Gene expression vector pJXNU for actinomyces and construction method and application thereof
By constructing the actinomycete gene expression vector pJXNU containing constitutive and inducible promoters, the problem of low gene expression efficiency in actinomycetes has been solved, achieving efficient and controllable gene expression, which is suitable for the study of various actinomycete strains and the synthesis of secondary metabolites.
Patent Information
- Application Number
- CN202210869300.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-22
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2042-07-22
AI Technical Summary
The lack of effective gene expression vectors for actinomycetes in the current technology leads to low gene expression efficiency in actinomycetes, making it difficult to conduct efficient functional gene research and biosynthesis of secondary metabolites.
A gene expression vector pJXNU for actinomycetes was designed and constructed, containing constitutive strong promoters GE-1 and GE-2 and a Thio inducible promoter GE-3, combined with multiple restriction endonuclease sites to achieve efficient and controllable gene expression, which was verified by cloning the reporter gene mcbB.
It significantly improves the efficiency of gene expression in actinomycetes, especially the initiation efficiency of GE-1 and GE-2 is higher than that of conventional promoters, and GE-3 can be expressed in a controlled manner in the presence of an inducer. It is suitable for gene expression studies of a variety of actinomycete strains.
Smart Images

Figure CN115927431B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial genetic engineering, specifically relating to a tool plasmid (vector) for actinomycetes containing three gene expression elements (two autonomously expressed and one inducible), and the application of this vector in heterologous expression of the Beta-carboline alkaloid marinacarboline biosynthetic gene cluster mcb. Background Technology
[0002] Actinomycete cells contain a large number of genes and gene clusters for the biosynthesis of secondary metabolites. These genes (clusters) can be cloned using efficient gene expression vectors and introduced in situ into the strain's own cells, or into engineered chassis cells with a solid research foundation, minimal fermentation interference, and clear detection background. This allows for the discovery of corresponding active secondary metabolites and the construction of production strains for these products, which can be used for subsequent research on biosynthetic mechanisms, metabolic engineering, and synthetic biology development.
[0003] By using high-quality plasmids and carefully designed gene expression elements to construct vectors, and then validating them using reporter genes and host bacteria, efficient gene expression vectors for actinomycetes can be created. These vectors can be applied to the research and development of actinomycetes, promoting the comprehensive utilization of actinomycete resources. Summary of the Invention
[0004] The purpose of this invention is to overcome the current lack of effective gene expression vectors for actinomycetes and to provide a gene expression vector pJXNU for actinomycetes, its construction method, and its application.
[0005] In this invention, kanamycin (Kan) and thiostrepton (Thio) resistance markers (Kan) were first added to the pSET152 plasmid (NCBI accession No. AJ414670.1; Bierman M, et al. 1992, 116(1):43-49). R and Thio R This invention aims to construct a tool plasmid with triple resistance selection markers, thereby achieving its first objective. The Kan resistance gene is derived from the SuperCosI plasmid (Agilent Technologies), while the Thio resistance gene is derived from pIJ6021 (NCBI accession No. AJ414669.1). The resistance gene fragment (including the upstream promoter and RBS) was amplified using molecular cloning technology and then cloned into pSET152 via the NheI site. This first constructs a plasmid containing Apr... R and Kan RThe plasmid pSET152K, which is a dual-resistance marker, was further modified by adding Thio. R Genes were used to construct the final plasmid pSET152KT with triple resistance markers. Figure 4 ).
[0006] After completing the optimization of the resistance marker, this invention further designed a gene expression element sequence. The DNA sequence is approximately 533 bp in length (as shown in SEQ ID NO.1) and contains three gene expression elements (GE): GE-1, which is composed of the constitutive strong promoter kasOp* and the RBS sequence SR40; GE-2, which is composed of the constitutive strong promoter SP43 and Rjn2, which is modified based on the RBS sequence SR19; and GE-3, which is an inducible gene expression element composed of the Thio inducible promoter tipAp and Rjn1, which is modified based on its natural tipA RBS sequence (Bai C, et al. 2015, 112(39): 12181-12186; Takano E, et al. 1995, 166(1): 133-137). Figure 4-6 Rjn1 and Rjn2 are two newly designed RBS sequences in this invention. The former replaces the six "ATAAGT" bases at the end of the SR19 sequence with the SpeI restriction endonuclease recognition site "ACTAGT"; the latter replaces the six "GGACAT" bases at the end of the upstream RBS sequence of the tipA gene with the BamHI restriction endonuclease recognition site "GGATCC". This design creates two RBS sequences with different restriction endonuclease recognition sites at their ends, making them directly applicable to gene cloning. Figure 5-6 Of the three gene expression elements mentioned above, GE-1 is designed as the most frequently used element, located downstream of the fragment. An NdeI site is designed at the end of its RBS sequence, forming the MCS1 sequence with the upstream HpaI, NotI, and NsiI restriction sites. GE-2 and the inducible gene expression element GE-3 are located upstream of the fragment, facing each other, with an MCS2 sequence composed of BamHI, KpnI, and SpeI in between. A 133bp spacer sequence is designed between GE-1 and MCS1 and GE-2. The entire fragment can be cloned into pSET152KT via the upstream XbaI and downstream EcoRV sites, thereby achieving the first objective of this invention, namely, constructing the target vector pJXNU. Figure 4-6 ).
[0007] After constructing the vector, it is necessary to verify the efficiency of the gene expression element, i.e., to select a reporter gene to validate the function of the vector. Because the gene expression element contains a promoter and RBS sequence, quantitative analysis of the biological activity of the corresponding functional protein or enzyme from the reporter gene is required to accurately and reliably reflect the efficacy of the gene expression element and the final vector efficacy. This invention selects the PS enzyme encoding gene mcbB as a reporter gene. The product McbB encoded by this gene can catalyze the condensation of tryptophan and methylglyoxal via the Pictet-Spengler reaction to form 1-acety-3-carboxy-β-carboline. This product has a typical 6 / 5 / 6 indolepyridine structure. The above product can be extracted from actinomycete cells containing the mcbB gene and successfully expressing the PS enzyme McbB. The content can be detected and analyzed by HPLC at 275 nm to calculate the content, and the catalytic efficiency of mcbB expression product-PS enzyme can be quantitatively analyzed. In addition, the utility of the corresponding gene expression element can be quantitatively evaluated (Chen, et al. 2013, 52(38): 9980-9984; Takahiro, et al. 2015, 22(7): 898-906). Figure 3Based on the above design, this invention clones mcbB into three gene expression elements on the vector using two sets of MCS sites, respectively, constructing three different clones: the validation plasmid pJXNU-mcbB-GE-1 for element GE-1; the plasmid pJXNU-mcbB-GE-2 for validating element GE-2; and the plasmid pJXNU-mcbB-GE-3 for validating element GE-3. Then, the above three plasmids were introduced into the engineered actinomycete strain *Streptomyces coelicolor* M1152 for gene expression, and three corresponding validation strains were constructed: *S. coelicolor* M1152::mcbB / GE-1, *S. coelicolor* M1152::mcbB / GE-2, and *S. coelicolor* M1152::mcbB / GE-3. Simultaneously, the *mcbB* gene was cloned using the conventional pSET152AKE plasmid containing the *ermEp* promoter element (Ma, et al. 2011, 50(34):7797-7802; Xie, et al. 2012, 13(18):2745-2757), and pSET152AKE-mcbB was constructed as a positive control reference. This pSET152AKE plasmid was then introduced into *S. coelicolor* M1152 for gene expression to construct the control mutant strain *S. coelicolor*. M1152::mcbB / AKE; In addition, the empty vectors pJXNU and pSET152AKE (without any cloned genes) were simultaneously introduced into *S. coelicolor* M1152 to construct corresponding negative control reference strains *S. coelicolorM1152::pSET152AKE* and *S. coelicolorM1152::pJXNU*, in order to analyze the effect of the vectors on the strain background. Subsequently, the above strains were fermented, and the 1-acety-3-carboxy-β-carboline product was extracted from the above six engineered strains, including the control. After proportional dilution and HPLC quantitative analysis, the production potency of 1-acety-3-carboxy-β-carboline in *S. coelicolorM1152::mcbB / GE-1* and *S. coelicolorM1152::mcbB / GE-2* was found to be 21.3±0.25 mg / L and 19.6±0.31 mg / L, respectively. Figure 7 The potency of 1-acety-3-carboxy-β-carboline in strains 2 and 3 (Courses 2 and 3) was significantly higher than that in the control strain S. coelicolorM1152::mcbB / AKE (5.7 ± 0.09 mg / L). Figure 7The efficiency of GE-1 was approximately 3.7 times that of conventional elements containing ermEp*, and the efficiency of GE-2 was 3.4 times that of conventional elements containing ermEp*. This result indicates that the GE-1 and GE-2 elements on the vector are highly effective, with gene expression initiation efficiency far exceeding that of commonly used gene expression elements containing ermEp*, demonstrating significant application value. However, the analysis results of S. coelicolor M1152::mcbB / GE-3 showed significant differences between the absence of the inducer Thio and the presence of 5 μmol / L Thio; the former showed no significant production of 1-acety-3-carboxy-β-carboline (…). Figure 7 (Course 4), the latter's production potency was basically the same as the control strain, approximately 6.2 ± 0.04 mg / L ( Figure 7 (Section 5) indicates that GE-3, as an inducible gene expression element, did not show significant leakage expression in the absence of the inducer Thio, but achieved the initiation efficiency of conventional ermEp*-type gene expression elements in the presence of 5 μmol / L Thio, demonstrating good application performance. In the above tests, strains *S. coelicolor* M1152::pSET152AKE* and *S. coelicolor* M1152::pJXNU containing empty vectors pSET152AKE and pJXNU (without any cloned genes) were selected as negative controls. No 1-acety-3-carboxy-β-carboline signal was detected in the tests. Figure 7 (Questions 6 and 7) Combined with positive control results, the above verification test results for GE-1 to GE-3 are true and reliable. The GE-2 initiation efficiency containing the newly designed RBS site Rjn1 is comparable to that of GE-1, which is composed of the constitutive strong promoter kasOp* and the RBS sequence SR40. The GE-3 element containing the tipAp promoter with the newly designed RBS site Rjn2 can also fully exert the Thio-induced expression effect. In summary, the pJXNU constructed in this invention can exert excellent gene expression efficacy in Streptomyces represented by S. coelicolor M1152, realizing integrated cloning and expression of the target gene.
[0008] Actinomycetes are mainly divided into two types: Streptomyces and rare actinomycetes. After completing the validation work on Streptomyces, namely S. coelicolor M1152, this invention selected two rare actinomycetes as hosts to conduct vector efficacy validation. These two rare actinomycetes are *Actinoalloteichus* sp. AHMUCJ021 (CCTCC M 2018157; Xie, et al. 2020, 19:159) and *Kitasatospora setae* NBRC 14216. T(Aroonsri, et al. 2012, 114(1): 56-58), all of which have been deposited in authoritative depository institutions. Similarly, clones of mcbB at three different sites on pJXNU: pJXNU-mcbB-GE-1, pJXNU-mcbB-GE-2, pJXNU-mcbB-GE-3, and pSET52AKE-mcbB, pSET152AKE and pJXNU empty vector plasmids were introduced into the above two rare actinomycetes to construct corresponding validation strains, and further 1-acety-3-carboxy-β-carboline tracking analysis was performed. Subsequent analysis found that the validation strains containing pSET152AKE and pJXNU empty vector plasmids also did not have any detectable 1-acety-3-carboxy-β-carboline product signal ( Figure 8 A, the f and gth passages; Figure 8 B, channels vi and vii), indicates that the vector also has no background interference in rare actinomycetes.
[0009] In the analysis of 1-acety-3-carboxy-β-carboline production in *Actinoalloteichus* sp. AHMUCJ021 as the host, the control strain AHMUCJ021::mcbB / AKE containing pSET152AKE-mcbB had a concentration of 5.3 ± 0.01 mg / L, which was roughly equivalent to its expression intensity in the model *Streptomyces coelicolor* M1152. Figure 8 A, the a). Among the three gene expression element validation strains, the GE-1 validation strain AHMUCJ021::mcbB / GE-1 was 3.1 times that of the control, approximately 16.4 ± 0.21 mg / L ( Figure 8 A, lane b); the GE-2 validation strain AHMUCJ021::mcbB / GE-2 was 4.2 times that of the control, approximately 21.3 ± 0.46 mg / L. Figure 8 A, lane c); GE-3 validation strain AHMUCJ021::mcbB / GE-3 showed almost no significant product formation without Thio induction, but the product concentration was consistent with the control at 5 μmol / L Thio, reaching 5.3 ± 0.05 mg / L. Figure 8 A, lanes d and e). And in K.setae NBRC 14216 T The validation results were basically consistent with the previous two strains, with the yield of the control strain containing pSET152AKE-mcbB being 4.9 ± 0.01 mg / L. Figure 8B, i); Among the three gene expression element verification strains, the product titers of GE-1 and GE-2 in the verification strains NBRC 14216::mcbB / GE-1 and NBRC 14216::mcbB / GE-2 were also significantly higher than those of the control strain, approximately 4.4 times and 3.9 times that of the control strain, respectively, with specific values of 21.6±0.51 mg / L and 19.1±0.42 mg / L. Figure 8 B, channels ii and iii). The validation strain NBRC 14216::mcbB / GE-3 for GE-3 also produced no product without Thio, and similarly achieved the same gene expression element activation effect as the control under 5 μmol / L Thio induction, obtaining a target product titer of 4.9 ± 0.06 mg / L. Figure 8 B, IV, V). It can be seen that the pJXNU vector designed and constructed in this invention can also exert its effects in rare actinomycetes. Its GE-1 and GE-2 are significantly superior to commonly used ermEp* promoter elements, and GE-3 can exert Thio-induced expression regulation effects, realizing the controllable expression of functional genes.
[0010] Therefore, the first objective of this invention is to provide a method for constructing a gene expression vector pJXNU for actinomycetes, comprising the following steps:
[0011] (1) The pSET152 plasmid was treated with NheI to obtain the linearized plasmid fragment pSET152-NheI;
[0012] (2) Using SuperCosI plasmid as a template, amplify Kan R Fragments, using homologous recombination, to transform Kan R The target plasmid pSET152K was obtained by cloning into pSET152-NheI.
[0013] (3) Process pSET152K with NheI to obtain the linearized fragment pSET152K-NheI;
[0014] (4) Using pIJ6021 plasmid as a template, amplify Thio R Fragments, using homologous recombination, Thio R The target plasmid pSET152KT was obtained by cloning into pSET152-NheI.
[0015] (5) Synthesize the gene expression element sequence as shown in SEQ ID NO.1, process the gene expression element and pSET152KT plasmid with the combination of EcoRV and XbaI respectively, and ligate the digested fragments to obtain the target vector pJXNU.
[0016] Preferably, in step (2), the Kan is amplified. R The primers for the fragment are 152KanIn-Fr:5'-ATCGGGCCCTGGCCAGCTAGCtggtaaggttgggaagccct-3' and 152KanIn-Re:5'-TGCAGGTCGACTCTAGCTAGtcagaagaactcgtcaagaag-3';
[0017] Preferably, in step (4), Thio is amplified. R The primers for the fragment are 152ThioIn-Fr:5'-ATCGGGCCCTGGCCAG CTAGCggggatcgaccgcgcgggtc-3' and 152ThioIn-Re:5'-TTCCCAACCTTACCAGCTAGttatcggttg gccgcgagat-3'.
[0018] A second objective of this invention is to provide a gene expression vector pJXNU for actinomycetes constructed according to the above-described construction method.
[0019] Preferably, the nucleotide sequence of the vector pJXNU is shown in SEQ ID NO.2.
[0020] A third objective of this invention is to provide a bacterium containing the aforementioned expression vector pJXNU.
[0021] Preferably, the bacteria are actinomycetes.
[0022] A fourth objective of this invention is to provide the application of the above-mentioned expression vector pJXNU in actinomycete gene expression.
[0023] The fifth objective of this invention is to provide the above-mentioned expression vector pJXNU in Beta-carboline alkaloids.
[0024] Application of the 1-acety-3-carboxy-β-carboline biosynthetic gene cluster mcb in heterologous expression.
[0025] Preferably, the expression vector pJXNU described above is used for heterologous expression of the Beta-carboline alkaloid 1-acety-3-carboxy-β-carboline biosynthetic gene cluster mcb in actinomycetes.
[0026] Compared with the prior art, the present invention has the following beneficial effects:
[0027] This invention designs and constructs a tool vector, pJXNU, for efficient gene expression in actinomycetes. This vector contains two gene expression elements, GE-1 and GE-2, which are superior to conventional ermEp* promoter elements, as well as a controllable gene expression element, GE-3, which is induced by Thio. This allows for autonomous, efficient, and controllable gene expression within a single vector. The vector also contains two sets of MCS sites, providing a variety of suitable gene cloning options. Therefore, the pJXNU vector designed and constructed in this invention has promising applications in the study of functional genes in actinomycetes and can provide a good starting plasmid and theoretical reference for the design and optimization of similar vectors in the future. Attached Figure Description
[0028] Figure 1 This is a diagram of the pSET152 plasmid.
[0029] Figure 2 This is a schematic diagram of the structure of gene expression elements in actinomycetes and the design of the RBS region.
[0030] Figure 3 This is a schematic diagram of the reporter gene (cluster) circuit.
[0031] Figure 4 This is a flowchart of the pJXNU build process.
[0032] Figure 5 It is a diagram of the structure of gene expression elements.
[0033] Figure 6 It is a sequence diagram of gene expression elements.
[0034] Figure 7 This study validated the functional efficiency of the pJXNU gene expression element in S. coelicolor M1152 using the reporter gene mcbB. Specifically, it analyzed the differences in the content of the McbB biocatalytic reaction product 1-acety-3-carboxy-β-carboline in each strain using HPLC. The strain information corresponding to each channel is as follows: 1. S. coelicolor M1152::mcbB / AKE, 2. S. coelicolor M1152::mcbB / GE-1, 3. S. coelicolor M1152::mcbB / GE-2, 4. S. coelicolor M1152::mcbB / GE-3, 5. S. coelicolor M1152::mcbB / GE-3 with 5 μmol / L Thio added, 6. S. coelicolor M1152::pSET152AKE, 7. S. coelicolor M1152::pJXNU. The dashed line in the figure corresponds to the detection signal of 1-acety-3-carboxy-β-carboline.
[0035] Figure 8 The reporter gene mcbB was used to target the expression element of the pJXNU gene in the rare actinomycetes *Actinoalloteichus* sp. AHMUCJ021(A) and *Kitasatospora setae* NBRC 14216. T (B) Functional validation was performed, i.e., HPLC analysis of the differences in the content of 1-acety-3-carboxy-β-carboline, the product of the McbB biocatalytic reaction, in each strain. The strain information corresponding to each channel is as follows: (A) a AHMUCJ021::mcbB / AKE, b AHMUCJ021::mcbB / GE-1, c AHMUCJ021::mcbB / GE-2, d AHMUCJ021::mcbB / GE-3, e AHMUCJ021::mcbB / GE-3 with 5 μmol / L Thio added, f AHMUCJ021::pSET152AKE, g AHMUCJ021::pJXNU; (B) iNBRC 14216::mcbB / AKE, bNBRC 14216::mcbB / GE-1, c NBRC 14216::mcbB / GE-2, d NBRC 14216::mcbB / GE-3, e NBRC14216::mcbB / GE-3 with 5 μmol / L Thio added, fNBRC 14216::pSET152AKE, gNBRC 14216::pJXNU. The solid black dots in the figure correspond to the detection signals of 1-acety-3-carboxy-β-carboline. Detailed Implementation
[0036] The following embodiments are further illustrations of the present invention, but not limitations thereof.
[0037] The design and construction of actinomycete gene expression vectors require the use of good starter (originating) plasmids or backbone (mother) plasmids. The vectors of this invention are constructed using the pSET152 plasmid (NCBI accession No. AJ414670.1; Bierman M, et al. 1992, 116(1):43-49) as the starter or mother plasmid. The pSET152 plasmid can be found in [link to pSET152]. Figure 1 As shown, it carries the aprmycin resistance gene aac(3)IV, and has Apr resistance (Apr... R ).
[0038] Besides a suitable initiator or parent plasmid, another crucial step in designing and constructing actinomycete gene expression vectors is the design of efficient gene expression elements. Actinomycete gene expression elements typically contain two main functional regions: the promoter (P) and the ribosome binding site (RBS). These are generally divided by the transcriptional start site (TSS), creating an upstream transcription initiation region and a downstream ribosome binding (site) region. The actinomycete promoter contains two important functional regions: the -35 and -10 regions. The former is primarily the σ-factor binding region, responsible for RNA polymerase recognition and binding to the target promoter; the latter has a higher A / T base content and is mainly the first region where RNA polymerase unwinds after binding to the promoter, promoting transcription initiation. The most important sequence segment on the actinomycete ribosome binding site is the Shine-Dalgarno sequence, abbreviated as SD sequence (SD). Figure 2 The SD sequence is a purine-rich region located 6-8 bp upstream of the start codon on mRNA post-transcriptionally. It binds complementary to a pyrimidine-rich region at the 3' end of the 16S rRNA on the 30S small subunit of the ribosome, promoting translation initiation. The 6-8 bp spacer region between the SD sequence and the start codon is also crucial; its sequence composition and length are fundamental to translation efficiency. This region is frequently used to design restriction endonuclease recognition sites for functional gene cloning. The design of these recognition sites must be as consistent as possible with the original sequence, avoiding significant alterations, otherwise translation efficiency will be severely affected, or even hindered. Figure 2 With the deepening of actinomycete research and the development of synthetic biology, more and more available actinomycete gene expression elements have been studied and applied (Bai C, et al. 2015, 112(39): 12181-12186; Takano E, et al. 1995, 166(1): 133-137), providing a rich variety of materials for the development of gene expression vectors for actinomycetes.
[0039] In addition to the plasmids and gene expression elements mentioned above, constructing actinomycete gene expression vectors also requires selecting appropriate reporter genes and actinomycete hosts to verify gene expression function and efficiency. In recent years, with the continuous deepening of research on the biosynthesis of actinomycete secondary metabolites, a series of gene clusters with significant metabolite signals and relatively delicate and small gene compositions, such as the biosynthetic gene cluster mcb of Beta-carboline alkaloid marinacarboline, have been discovered, and the related biosynthetic mechanisms have also been clearly elucidated (Huang, et al. 2011, 74(10): 2122-2127; Chen, et al. 2013, 52(38): 9980-9984). The aforementioned mcb gene cluster contains a Pictet-Spenglerase (PS enzyme) encoding gene mcbB (Huang, et al. 2011, 74(10): 2122-2127; Chen, et al. 2013, 52(38): 9980-9984; Chen, et al. 2017, 57(7): 1095-1105). McbB can catalyze the PS reaction of tryptophan and methylglyoxal to produce 1-acety-3-carboxy-β-carboline, a product with a 6 / 5 / 6 indolepyridine Beta-carboline skeleton. Figure 3 The aforementioned reaction raw materials are widely present in the primary metabolism of actinomycete cells, ensuring sufficient biosynthesis of the product. The product possesses a unique Beta-carboline skeleton, allowing for qualitative and quantitative analysis using HPLC at 275 nm. Therefore, mcbB was used as the reporter gene of this invention, cloned into three different gene expression elements. The efficiency of the gene expression elements can be verified based on the product formation. Furthermore, in addition to studying functional genes in actinomycetes, our research team has accumulated a series of actinomycete strains, including Streptomyces and other rare actinomycetes. These strains can also serve as excellent hosts for verifying gene expression elements and vectors.
[0040] Example 1: Construction of the pJXNU vector
[0041] First, the purified pSET152 plasmid was treated with NheI restriction endonuclease to obtain the linearized plasmid fragment pSET152-NheI for later use. Then, using the commercially available SuperCosI plasmid (Agilent Technologies) as a template, Kan... RThe amplification primers were 152KanIn-Fr / Re (Table 1). The amplification reaction system was: TransStartFastPfu DNA Polymerase 1U, 5×Buffer 10μL, dNTPs 0.5mmol / L, primers 0.5μmol / L each, DNA template SuperCosI plasmid approximately 1ng, and water added to a final volume of 50μL. The PCR reaction conditions were: pre-denaturation at 95℃ for 5 min; amplification cycles of 95℃ denaturation for 45 s, 55℃ annealing for 45 s, and 72℃ extension for 90 s, for a total of 30 cycles; and a final extension at 72℃ for 5 min. The final amplified fragment was approximately 949bp in length, including the upstream promoter. R Excerpt. Kan R The fragment contains a 15bp homologous sequence at each end that overlaps with the ends of pSET152-NheI. Subsequently, using these homologous sequences, homologous recombination was performed via DNA assemble to transfer Kan... R Cloned to pSET152-NheI, the above reaction system is: LightNing TM DNAAssembly Mix Plus 5μL, Kan R 200 ng of fragment, 200 ng of pSET152-NheI, and water were added to a final volume of 10 μL. The reaction conditions were 50 °C for 30 min. The reaction product was then transformed into E. coli DH5α competent cells. After Kan resistance selection and plasmid extraction and sequencing verification of cloned cells, the target plasmid pSET152K was obtained. Figure 4 Because only the 152KanIn-Fr fragment contains a complete NheI-recognizable "GCTAGC" sequence during KanR fragment amplification, the 152KanIn-Re fragment was designed with "GCTAG". This resulted in the generated pSET152K fragment still containing only one NheI site, which can be used for subsequent Thio... R Fragment cloning (Table 1).
[0042] Therefore, this invention continues along the same path, using NheI to treat pSET152K to obtain the linearized fragment pSET152K-NheI. Using primer 152ThioIn-Fr / Re and the template plasmid pIJ6021 (NCBI accession No. AJ414669.1), ThioIn-Fr / Re fragments are amplified to obtain the fragments. RThe amplification reaction system for the fragment was as follows: TransStart FastPfuDNA Polymerase 1U, 5×Buffer 10μL, dNTPs 0.5mmol / L, primers 0.5μmol / L each, DNA template SuperCosI plasmid approximately 1ng, and water added to a final volume of 50μL. The PCR reaction conditions were: pre-denaturation at 95℃ for 5 min; amplification cycles of 95℃ denaturation for 45 s, 55℃ annealing for 45 s, and 72℃ extension for 90 s, for a total of 30 cycles; and a final extension at 72℃ for 5 min. The final amplified fragment was approximately 1021 bp in length, including the upstream promoter. R Excerpt. Thio R The fragment contains 15bp homologous sequences at both ends that overlap with those at both ends of pSET152K-NheI. Subsequently, using these homologous sequences, Thio was recombined via DNA assemblies. R Cloned to pSET152-NheI, the above reaction system is: LightNing TM DNAAssembly Mix Plus 5μL, Kan R 200 ng of fragment, 200 ng of pSET152-NheI, and water were added to a final volume of 10 μL; the reaction conditions were 50 °C for 30 min. The reaction product was then transformed into E. coli DH5α competent cells, and selection was performed using a combination of Apr and Kan antibodies (Thio...). R This resistance does not work in E. coli, therefore it cannot be used directly for selection. Instead, the Apr antibody carried on the plasmid should be used. R and Kan R After resistance screening and extraction and sequencing verification of cloned plasmids, the target plasmid pSET152KT was obtained. Figure 4 Because 152ThioIn-Fr contains a complete NheI-recognizable "GCTAGC" sequence, while 152ThioIn-Re is designed with only "GCTAG", the generated pSET152KT also has only one NheI site and can be used for subsequent cloning.
[0043] Table 1. Constructing pSET152KT Kan R With Thio R Fragment amplification primers
[0044]
[0045] Note: Uppercase letter sequences represent regions homologous to the vector; bold black text represents sequences related to the NheI recognition site; lowercase letter sequences represent fragment amplification pairing regions.
[0046] After completing the construction of pSET152KT, this invention commissioned Genscript to obtain a 533bp gene expression element sequence as shown in SEQ ID NO.1 via total DNA synthesis. Figure 5-6 Gene expression elements and pSET152KT plasmid were synthesized using a combination of EcoRV and XbaI modification. The reaction system was as follows: LightNing TM EcoRV 2.5U, Lightning TM XbaI 2.5U, 10×Buffer 20μL, DNA fragment or plasmid 1μg, ddH2O to 200μL; reaction conditions: 37℃, 30min. The digested fragment was then recovered and ligated. The reaction system was: element DNA fragment 600ng, pSET152KT-EcoRV+XbaI linear fragment 200ng, 10×Buffer 1μL, Taq DNA ligase 2U, ddH2O to 10μL; reaction conditions: 45℃, 15min. The DNA ligation product was directly transformed into E. coli DH5α competent cells. After selection with Apr and Kan antibiotics and verification by clone plasmid sequencing, the element fragment was cloned into pSET152KT, and the target vector pJXNU was constructed. Figure 4 Its nucleotide sequence is shown in SEQ ID NO.2.
[0047] The gene expression element sequence has the nucleotide sequence shown in SEQ ID NO.1, and the specific sequence is as follows: TCTAGAGTCGAGGGCTGAGGGAGCCGACGGCACGCGGCGGCTCACGGCGTGGCACGCGGAACGTCCGGGCTTGCACCTCACGTCACGTGAGGAGGCAGCGTGGACGGCGTCAGAGAAGGGAGCGGATCCAGATCTGAGACCGAATTCGGTACCCTCGAGACTAGTTCTCCTTACTTAGACTGTCGTATTCTCCTGGCCACGACTTTACACCATAGCGCTTGTCCGTGTCAAAGCAGAGACGGTTCGAATGTGAACACGCGGTCGATCTTGACGGCTGGCGAGAGGTGCGGGGAGGATCTGACCGACGCGGTCCACACGTGGCACCGCGATGCTGTTGTGGGCACAATCGTGCCGGTTGGTAGGATACAGAACCACTCCACAGGAGGACCATGCATCTCGAGGCGGCCGCAAGCTTGTTAACAGATCTCATATGGACACTCCTTTGACAAGCTGTCGTATTCTCCTGGCCACGACTTTACAACACCGCACAGCATGTTGTCAAAGCAGAGACCGTTCGAATGTGAACAGATATC。
[0048]
[0049] Example 2: Functional verification of gene expression elements in the pJXNU vector
[0050] This invention selects the PS enzyme McbB encoding gene mcbB as a reporter gene, and clones three gene expression elements into pJXNU. These elements are then introduced into the model actinomycete *S. coelicolor* M1152 for gene expression. The content of the gene expression product McbB is specifically reflected by the yield of 1-acety-3-carboxy-β-carboline in the host bacterium, thus ultimately allowing for quantitative analysis of the gene expression element's efficacy. This invention uses a laboratory-stored mcbB gene fragment as a template, and uses three sets of primers to amplify homologous recombination clones mcbBGE-1, mcbBGE-2, and mcbBGE-3 adapted to the three gene expression elements, respectively. Additionally, the product mcbBAKE is amplified using primer set 1 (mcbAKE-Fr / Re) and cloned into the control plasmid pSET152AKE, simultaneously constructing a reference control (Table 2). The PCR amplification system for the fragment was as follows: TransStart FastPfu DNA Polymerase 1U, 5×Buffer 10μL, dNTPs 0.5mmol / L, primers 0.5μmol / L each, template mcbB fragment approximately 1ng, DMSO 4μL, and water added to a final volume of 50μL. The PCR reaction conditions were: pre-denaturation at 95℃ for 5 min; amplification cycles of 95℃ denaturation for 45 s, 60℃ annealing for 45 s, 72℃ extension for 90 s, for a total of 30 cycles; and a final extension at 72℃ for 8 min.
[0051] Table 2. McbB amplification primers used for pJXNU gene expression element verification.
[0052]
[0053] Note: Lowercase letter sequences represent the homologous region between the mcbB fragment and the linearized vector; bold black text indicates restriction endonuclease recognition sites; uppercase letter sequences represent the mcbB amplification pairing region.
[0054] Subsequently, linearized vectors were constructed based on different combinations of restriction endonucleases at the MCS sites on pJXNU. For the mcbB gene clone on GE-1, NdeI and HpaI were selected to digest the vector, constructing the linearized fragment pJXNU-NdeI+HpaI. Similarly, linearized vectors pJXNU-SpeI+KpnI and pJXNU-BamHI+KpnI were constructed for the mcbB gene clones on GE-2 and GE-3, respectively. Simultaneously, the linearized fragment pSET152AKE-NdeI+XbaI required for the control sample was constructed. The reaction system for the above restriction enzyme treatment was: LightNingTM restriction enzyme-12.5U, LightNing TM Restriction enzyme-22.5U, 10×Buffer 20μL, plasmid 1μg, ddH2O to bring the total to 200μL; reaction conditions: 37℃, 30min. The enzyme-digested fragments were then recovered, and the corresponding plasmids were constructed via DNA assembly homologous recombination, as follows: mcbBGE-1 underwent homologous recombination with pJXNU-NdeI+HpaI, cloning mcbB downstream of GE-1 to construct pJXNU-mcbB-GE-1; mcbBGE-2 underwent homologous recombination with pJXNU-SpeI+KpnI, cloning mcbB downstream of GE-2 to construct pJXNU-mcbB-GE-2; mcbBGE-3 underwent homologous recombination with pJXNU-BamHI+KpnI, cloning mcbB downstream of GE-3 to construct pJXNU-mcbB-GE-3; mcbBAKE underwent homologous recombination with pSET152AKE-NdeI+XbaI to construct pSET152AKE-mcbB. The reaction system for the above homologous recombination cloning was: LightNing TM The following reagents were added: DNAAssembly Mix Plus 5 μL, PCR amplification fragment 600 ng, linearized vector 200 ng, and water to a final volume of 10 μL. The reaction conditions were 50 °C for 30 min. The reaction products were then transformed into E. coli DH5α competent cells. After Apr resistance selection and plasmid extraction and sequencing verification of cloned cells, the four target plasmids were obtained. The plasmids were then transformed into E. coli ET12567 / pUZ8002 to construct four corresponding conjugation transfer donor strains: E. coli ET12567 / pUZ8002 / pJXNU-mcbB-GE-1, E. coli ET12567 / pUZ8002 / pJXNU-mcbB-GE-2, E. coli ET12567 / pUZ8002 / pJXNU-mcbB-GE-3, and E. coli ET12567 / pUZ8002 / pSET152AKE-mcbB. In addition, the empty vectors pJXNU and pSET152AKE without any functional genes were also simultaneously transformed into E. coli ET12567 / pUZ8002 to construct two control conjugation transfer donor strains: E. coli ET12567 / pUZ8002 / pJXNU and E. coli ET12567 / pUZ8002 / pSET152AKE.
[0055] Simultaneously with the construction of the donor strain, the recipient strain—the model actinomycete *S. coelicolor* M1152—was streaked in ISP2 medium (formulation: 4g malt extract, 4g yeast extract, 4g glucose, water to 1L, pH 7.2; preparation: dissolve all components in water, stir well, adjust pH, and sterilize) for 3-5 days. The resulting spores were collected using sterile swabs and dispersed in TSB medium (Guangdong Huankai Microbial Technology Co., Ltd., catalog number: 024051, Guangzhou, China). The mycelium and spores were separated by filtration. The spores were suspended in 5mL of TSB medium, heat-shocked at 50℃ for 10 min, and then germinated at 28℃ for 2-4 hours for later use. Six types of donor bacteria were grown in 50mL LB broth containing 50μg / mL kanamycin at 37℃ to the OD level. 600 When the pH value is approximately 0.8, the bacterial cells are collected by centrifugation (4000 rpm, 10 min), washed three times with LB broth, and suspended in 300 μL of LB medium for later use. The above recipient bacterial spore germination material and the bacterial cells of 6 donor bacteria are mixed evenly and spread on M-ISP4 solid medium (formula: 10 g soluble starch, 0.5 g yeast extract, 1 g peptone, 1 g NaCl, 1 g MgSO4·7H2O, 2 g (NH4)2SO4, 1 g K2HPO4, 2 g CaCO3, add water to 1 L, pH 7.2; preparation: dissolve each component in water, stir well, adjust pH, and sterilize) without antibiotics. After drying, it is incubated at 28℃ for 18-20 h. Then, remove the culture plate and cover it with water containing antibiotics, with a final concentration of 50 μg / mL apramycin (Apr) and 50 μg / mL trimethoprim (Tmp). After drying, place it in an incubator at 28°C and observe after 2-3 days of incubation. Once small colonies (conjugates) have grown on the conjugation transfer plate, they are transferred to M-ISP4 plates containing 50 μg / mL Apr and 50 μg / mL LTmp using sterile toothpicks. After incubation at 28°C for 2-3 days, genomic DNA is extracted from the conjugate clones. PCR verification is performed using the corresponding mcbB amplification primers for each clone, resulting in four valid single gene element expression verification strains: S. coelicolor M1152::mcbB / GE-1; S. coelicolor M1152::mcbB / GE-2; S. coelicolor M1152::mcbB / GE-3 and S. coelicolor M1152::mcbB / AKE; and two control strains: S. coelicolor M1152::pJXNU and S. coelicolor M1152::pSET152AKE.
[0056] After activating all four single-gene element verification strains and two control strains, they were inoculated at a volume ratio of 5% into 50mL fermentation medium in 250mL Erlenmeyer flasks (formula: 10g soluble starch, 3g corn flour, 5g yeast extract, 2g bacteriological peptone, 5g NaCl, 1g MgSO4·7H2O, 2g (NH4)2SO4, 1g K2HPO4, 2g CaCO3, with water added to 1L, pH 7.0; preparation: dissolve all components in water, stir well, adjust pH, and sterilize). The cultures were incubated at 28℃ for 6 days. The fermentation culture of *S. coelicolor* M1152::mcbB / GE-3 was divided into two parts: one part was the same as the other strains, and the other part of the fermentation product was induced at day 2 by adding a final concentration of 5μmol / L Thio. After the strain culture was completed, 2 volumes of ethyl acetate were added to a 250 mL Erlenmeyer flask containing the fermentation culture. The cells were sonicated for 30 min to disrupt the cell structure, and then allowed to stand for phase separation. The ethyl acetate extract was separated from the aqueous phase, and the ethyl acetate was evaporated to dryness using a rotary evaporator. The residue was dissolved in methanol to form a sample, which was then analyzed by HPLC. The detection conditions were as follows: Phenomex C184.6×250 mm reversed-phase column; mobile phase A: ddH2O containing 0.1% acetic acid; mobile phase B: methanol containing 0.1% acetic acid; flow rate: 1 mL / min; detection wavelength: 275 nm. HPLC program: 0-20 min, 0%-80% B phase; 20-20.1 min, 80%-100% B phase; 20.1-25 min, 100% B phase; 25-25.1 min, 100%-0% B phase; 25.1-30 min, 0% B phase.
[0057] The test results are as follows: the production potency of 1-acety-3-carboxy-β-carboline in S. coelicolor M1152::mcbB / GE-1 and S. coelicolor M1152::mcbB / GE-2 were 21.3±0.25 mg / L and 19.6±0.31 mg / L, respectively. Figure 7 The titer of 1-acety-3-carboxy-β-carboline in strains 2 and 3 (Courses 2 and 3) was significantly higher than that in the control strain S. coelicolor M1152::mcbB / AKE (5.7 ± 0.09 mg / L). Figure 7 (Chapter 1); while the analytical results of S. coelicolor M1152::mcbB / GE-3 showed significant differences between the absence of the inducing agent Thio and the presence of 5 μmol / L Thio, with the former showing no significant production of 1-acety-3-carboxy-β-carboline ( Figure 7(Course 4), the latter's production potency was basically the same as the control strain, approximately 6.2 ± 0.04 mg / L ( Figure 7 (Channel 5); No 1-acety-3-carboxy-β-carboline signal was detected in the detection of S. coelicolor M1152::pSET152AKE and S. coelicolor M1152::pJXNU. Figure 7 (Chapters 6 and 7) The results showed that pJXNU can exert excellent gene expression effects in Streptomyces represented by S. coelicolor M1152, achieving integrated cloning and expression of the target gene.
[0058] Example 3: Functional validation of pJXNU vector gene expression elements in rare actinomycetes
[0059] Following the method described in Example 2, six donor strains, E. coli ET12567 / pUZ8002 / pJXNU-mcbB-GE-1, E. coli ET12567 / pUZ8002 / pJXNU-mcbB-GE-2, E. coli ET12567 / pUZ8002 / pJXNU-mcbB-GE-3, and E. coli ET12567 / pUZ8002 / pSET152AKE-mcbB, E. coli ET12567 / pUZ8002 / pJXNU, E. coli ET12567 / pUZ8002 / pSET152AKE, were conjugated and transferred into two rare actinomycetes, Actinoalloteichus sp. AHMU CJ021 (CCTCC M 2018157; Xie, et al.). al.2020,19:159) and Kitasatospora setaeNBRC 14216 T (Aroonsri, et al. 2012, 114(1):56-58).
[0060] Actinoalloteichus sp.AHMUCJ021 and Kitasatospora setaeNBRC 14216 T Streak the bacteria on M-ISP4 solid agar plates for 3-5 days. Collect the spores with sterile cotton swabs and vortex to disperse them. Filter to separate the mycelium and spores. Suspend the spores in 5 mL of TSB medium, heat shock at 50°C for 10 min, and then germinate at 28°C for 2-4 hours for later use. Six types of donor bacteria are grown to OD in 50 mL of LB liquid medium containing 50 μg / mL kanamycin at 37°C. 600When the pH value is approximately 0.8, the bacterial cells are collected by centrifugation (4000 rpm, 10 min), washed three times with LB broth, and suspended in 300 μL of LB medium for later use. The spore germination products of the two rare actinomycete recipient bacteria and the bacterial cells of the six donor bacteria are mixed evenly and spread on M-ISP4 solid medium (formula: 10 g soluble starch, 0.5 g yeast extract, 1 g peptone, 1 g NaCl, 1 g MgSO4·7H2O, 2 g (NH4)2SO4, 1 g K2HPO4, 2 g CaCO3, water added to 1 L, pH 7.2; preparation: dissolve all components in water, stir well, adjust pH, and sterilize) without antibiotics. After drying, the medium is incubated at 28℃ for 18-20 h. Then, remove the culture plate, cover it with water containing antibiotics at a final concentration of 50 μg / mL Apr and 50 μg / mL Ltmp, dry it, and place it in an incubator at 28°C. Observe after 2-3 days of incubation. Once small colonies (conjugates) have grown on the conjugate transfer plate, they are transferred using sterile toothpicks to M-ISP4 plates containing 50 μg / mL LAPr and 50 μg / mL Tmp. After incubation at 28°C for 2-3 days, genomic DNA is extracted from the conjugate clones. PCR verification is performed using the corresponding mcbB amplification primers for each clone, resulting in the identification of eight valid single gene element expression strains: AHMUCJ021::mcbB / GE-1, AHMUCJ021::mcbB / GE-2, AHMUCJ021::mcbB / GE-3, AHMUCJ021::mcbB / AKE, NBRC 14216::mcbB / GE-1, NBRC 14216::mcbB / GE-2, NBRC 14216::mcbB / GE-3, NBRC 14216::mcbB / AKE; 4 control strains: AHMUCJ021::pJXNU, AHMU CJ021::pSET152AKE, NBRC 14216::pSET152AKE, and NBRC 14216::pJXNU.
[0061] After activating all eight single-gene element verification strains and four control strains, they were inoculated at a volume ratio of 5% into 50mL fermentation medium in 250mL Erlenmeyer flasks (formula: 10g soluble starch, 3g corn flour, 5g yeast extract, 2g bacteriological peptone, 5g NaCl, 1g MgSO4·7H2O, 2g (NH4)2SO4, 1g K2HPO4, 2g CaCO3, with water added to 1L, pH 7.0; preparation: dissolve all components in water, stir well, adjust pH, and sterilize). The cultures were incubated at 28℃ for 6 days. The fermentation cultures of AHMUCJ021::mcbB / GE-3 and NBRC 14216::mcbB / GE-3 were divided into two parts: one part was the same as the other strains, and the other part of the fermentation product was induced at day 2 by adding a final concentration of 5μmol / L Thio. After the strain culture was completed, 2 volumes of ethyl acetate were added to a 250 mL Erlenmeyer flask containing the fermentation culture. The cells were sonicated for 30 min to disrupt the cell structure, and then allowed to stand for phase separation. The ethyl acetate extract was separated from the aqueous phase, and the ethyl acetate was evaporated to dryness using a rotary evaporator. The residue was dissolved in methanol to form a sample, which was then analyzed by HPLC. The detection conditions were as follows: Phenomex C184.6×250 mm reversed-phase column; mobile phase A: ddH2O containing 0.1% acetic acid; mobile phase B: methanol containing 0.1% acetic acid; flow rate: 1 mL / min; detection wavelength: 275 nm. HPLC program: 0-20 min, 0%-80% B phase; 20-20.1 min, 80%-100% B phase; 20.1-25 min, 100% B phase; 25-25.1 min, 100%-0% B phase; 25.1-30 min, 0% B phase.
[0062] The results are as follows: In the analysis using *Actinoalloteichus* sp. AHMUCJ021 as the host, the control strain AHMUCJ021::mcbB / AKE containing pSET152AKE-mcbB had an expression level of 5.3 ± 0.01 mg / L, which was roughly equivalent to its expression intensity in the model *Streptomyces coelicolor* M1152. Figure 8 A, the a). Among the three gene expression element validation strains, the GE-1 validation strain AHMUCJ021::mcbB / GE-1 was 3.1 times that of the control, approximately 16.4 ± 0.21 mg / L ( Figure 8 A, lane b); the GE-2 validation strain AHMUCJ021::mcbB / GE-2 was 4.2 times that of the control, approximately 21.3 ± 0.46 mg / L. Figure 8A, lane c); GE-3 validation strain AHMUCJ021::mcbB / GE-3 showed almost no significant product formation without Thio induction, but the product concentration was consistent with the control at 5 μmol / L Thio, reaching 5.3 ± 0.05 mg / L. Figure 8 A, lanes d and e). And in K.setae NBRC 14216 T The validation results were basically consistent with the previous two strains, with the yield of the control strain containing pSET152AKE-mcbB being 4.9 ± 0.01 mg / L. Figure 8 B, i); Among the three gene expression element verification strains, the product titers of GE-1 and GE-2 in the verification strains NBRC 14216::mcbB / GE-1 and NBRC 14216::mcbB / GE-2 were also significantly higher than those of the control strain, approximately 4.4 times and 3.9 times that of the control strain, respectively, with specific values of 21.6±0.51 mg / L and 19.1±0.42 mg / L. Figure 8 B, channels ii and iii). The validation strain NBRC 14216::mcbB / GE-3 for GE-3 also produced no product without Thio, and similarly achieved the same gene expression element activation effect as the control under 5 μmol / L Thio induction, obtaining a target product titer of 4.9 ± 0.06 mg / L. Figure 8 B, IV, V). It can be seen that the pJXNU vector designed and constructed in this invention can also exert its effects in rare actinomycetes. Its GE-1 and GE-2 are significantly superior to commonly used ermEp* promoter elements, and GE-3 can exert Thio-induced expression regulation effects, realizing the controllable expression of functional genes.
[0063] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A method for constructing a gene expression vector pJXNU for actinomycetes, characterized in that, Includes the following steps: (1) The pSET152 plasmid was treated with NheI to obtain the linearized plasmid fragment pSET152-NheI; (2) Using SuperCosI plasmid as a template, amplify Kan R Fragments, using homologous recombination, to transform Kan R The target plasmid pSET152K was obtained by cloning into pSET152-NheI. (3) Process pSET152K with NheI to obtain the linearized fragment pSET152K-NheI; (4) Using pIJ6021 plasmid as a template, amplify Thio R Fragments, using homologous recombination, Thio R The target plasmid pSET152KT was obtained by cloning into pSET152-NheI. (5) Synthesize the gene expression element sequence as shown in SEQ ID NO.1, process the gene expression element and pSET152KT plasmid with the combination of EcoRV and XbaI respectively, and ligate the digested fragments to obtain the target vector pJXNU.
2. The construction method according to claim 1, characterized in that, In step (2), Kan is amplified. R The primers for the fragment were 152KanIn-Fr:5'-ATCGGGCCCTGGCCAGCTAGCtggtaaggttgggaagccct-3' and 152KanIn-Re:5'-TGCAGGTCGACTCTAGCTAGtcagaagaactcgtcaagaag-3'.
3. The construction method according to claim 1, characterized in that, In step (4), Thio is amplified. R The primers for the fragment are 152ThioIn-Fr:5'-ATCGGGCCCTGGCCAGCTAGCggggatcgaccgcgcgggtc-3' and 152ThioIn-Re:5'-TTCCCAACCTTACCAGCTAGttatcggttggccgcgagat-3'.
4. A gene expression vector pJXNU for actinomycetes constructed according to any one of claims 1-3.
5. The expression vector pJXNU according to claim 4, characterized in that, The nucleotide sequence of the vector pJXNU is shown in SEQ ID NO.
2.
6. A bacterium containing the expression vector pJXNU as described in claim 4, wherein the bacterium is an actinomycete.
7. The application of the expression vector pJXNU according to claim 4 in actinomycete gene expression.
8. The application of the expression vector pJXNU according to claim 4 in heterologous expression of the Beta-carboline alkaloid 1-acety-3-carboxy-β-carboline biosynthetic gene cluster mcb in actinomycetes.
Citation Information
Patent Citations
Cloning method of antibiotics biosynthetic gene cluster based on site-specific recombination
CN103060362A
Streptomycete recombinant plasmid pIJ8600-attM, and construction method and applications thereof
CN106591348A