genome through traditional homologous recombination methods. This method has certain limitations. It is highly dependent on screening markers and usually cannot achieve seamless gene editing. At the same time, its efficiency in obtaining correct mutants is low, with a maximum of only 1%. Therefore, it is necessary to develop efficient gene editing tools suitable for Thermus thermophilus, which will promote the research on the functional mechanism and industrial application of thermophiles. As early as 2004, researchers analyzed the complete genome sequence of Thermus thermophilus HB27. Later in 2006, Godde et al. reported the presence of CRISPR repeat sequences and cas genes on the giant plasmid of Thermus thermophilus HB27. The above findings were confirmed by other researchers and showed the distribution of CRISPRs and cas genes on the giant plasmid and chromosome of Thermus thermophilus HB27. According to the annotation, the giant plasmid pTT27 encodes I-B, I-C, III-A and III-B subtypes of CRISPR-Cas systems, as well as 9 CRISPR clusters; the chromosome encodes 2 CRISPR clusters. Based on the comparison results of the Cas proteins of the CRISPR system of Thermus thermophilus HB27, the researchers established a phylogenetic tree and divided the 11 CRISPR clusters into three categories, corresponding to different types of CRISPR-Cas systems. Type II CRISPR-Cas9 systems have been widely used as gene editing tools in prokaryotes and eukaryotes. The rich CRISPR system in Thermus thermophilus HB27 also has the potential to be developed into a gene editing tool. By targeting the target gene or fragment, it can efficiently introduce target chain breaks, improve the efficiency of genetic modification of the strain, and achieve efficient gene deletion, insertion and point mutation editing of Thermus thermophilus HB27, providing technical support for the design and construction of thermophilic microbial chassis cells.

[0004] Superoxide dismutase (SOD) is widely present in various organisms. It is a natural scavenger of superoxide anion free radicals in the body and plays a protective role on the body's cells. As an antioxidant, SOD is widely used in cosmetics. It has been shown to alleviate UV damage to the skin, heal wounds, and reduce facial wrinkles and pigmentation. Studies have shown that after biological fermentation, Thermus thermophilus can produce heat-stable superoxide dismutase and B vitamins, showing efficient antioxidant and photoprotective activities and strong cell repair effects. Studies have also found that the fermentation products of Thermus thermophilus contain polyamino acids, nicotinamide mononucleotide, etc. After the fermentation broth is broken, it can be extracted to obtain a large number of active ingredients such as amino acids, peptides, vitamins, glutathione peroxidase, superoxide dismutase, etc. that are needed by the skin. It has antioxidant ability, can effectively remove free radicals, and resist skin aging. Secondly, it can stimulate the growth of skin fibroblasts and help skin repair. It can also effectively inhibit the activity of tyrosinase (a key enzyme in the production of melanin) and reduce the production of melanin, thereby achieving the effect of brightening and whitening the skin. Therefore, in order to obtain biologically derived SOD, it is of great significance to transform Thermus thermophilus through gene editing. Summary of the invention

[0005] The purpose of the present invention is to provide a Thermus thermophilus gene editing plasmid and its application in the production of superoxide dismutase to solve the problems existing in the above-mentioned prior art. The CRISPR-Cas systems of subtypes Ⅰ-B, Ⅰ-C, Ⅲ-A and Ⅲ-B are respectively used to construct Thermus thermophilus engineered bacteria. The tool is simple to construct and has a short experimental cycle. It can perform efficient gene editing on the Thermus thermophilus genome, and the constructed Thermus thermophilus engineered bacteria can produce high levels of superoxide dismutase.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a gene editing plasmid for Thermus thermophilus, wherein the editing plasmid comprises the following gene structure: 5'-promoter-repeat sequence-spacer sequence-repeat sequence-donor DNA-3'; wherein the repeat sequence is derived from the CRISPR-Cas system of subtype I-B, subtype I-C or subtype III-A / B on the Thermus thermophilus genome; and the spacer sequence is a target fragment.

[0008] Preferably, the repeat sequence derived from the I-B subtype CRISPR-Cas system on the Thermus thermophilus genome (SEQ ID NO: 1) is: 5'-GTTGCAAACCTCGTTAGCCTCGTAGAGGATTGAAAC-3';

[0009] The repeat sequence derived from the I-C subtype CRISPR-Cas system on the Thermus thermophilus genome (SEQ ID NO: 2) is: 5'-GTTGCACCGG CCCGAAAGGG CCGGTGAGGA TTGAAAC-3';

[0010] The repeat sequence derived from the III-A and III-B subtype CRISPR-Cas systems on the Thermus thermophilus genome (SEQ ID NO: 3) is: 5'-GTTGCAAGGG ATTGAACCCC GTAAGGGGAT TGCGAC-3'.

[0011] Preferably, the spacer sequence is a sequence of 38-40 bp in length immediately adjacent to the PAM sequence.

[0012] Preferably, the PAM sequence of subtype I-B and subtype I-C is 5'-TTC-3'.

[0013] Preferably, when the 3' flanking sequence of the target site does not match the 5' repeat sequence of the crRNA, the Cas proteins of the III-A and III-B subtypes have DNA cleavage activity.

[0014] Preferably, the promoter is a constitutive promoter of Thermus thermophilus. More preferably, the promoter is a constitutive promoter P31 derived from Thermus thermophilus, which can continuously and highly express genes.

[0015] The donor DNA is a genomic DNA sequence or fragment of Thermus thermophilus HB27.

[0016] The present invention also provides an engineered strain, comprising the Thermus thermophilus gene editing plasmid.

[0017] The present invention also provides the Thermus thermophilus gene editing plasmid or the use of the engineered strain in producing superoxide dismutase.

[0018] The present invention also provides a method for producing superoxide dismutase, comprising: transferring the editing plasmid into Thermus thermophilus, knocking out the crtB gene of Thermus thermophilus and inserting a gene encoding SOD (the SOD gene sequence is shown in SEQ ID NO: 4, and the SOD protein sequence is shown in SEQ ID NO: 5), and after multiple passages to make it a homozygous strain, continuing to pass it in an antibiotic-free medium to lose the editing plasmid, thereby obtaining a Thermus thermophilus engineered bacterium that can be cultured without adding antibiotics and produces high superoxide dismutase. Then, the Thermus thermophilus engineered bacterium is cultured by liquid fermentation until the OD of the Thermus thermophilus engineered bacterium reaches 1. 600 When the pH value is 0.8-1.2, the fermentation is terminated and superoxide dismutase is obtained.

[0019] SOD gene sequence (SEQ ID NO: 4):

[0020] ATGCCGTACCCGTTCAAGCTTCCTGACCTAGGCTACCCCTACGAGGCCCTCGAGCCCCACATTGACGCCAAGACCATGGAGATCCACCACCAGAAGCACCACGGGGCCTACGTGACGAACCTCAACGCCGCCCTGGAGAAGTACCCCTACCTCCACGGGGTGGAGGTGGAGGTCCTCCTGAGGCACCTCGCCGCCCTTCCCCAGGACATCCAGACCGCCGTGCGCAACAACGGGGGCGGGCACCTGAACCACAGCCTCTTCTGGAGGCTCCTCACCCCCGGGGGGGCCAAGGAGCCCGTGGGGGAGCTGAAGAAGGCCATTGACGAGCAGTTCGGGGGCTTCCAGGCCCTCAAGGAGAAGCTCACCCAGGCGGCCATGGGCCGGTTCGGCTCGGGCTGGGCCTGGCTCGTGAAGGACCCCTTCGGCAAGCTCCACGTCCTCTCCACCCCCAACCAAGACAACCCCGTGATGGAGGGCTTCACCCCCATCGTGGGCATTGACGTCTGGGAGCACGCCTACTACCTCAAGTACCAGAACCGCCGGGCCGATTACCTCCAGGCCATCTGGAACGTCCTCAACTGGGACGTGGCCGAGGAGTTCTTCAAGAAGGCCTGA。

[0021] SOD protein sequence (SEQ ID NO: 5):

[0022] Met Pro Tyr Pro Phe Lys Leu Pro Asp Leu Gly Tyr Pro Tyr Glu Ala LeuGlu Pro His Ile Asp Ala Lys Thr Met Glu Ile His His Gln Lys His His Gly AlaTyr Val Thr Asn Leu Asn Ala Ala Leu Glu Lys Tyr Pro Tyr Leu His Gly Val GluVal Glu Val Leu Leu Arg His Leu Ala Ala Leu Pro Gln Asp Ile Gln Thr Ala ValArg Asn Asn Gly Gly Gly His Leu Asn His Ser Leu Phe Trp Arg Leu Leu Thr ProGly Gly Ala Lys Glu Pro Val Gly Glu Leu Lys Lys Ala Ile Asp Glu Gln Phe GlyGly Phe Gln Ala Leu Lys Glu Lys Leu Thr Gln Ala Ala Met Gly Arg Phe Gly SerGly Trp Ala Trp Leu Val Lys Asp Pro Phe Gly Lys Leu His Val Leu Ser Thr ProAsn Gln Asp Asn Pro Val Met Glu Gly Phe Thr Pro Ile Val Gly Ile Asp Val TrpGlu His Ala Tyr Tyr Leu Lys Tyr Gln Asn Arg Arg Ala Asp Tyr Leu Gln Ala IleTrp Asn Val Leu Asn Trp Asp Val Ala Glu Glu Phe Phe Lys Lys Alas.

[0023] Preferably, during liquid fermentation culture, the liquid fermentation medium used includes the following components in concentrations: 8 g / L peptone, 4 g / L yeast extract, 3 g / L sodium chloride, 367 mg / L sodium bicarbonate, 31.34 mg / L magnesium sulfate, 0.95 mg / L potassium chloride, 36.75 mg / L calcium chloride dihydrate and 150.44 mg / L magnesium chloride hexahydrate, and the pH value is 7.5.

[0024] The present invention discloses the following technical effects:

[0025] (1) When performing genome editing, the present invention only needs to construct an editing plasmid that carries a promoter, two repeat sequences, a spacer sequence that guides the targeted target site, and a donor DNA. After the endogenous Cas protein interferes with the target DNA chain, the donor DNA provides the bacteria with a homologous recombination repair template to edit the genome. The gene editing technology of the present invention has a simple process and higher editing efficiency, and a short time period, providing a tool for the excavation of the gene function of Thermus thermophilus and the construction of high-performance engineering strains.

[0026] (2) The present invention uses the above-mentioned gene editing technology to knock out the crtB gene in the Thermus thermophilus strain HB27, and inserts the SOD coding gene at the gene site, thereby increasing the copy number of the SOD gene in the Thermus thermophilus; the gene editing technology is implemented using the endogenous type I-C CRISPR-Cas system of Thermus thermophilus, and then successfully constructs the Thermus thermophilus engineered bacteria. Experiments have shown that the superoxide dismutase content of the Thermus thermophilus fermentation broth constructed by the present invention is significantly increased by 2.2 times, and can be used as a raw material to be added to cosmetics such as creams, lotions, eye essences, lotions and essences.

[0027] (3) The thermophilic bacteria of the present invention grow in a high temperature environment, and the superoxide dismutase produced by the bacteria is a thermophilic enzyme with high stability. Therefore, the bacteria can be separated, purified, packaged and transported at room temperature, and can maintain their activity for a long time.

[0028] (4) The thermophilic fermentation process of the present invention reduces the requirements for the reactor cooling system, thereby reducing energy consumption.

[0029] (5) The fermentation temperature of the thermophilic bacteria of the present invention is high, and few foreign bacteria survive, thereby reducing the contamination of the product by bacterial metabolism. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0031] Figure 1 This is a schematic diagram of the principle of gene editing using the endogenous CRISPR-Cas system of Thermus thermophilus in the present invention;

[0032] Figure 2This is an agarose gel electrophoresis diagram of PCR verification of inserting a 10×His tag into the csm3 gene of the Thermus thermophilus HB27 genome in Example 1 of the present invention;

[0033] Figure 3 This is a western blot result of total protein of Thermus thermophilus HB27 genome csm3 gene with 10×His tag inserted in Example 1 of the present invention;

[0034] Figure 4 This is an agarose gel electrophoresis diagram of multiple monoclonal PCR verification of crtB gene knockout using three different endogenous CRISPR-Cas systems in Example 2 of the present invention;

[0035] Figure 5 This is a schematic diagram of the gene editing principle of inserting the SOD gene into the Thermus thermophilus HB27 genome in Example 3 of the present invention;

[0036] Figure 6 This is an agarose gel electrophoresis diagram of PCR verification of the SOD gene encoded by the engineered bacteria provided in Example 3 of the present invention inserted into the crtB gene site. DETAILED DESCRIPTION

[0037] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0038] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0039] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0040] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0041] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0042] The design principle of the present invention is as follows: Figure 1 As shown, the gene editing plasmid can use the endogenous CRISPR-Cas system to edit the Thermus thermophilus genome: the guide RNA guides the CRISPR-Cas effector protein to the target site based on the spacer sequence, and when the correct PAM sequence or flanking sequence is recognized, the double-stranded DNA breaks (DSBs) are mediated by the nuclease of the CRISPR-Cas system. When non-homologous end joining (NHEJ) and homology-directed repair (HDR) are performed in bacteria, the donor DNA will be used as a template to achieve precise genome editing. More specifically: the present invention uses the endogenous CRISPR-Cas system to edit the Thermus thermophilus genome, first determine the fragment to be edited, select the original spacer sequence, i.e., the target site, based on the PAM sequence and the flanking sequence; artificially synthesize or obtain the donor DNA by SOE-PCR amplification, construct the editing plasmid, and then transform the editing plasmid into Thermus thermophilus; pick a single clone, and detect the efficiency of gene editing at the target site by PCR amplification.

[0043] The technical solution of the present invention will be described in more detail below with reference to specific embodiments.

[0044] Example 1 Insertion mutation of Csm3 protein of Thermus thermophilus HB27 using III-A / B subtype CRISPR-Cas system

[0045] 1. Construction of editing plasmid

[0046] (1) The editing plasmid in the present invention is constructed on the basis of a mini-CRISPR plasmid containing a III-A / B subtype repeat sequence. The last 39 bases of the csm3 gene (TT_RS10655) in the Thermus thermophilus HB27 genome were selected as protospacer, and its reverse complementary sequence was 5'-CTAAAGGACCACTTCCTCCACCTTGAGCCTTTCCTTTAG-3', which has no TTC-PAM in front, and thus only has the DNA interference activity of the III-A / B subtype CRISPR.

[0047] Based on this protospacer, primers were designed: 1R-csm3his-F (nucleotide sequence: CGACCCTAAAGGACCACTTCCTCCACCTTGAGCCTTTCCTTTAG) and 1R-csm3his-R (nucleotide sequence: CAACCTAAAGGAAAGGCTCAAGGTGGAGGAAGTGGTCCTTTAGG), and the two primers were annealed to generate a spacer sequence fragment with sticky ends at both ends;

[0048] (2) The artificial mini-CRISPR vector pRKP31-AC1 was digested with BbsⅠ, and the digested product was ligated with the above-mentioned spacer sequence fragment using T4 DNA ligase at 22°C for 2 h, and then transformed into Escherichia coli DH5α to obtain a mini-CRISPR vector targeting the csm3 gene;

[0049] (3) Design two SOE-PCR primers containing ten histidine codons: 1Rpt-csm3inst-LR (nucleotide sequence: ATGATGATGGTGATGGTGATGGTGGTGATGAAGGACCACTTCCTCCACCTT) and 1Rpt-csm3inst-RF (nucleotide sequence: CATCACCACCATCACCATCACCATCATCATTAGGGGGCCTGGATGCGGGCGAC). Two primers with SalⅠ and NheⅠ restriction sites, respectively: 1Rpt-csm3instL-SalI-F (nucleotide sequence: GTAAGGGGATTGCGACCGCGATGAAGCTCAAGAAGGTGATCC) and csm3inst-R-NheI-R (nucleotide sequence: GATGGTGATGGTGATGGTGGTGGCGTAGGCGTTCGGCTCCTT). Use SOE-PCR to obtain the donor DNA fragment for homologous recombination;

[0050] (4) The donor DNA fragment and the above-mentioned mini-CRISPR plasmid were digested with SalⅠ and NheⅠ, respectively, and then Hieff The fragments were connected using the Plus One Step Cloning Kit and transformed into Escherichia coli DH5α to obtain the editing plasmid pRKP31-csm3his-Sp1-LR.

[0051] 2. Screening of mutant strains

[0052] When the OD of Thermus thermophilus HB27 (collected by the State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University) 600When the value was 0.8, 500 μL of bacterial solution was drawn, 1.2 ng of the edited plasmid was added to the bacterial solution, and after incubation at 65°C 180 r / min shaking for 2.5 hours, all the bacterial solution was spread on TB solid medium containing 30 mg / mL kanamycin. After incubation at 65°C for 24 hours, a single clone was obtained, and PCR was used to verify whether the SOD gene fragment was correctly inserted into the genome. The verification primers were csm10His-exm-F (nucleic acid sequence: TCCTCAGGGCCAAGCTCTTCTACAAC) and 10His-R (nucleic acid sequence: ATGATGGTGATGGTGATGGTGGTGATG), and the PCR verification product size was about 943 bp.

[0053] The results are as follows Figure 2 As shown, the genotype of the engineered strain is Csm3His-tagged. After multiple subcultures to obtain a homozygous strain, it was subcultured three times in an antibiotic-free medium to lose the edited plasmid, and the HB27Csm3-His insertion mutant strain was obtained. No antibiotics are required for the cultivation of this strain.

[0054] 3. Detection of His-tag fusion protein

[0055] The csm310xHis insertion mutant strain mediated by the III-A / B subtype system was collected, the bacteria were disrupted and the western blot experiment was performed using His primary antibody.

[0056] like Figure 3 As shown in the figure, the antibody cannot hybridize to obtain a 27kDa band in the wild-type total protein, but a clear Csm3 protein band can be obtained in the insertion mutant, and the positive control protein with a His tag also has a correct band. This result also proves that the 10×His tag is successfully inserted into the csm3 gene.

[0057] Example 2 Comparison of the knockout ability of the endogenous CRISPR-Cas system on the crtB gene of Thermus thermophilus

[0058] 1. Construction of mini-CRISPR plasmid targeting crtB gene

[0059] In the present invention, the crtB gene (TT_RS10425) is selected as the knockout gene in the Thermus thermophilus HB27 genome. Since the PAM sequence of the I-B and I-C type CRISPR-Cas systems is TTC, the 38 bp sequence after TTC is selected as the target and primers are designed: crtBsp23-F (nucleotide sequence: AAACCTGACCGACCTCGGCCCCGTGCGGCTCGGGACGGAGGC) and crtBsp23-R (nucleotide sequence: CAACGCCTCCGTCC CGAGCCGCACGGGGCCGAGGTCGGTCAG); a 40 bp sequence whose 5' flanking sequence is not complementary to the III-A / B subtype repeat sequence was selected as the target and primers were designed: crtBsp1-F (nucleotide sequence: CGACGCTCCGCCTCCGTCCCGAGCCGCACGGGGCCGAGGTCGGT) and crtBsp1-R (nucleotide sequence: CAACACCGACCTCGGCCCCGTGCGGCTCGGGACGGAGGCGGAGC). The forward primer and the reverse primer were mixed in equal amounts, incubated at 95°C for 10 minutes, cooled and annealed, and then ligated to the mini-CRISPR vector by enzyme to obtain a plasmid that can target the crtB gene.

[0060] 2. Construction of donor DNA for knocking out crtB gene

[0061] In the process of knocking out the crtB gene, the upstream and downstream sequences of the gene itself are used as templates for homologous recombination. When the CRISPR-Cas effector complex in the bacteria targets the target site according to the guide RNA, the Cas protein causes DNA breaks, and the donor DNA is used as a template for homologous recombination repair to obtain a precisely edited knockout strain. The principle is as follows Figure 1As shown. The primers for the donor DNA fragment of crtB gene knockout were designed as follows: the upstream fragment amplification primer for type I-B and I-C systems was KOCRTB-L-F23 (nucleotide sequence: GAGGATTGAAACCGCGTCGATAGGCGGCGAGCATGGCC) and the 3' end primer KOCRTB-LR (nucleotide sequence: CATAGCCTTATAGCCTGAGGACGCGGAGGAGGGCTTTCCAGTC); the upstream fragment amplification primer for type III-A and III-B systems was the 5' end primer KOCRTB-L-F1 (nucleotide sequence: GGGGATTGCGACCGC The downstream fragment amplification primers are 5' primer KOCRTB-RF (nucleotide sequence: CAAAGCCCCTTGCCGCTCAAGGCCTGGGAACGGGCCCTC) and 3' primer KOCRTB-RR (nucleotide sequence: GTGATGGTGATGGTGGCTAGGAAGCCCCGGGTCTTCCCG). The upstream and downstream fragments were amplified by PCR from the genomic DNA of Thermus thermophilus HB27 using a high-fidelity DNA polymerase. Through the following fusion PCR steps, the donor DNA fragment with a final length of 1400 bp was recovered by gel excision using a gel recovery kit.

[0062] Fusion PCR connected the upstream fragment and the downstream fragment, 1 μL of each upstream fragment and downstream fragment was used as a template, and the rest of the system was referred to the DNA polymerase instruction manual; the reaction program was 95°C for 10 min, (95°C for 15 s, 8°C for 15 s, 72°C for 90 s) for 28 cycles, 72°C for 5 min, and stored at 12°C. The PCR product was subjected to agarose gel electrophoresis to identify whether the band size was correct, and the gel was cut to recover the correct band (1400 bp).

[0063] 3. Construction of editing plasmid for knocking out crtB gene

[0064] The mini-CRISPR plasmid targeting the crtB gene was digested with restriction endonucleases SalⅠ and NheⅠ, and the donor DNA was connected to the mini-CRISPR plasmid using a seamless cloning kit to obtain an editing plasmid that knocked out the crtB gene.

[0065] 4. Plasmid transformation and acquisition of knockout strains

[0066] When the OD of Thermus thermophilus HB27 600When the value was 0.8, 500 μL of bacterial solution was drawn, 1.2 ng of the edited plasmid was added to the bacterial solution, and after incubation at 65°C 180 r / min shaking for 2.5 hours, all the bacterial solution was spread on TB solid medium containing 30 mg / mL kanamycin. After incubation at 65°C for 24 hours, a single clone was obtained, and PCR was used to verify whether the crtB gene fragment was knocked out. The verification primers were crtB-exm-F (nucleotide sequence: TTAAAGGCTCGGAAAGGACGGC) and crtB-exm-R (nucleotide sequence: GTAGAGGAGGTGGTAGGAGAAGTC). The PCR verification product size was about 1686 bp.

[0067] The results are as follows Figure 4 As shown, the knockout efficiency of the III-A / B system was 60% (12 / 20), the knockout efficiency of the I-C system was 95% (19 / 20), and the knockout efficiency of the I-B system was 100% (20 / 20). After multiple subculturing to obtain a homozygous strain, it was subculturated three times in an antibiotic-free medium to lose the edited plasmid, and the knockout strain HB27△crtB was obtained. No antibiotics are required for the culture of this strain.

[0068] Example 3: Obtaining Thermus thermophilus with high superoxide dismutase production using subtype IC CRISPR-Cas system

[0069] 1. Construction of mini-CRISPR plasmid targeting crtB gene

[0070] The editing plasmid in the present invention is constructed on the basis of a mini-CRISPR plasmid containing a subtype I-C repeat sequence. The crtB gene (TT_RS10425) was selected as the knockout gene on the Thermus thermophilus HB27 genome. Since the PAM sequence of the I-C type CRISPR-Cas system is TTC, the 38bp sequence after TTC was selected as the target and primers were designed: crtBsp23-F (nucleic acid sequence: AAACCTGACCGACCTCGGCCCCGTGCGGCTCGGGACGGAGGC) and crtBsp23-R (nucleic acid sequence: CAACGCCTCCGTCCCGAGCCGCACGGGGCCGAGGTCGGTCAG). The forward primer and the reverse primer were mixed in equal amounts and annealed, and then enzyme-linked to the mini-CRISPR vector to obtain a plasmid that can target the crtB gene.

[0071] 2. Obtaining the gene encoding superoxide dismutase

[0072] Using the genomic DNA of Thermus thermophilus HB27 as a template, a high-fidelity DNA polymerase (Vazyme P501-d1) was used to amplify the SOD protein encoding gene (TT_RS00960) according to the instructions: PCR amplification was performed using the 5' end primer SOD-F (nucleic acid sequence: AGGCTATAAGGCTATGGGGATCAGG) and the 3' end primer SOD-R (nucleic acid sequence: GCGGCAAGGGGCTTTGTGAGGAAG) to obtain the SOD gene encoding DNA sequence (709 bp).

[0073] 3. Construction of donor DNA that knocks out the crtB gene and inserts the SOD gene

[0074] In the process of knocking out the crtB gene, the upstream and downstream sequences of the gene itself are used as templates for homologous recombination. When the CRISPR-Cas effector complex in the bacteria targets the target site according to the guide RNA, the Cas protein causes DNA breaks, and the donor DNA is used as a template for homologous recombination repair to obtain a precisely edited knockout strain. The principle is as follows Figure 5 shown.

[0075] The primers for the donor DNA fragment for crtB gene knockout were designed as follows:

[0076] The primers for upstream fragment amplification are 5' primer KOCRTB-LF (nucleotide sequence: GAGGATTGAAACCGCGTCGATGCTCCTCCGCCACCCCGATCT) and 3' primer KOCRTB-LR (nucleotide sequence: CATAGCCTTATAGCCTGAGGACGCGGAGGAGGGCTTTCCAGTC); the primers for downstream fragment amplification are 5' primer KOCRTB-RF (nucleotide sequence: CAAAGCCCCTTGCCGCTCAAGGCCTGGGAACGGGCCCTC) and 3' primer KOCRTB-RR (nucleotide sequence: GTGATGGTGATGGTGGCTAGGAAGCCCCGGGTCTTCCCG). The upstream and downstream fragments were obtained by PCR amplification from the genomic DNA of Thermus thermophilus HB27 using high-fidelity DNA polymerase (Vazyme P501-d1). Through the following fusion PCR steps, the donor DNA fragment with a final length of 2058 bp was recovered by gel excision using a gel recovery kit.

[0077] In the first step of fusion PCR, the upstream fragment and the SOD gene fragment were connected. 1 μL of each of the upstream fragment and the SOD gene fragment was used as a template. The rest of the system was referred to the DNA polymerase manual. The reaction procedure was 95°C for 10 min, (95°C for 15 s, 58°C for 15 s, 72°C for 90 s) for 28 cycles, 72°C for 5 min, and stored at 12°C. The PCR product was subjected to agarose gel electrophoresis to identify whether the band size was correct, and the gel was cut to recover the correct band. In the second step of fusion PCR, the fused fragment and the downstream fragment were connected again. 1 μL of each of the fused fragment and the downstream fragment was used as a template. The rest of the system was referred to the DNA polymerase manual. The reaction procedure was 95°C for 10 min, (95°C for 15 s, 56°C for 15 s, 72°C for 2 min) for 28 cycles, 72°C for 5 min, and stored at 12°C. The PCR product was subjected to agarose gel electrophoresis to identify whether the band size was correct, and the gel was cut to recover the correct band (2058 bp).

[0078] 3. Construction of editing plasmid for knocking out crtB gene and inserting SOD gene

[0079] The mini-CRISPR plasmid targeting the crtB gene was digested with restriction endonucleases SalⅠ and NheⅠ, and the donor DNA was connected to the mini-CRISPR plasmid using a seamless cloning kit to obtain an editing plasmid with the crtB gene knocked out and the SOD gene inserted.

[0080] 4. Plasmid transformation and acquisition of engineered strains

[0081] When the OD of Thermus thermophilus HB27 600 When the value is 0.8, 500 μL of bacterial solution was drawn, 1.2 ng of the edited plasmid was added to the bacterial solution, and after incubation at 65°C 180 r / min shaking for 2.5 hours, all the bacterial solution was spread on TB solid culture medium containing 30 mg / mL kanamycin. After incubation at 65°C for 24 hours, a single clone was obtained, and PCR was used to verify whether the SOD gene fragment was correctly inserted into the genome. The verification primers were crtB-exm-F (nucleotide sequence: TTAAAGGCTCGGAAAGGACGGC) and SOD-R (nucleotide sequence: GCGGCAAGGGGCTTTGTGAGGAAG), and the PCR verification product size was about 1543 bp. The results are as follows Figure 6 As shown, the genotype of the engineered strain is △crtB::TTRS00960. After multiple subcultures to obtain a homozygous strain, it was subcultured three times in an antibiotic-free medium to lose the edited plasmid, and the engineered strain HB27△crtB::TTRS00960 was obtained. No antibiotics are required for the culture of this strain.

[0082] Example 4 Method for producing superoxide dismutase using high-yield superoxide dismutase engineered strains

[0083] 1. Fermentation production of superoxide dismutase by the engineered strain Thermus thermophilus HB27△crtB::TTRS00960

[0084] (1) Preparation of culture medium

[0085] The solvent is single distilled water, and the solutes and their final concentrations are: 8g / L peptone, 4g / L yeast extract, 3g / L sodium chloride, 367mg / L sodium bicarbonate, 31.34mg / L magnesium sulfate, 0.95mg / L potassium chloride, 36.75mg / L calcium chloride dihydrate, 150.44mg / L magnesium chloride hexahydrate. The pH value of the culture medium is 7.5, and it is sterilized at 115°C for 20min.

[0086] (2) Seed solution preparation and shake flask fermentation

[0087] The engineered strain HB27△crtB::TTRS00960 was activated and cultured in liquid medium at 65°C and 200 rpm for 12 h to obtain the OD 600 It is a seed liquid of about 2.5.

[0088] The obtained seed liquid was inoculated into liquid culture medium at a ratio of 4%, and the culture was fermented in a shake flask until OD 600 It is about 0.8.

[0089] (3) Detection of superoxide dismutase

[0090] The fermentation liquid in step 2 was collected, centrifuged at 5000g for 15 minutes, and the cells were collected; the cells were resuspended in PBS buffer, ultrasonically disrupted (intermittent ultrasonication, each ultrasonication for 1 second), and centrifuged at 13000g for 30 minutes, and the supernatant was collected, which was the crude enzyme solution containing superoxide dismutase. Finally, the superoxide dismutase activity of the crude enzyme solution was detected.

[0091] The above-mentioned superoxide dismutase (SOD) enzyme activity detection method is as follows:

[0092] (1) One standard enzyme activity (U) of superoxide dismutase is defined as the SOD enzyme activity in the reaction system when the inhibition percentage in the above xanthine oxidase coupled reaction system is 50% at 37°C.

[0093] (2) Prepare the following reagents

[0094] PBS buffer: weigh 8.0g NaCl, 0.2g KCl, 1.44g Na2HPO4, and 0.24g KH2PO4 and dissolve them in 800mL distilled water. Adjust the solution to pH 7.4 with HCl, and finally add distilled water to make up to 1L.

[0095] Other reagents: all from Biosharp Total SOD Activity Detection Kit (WST-1 method) (BL903A).

[0096] (3) Superoxide dismutase activity detection method: according to the instructions of Biosharp Total SOD Activity Detection Kit (WST-1 method) (BL903A).

[0097] The activity of superoxide dismutase in the fermentation supernatant to be tested was calculated according to the following formula:

[0098]

[0099]

[0100] In the above formula, A is the absorbance reading measured at a wavelength of 450nm.

[0101] 2. Production of superoxide dismutase by fermentation of control bacteria

[0102] The method of (1)-(3) in step 1 is followed, except that the engineered strain HB27ΔcrtB::TTRS00960 is replaced by the wild-type strain Thermus thermophilus HB27.

[0103] 3. Results

[0104] Table 1 OD of bacteria 600 Results of superoxide dismutase activity in fermentation broth

[0105]

[0106] like Figure 1 As shown, the specific enzyme activity of superoxide dismutase produced by the engineered strain HB27△crtB::TTRS00960 was significantly higher than that of the wild-type control strain.

[0107] Example 5 Method for producing superoxide dismutase using high-yield superoxide dismutase engineered strains

[0108] 1. Fermentation production of superoxide dismutase by the engineered strain Thermus thermophilus HB27△crtB::TTRS00960

[0109] (1) Preparation of culture medium

[0110] The solvent is single distilled water, and the solutes and their final concentrations are: 8g / L peptone, 4g / L yeast extract, 3g / L sodium chloride, 367mg / L sodium bicarbonate, 31.34mg / L magnesium sulfate, 0.95mg / L potassium chloride, 36.75mg / L calcium chloride dihydrate, 150.44mg / L magnesium chloride hexahydrate. The pH value of the culture medium is 7.5, and it is sterilized at 115°C for 20min.

[0111] (2) Seed solution preparation and shake flask fermentation

[0112] The engineered strain HB27△crtB::TTRS00960 was activated and cultured in liquid medium at 65°C and 200 rpm for 12 hours to obtain the OD 600 It is a seed liquid of about 2.5.

[0113] The obtained seed liquid was inoculated into liquid culture medium at a ratio of 4%, and the culture was fermented in a shake flask until OD 600 It is about 1.0.

[0114] (3) Detection of superoxide dismutase

[0115] The fermentation broth in step 2 was collected, centrifuged at 5000 g for 15 minutes, and the cells were collected; the cells were resuspended in PBS buffer, ultrasonically disrupted (intermittently ultrasonicated, each ultrasonic treatment lasted for 1 s), and centrifuged at 13000 g for 30 minutes, and the supernatant was collected, which was a crude enzyme solution containing superoxide dismutase. Finally, the superoxide dismutase activity of the crude enzyme solution was detected (same as in Example 4).

[0116] 2. Production of superoxide dismutase by fermentation of control bacteria

[0117] The method of (1)-(3) in step 1 is followed, except that the engineered strain HB27ΔcrtB::TTRS00960 is replaced by the wild-type strain Thermus thermophilus HB27.

[0118] 3. Results

[0119] Table 2 OD of bacteria 600 Results of superoxide dismutase activity in fermentation broth

[0120]

[0121] As shown in Table 2, it can be seen that the specific enzyme activity of superoxide dismutase produced by the engineered bacteria HB27△crtB::TTRS00960 is significantly higher than that of the wild-type control bacteria.

[0122] Example 6 Method for producing superoxide dismutase using high-yield superoxide dismutase engineered strains

[0123] 1. Fermentation production of superoxide dismutase by the engineered strain Thermus thermophilus HB27△crtB::TTRS00960

[0124] (1) Preparation of culture medium

[0125] The solvent is single distilled water, and the solutes and their final concentrations are: 8g / L peptone, 4g / L yeast extract, 3g / L sodium chloride, 367mg / L sodium bicarbonate, 31.34mg / L magnesium sulfate, 0.95mg / L potassium chloride, 36.75mg / L calcium chloride dihydrate, 150.44mg / L magnesium chloride hexahydrate. The pH value of the culture medium is 7.5, and it is sterilized at 115°C for 20min.

[0126] (2) Seed solution preparation and shake flask fermentation

[0127] The engineered strain HB27△crtB::TTRS00960 was activated and cultured in liquid medium at 65°C and 200 rpm for 12 hours to obtain the OD 600 It is a seed liquid of about 2.5.

[0128] The obtained seed liquid was inoculated into liquid culture medium at a ratio of 4%, and the culture was fermented in a shake flask until OD 600 It is about 1.2.

[0129] (3) Detection of superoxide dismutase

[0130] The fermentation liquid in step 2 was collected, centrifuged at 5000g for 15 minutes, and the cells were collected; the cells were resuspended in PBS buffer, ultrasonically disrupted (intermittent ultrasonication, each ultrasonication for 1s), and centrifuged at 13000g for 30min, and the supernatant was collected, which was the crude enzyme solution containing superoxide dismutase. Finally, the superoxide dismutase activity of the crude enzyme solution was detected.

[0131] 2. Production of superoxide dismutase by fermentation of control bacteria

[0132] The method of (1)-(3) in step 1 is followed, except that the engineered strain HB27ΔcrtB::TTRS00960 is replaced by the wild-type strain Thermus thermophilus HB27.

[0133] 3. Results

[0134] Table 3 OD of bacteria 600 Results of superoxide dismutase activity in fermentation broth

[0135]

[0136] As shown in Table 3, the specific enzyme activity of superoxide dismutase produced by the engineered bacteria HB27△crtB::TTRS00960 was significantly higher than that of the wild-type control bacteria.

[0137] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A Thermus thermophilus gene editing plasmid, characterized in that: The gene editing plasmid includes the following gene structure: 5'-promoter-repeat sequence-spacer sequence-repeat sequence-donor DNA-3'; wherein the repeat sequence is derived from the CRISPR-Cas system of subtype I-B, subtype I-C or subtype III-A / B on the Thermus thermophilus genome; the spacer sequence is a target fragment; The repeat sequence derived from the CRISP-Cas system on the Thermus thermophilus subtype I-B genome is: 5′-GTTGCAAACCTCGTTAGCCTCGTAGAGGATTGAAAC-3′; The repeat sequence derived from the Ⅰ-C subtype CRISPR-Cas system on the Thermus thermophilus genome is: 5′-GTTGCACCGGCCCGAAAGGG CCGGTGAGGA TTGAAAC-3′; The repeat sequence derived from the III-A and III-B subtype CRISPR-Cas systems on the Thermus thermophilus genome is: 5'-GTTGCAAGGG ATTGAACCCC GTAAGGGGAT TGCGAC-3'.

2. The Thermus thermophilus gene editing plasmid according to claim 1, characterized in that The spacer sequence is a sequence of 38-40 bp in length adjacent to the PAM sequence.

3. The Thermus thermophilus gene editing plasmid according to claim 2, characterized in that The PAM sequence of subtypes Ⅰ-B and Ⅰ-C is 5'-TTC-3'.

4. The Thermus thermophilus gene editing plasmid according to claim 2, characterized in that When the 3' flanking sequence of the target site does not match the 5' repeat sequence of crRNA, Cas proteins of subtypes III-A and III-B have DNA cleavage activity.

5. The Thermus thermophilus gene editing plasmid according to claim 1, characterized in that The promoter is a constitutive promoter of Thermus thermophilus; the donor DNA is a genomic DNA sequence or fragment of Thermus thermophilus HB27.

6. An engineered strain, characterized in that: Comprising the Thermus thermophilus gene editing plasmid according to any one of claims 1 to 5.

7. Use of the Thermus thermophilus gene editing plasmid according to any one of claims 1 to 5 or the engineered strain according to claim 6 in the production of superoxide dismutase.

8. A method for producing superoxide dismutase, characterized in that: The method comprises transferring the gene editing plasmid described in claim 1 into Thermus thermophilus, knocking out the crtB gene of Thermus thermophilus and inserting a gene encoding SOD to construct an engineered Thermus thermophilus; Then, the thermophilic thermophilic engineered bacteria is cultured by liquid fermentation until the OD of the thermophilic thermophilic engineered bacteria reaches 0. 600 When the pH value is 0.8-1.2, the fermentation is terminated and superoxide dismutase is obtained.

9. The method according to claim 8, characterized in that During liquid fermentation culture, the liquid fermentation medium used includes components in the following concentrations: 8 g / L peptone, 4 g / L yeast extract, 3 g / L sodium chloride, 367 mg / L sodium bicarbonate, 31.34 mg / L magnesium sulfate, 0.95 mg / L potassium chloride, 36.75 mg / L calcium chloride dihydrate and 150.44 mg / L magnesium chloride hexahydrate, and the pH value is 7.5.

Images