A Pichia pastoris recombinant strain for producing patchouli alcohol, a construction method thereof, and an application thereof

Abstract

The present invention discloses a recombinant Pichia pastoris strain for producing patchouli alcohol, a construction method thereof, and an application. The construction method of the present invention is as follows: patchouli synthase derived from patchouli plants is expressed in Pichia pastoris, and at the same time, the overexpression modes of two enzymes, namely endogenous farnesyl pyrophosphate synthase and patchouli alcohol synthase, are optimized. Then, the endogenous mevalonate precursor pathway is modified to significantly improve the yield. Finally, on this basis, the copy number of key enzymes is optimized to obtain a recombinant strain with high yield of patchouli alcohol. The present invention uses a combined regulation strategy of Pichia pastoris to make the yield of patchouli alcohol reach 2.47 g / L, which is the highest among other reported engineering strains at present. The Pichia pastoris chassis cell of the present invention can significantly improve the synthesis of patchouli alcohol and alleviate the market demand.

Description

Technical Field

[0001] The present invention relates to the field of biocatalytic applications, and more particularly to a recombinant Pichia pastoris strain for producing patchoulol, a method for constructing the same, and applications thereof. Background Art

[0002] Patchoulol, also known as pogostol, is a tricyclic sesquiterpene compound with the chemical formula C 15 H 26 O, CAS registry number 5986-55-0, relative molecular mass of 222.37, and density of 1.001 g / cm 3 . Patchoulol is colorless and is a colorless crystal at room temperature. It is volatile and emits a special soothing odor. It is insoluble in water and soluble in alcohols, ethers, and common organic solvents. In nature, patchoulol mainly exists in Pogostemon cablin, a plant of the genus Pogostemon in the family Lamiaceae. It is widely used in the pharmaceutical field due to its various pharmacological effects such as anti-inflammatory, antiviral, and anticancer properties, and is also widely used in the cosmetic field due to its unique odor.

[0003] Currently, patchoulol is mainly obtained through plant extraction, chemical synthesis, microbial fermentation, etc. In China, it is mainly extracted from plants, but the yield is extremely low and it is not suitable for industrial production. Abroad, it focuses on chemical synthesis methods. The patchoulol molecule has a functionalized tricyclic tetrahedral cyclized structure, which is complex and difficult to synthesize. Therefore, the chemical synthesis steps are complicated, there are many by-products, and the yield is low, resulting in a high cost. Neither of these two methods can meet the growing market demand for patchoulol. The development of metabolic engineering and synthetic biology has made the microbial production of terpenoids a promising method that can replace traditional chemical or plant extraction methods, with advantages such as short cycle, low energy consumption, and environmental friendliness. Therefore, researchers are committed to developing microbial production platforms to improve the biosynthesis of patchoulol. Using a microbial platform to produce patchoulol is an economical and sustainable option with the potential for industrial production applications. The latest research shows that metabolic engineering bacteria and yeast can be used as promising patchoulol cell factories, with a maximum yield of 1.63 g / L.

[0004] In the design of yeast engineering bacteria for large-scale production of terpenoids, the vast majority of research has been carried out in the model yeast Saccharomyces cerevisiae. However, since it is a Crabtree-positive strain, under high glucose concentration and aerobic conditions, the carbon metabolic flux direction will be redirected to synthesize ethanol. Although this characteristic has enabled the synthesis of ultra-high-concentration ethanol in Saccharomyces cerevisiae, it also limits its use as a host for high-yield carbon metabolites. In addition, Saccharomyces cerevisiae has characteristics such as low biomass, high culture cost, and difficulty in large-scale cultivation, which limit their industrial production and applications.

[0005] In recent years, more and more studies have used Pichia pastoris as a chassis cell for the production of metabolites from various sources. For example, sesquiterpene compound nootkatone, triterpene compounds dammarenediol and ambrein, carotenoid compounds such as lycopene, β-carotene, and astaxanthin. In addition, studies on the synthesis of polyketide compounds by Pichia pastoris have also been reported, such as lovastatin and monacolin J. Pichia pastoris also has irreplaceable advantages. First, Pichia pastoris has the ability to express heterologous proteins from bacteria, fungi, and plants superior to other hosts, which is a key factor for successfully expressing heterologous complex key enzymes by reconstructing the metabolic pathway of Pichia pastoris. It has been reported that cytochrome P450 has a low expression level or even no expression in Escherichia coli due to the lack of further modification of the amino acid sequence in the bacterial expression system. Similarly, Pichia pastoris has a more advanced protein expression mechanism and rich intracellular membranes, making it a more suitable host for the functional expression of complex key enzymes such as cytochrome P450. Second, Pichia pastoris has a strict and powerful methanol-inducible AOX promoter, which is strictly induced by methanol and inhibited by glycerol, enabling the separation of growth and production in high-density fed-batch fermentation. Third, Pichia pastoris has a strong respiratory metabolism ability and can grow to a very high cell density in a simple medium, showing great potential in the production of high-value compounds. Therefore, Pichia pastoris is expected to become an efficient cell factory for the synthesis of patchouli alcohol.

[0006] Currently, there is no effective and reliable synthetic biology and industrial microbiology technology in the field to efficiently synthesize patchouli alcohol in Pichia pastoris. Therefore, there is a certain potential for the heterologous synthesis of patchouli alcohol using Pichia pastoris to achieve the cheap and efficient production of patchouli alcohol. Summary of the Invention

[0007] Aiming at the existing defects and deficiencies, the present invention combines the advantages of Pichia pastoris itself and conducts research on the metabolic regulation mechanism of its use as a platform for the synthesis of terpenoid compounds. The present invention uses genetic engineering means to carry out metabolic engineering transformation of Pichia pastoris, aiming to obtain Pichia pastoris strains with high-yield patchouli alcohol, promoting the exploration of Pichia pastoris as a new generation of terpenoid compound cell factories.

[0008] The present invention uses Pichia pastoris as the starting strain, expresses patchouli synthase from patchouli plants in Pichia pastoris, and at the same time optimizes the overexpression mode of the two enzymes, the endogenous direct precursor farnesyl pyrophosphate (FPP) synthase ERG20 and patchouli alcohol synthase. Then, the endogenous mevalonate (MVA) precursor pathway is modified to significantly improve the yield. Finally, on this basis, the copy number of the key enzyme is optimized to obtain a recombinant strain with high-yield patchouli alcohol.

[0009] According to the construction method provided by the present invention, first, an optimized patchouli alcohol synthase encoding gene PTS is inserted into the genome of Pichia pastoris. Further, the overexpression methods of the two enzymes, endogenous farnesyl pyrophosphate synthase ERG20 and patchouli alcohol synthase, are explored, and it is found that the fusion expression of the two enzymes is superior to the co-expression alone. Among them, the connection method of the C-terminus of farnesyl pyrophosphate synthase and the N-terminus of patchouli alcohol synthase is superior to the connection method of the C-terminus of patchouli alcohol synthase and the N-terminus of farnesyl pyrophosphate synthase.

[0010] To increase the precursor supply, the present invention further strengthens the mevalonate synthesis pathway in the cytoplasm. The present invention overexpresses 5 key enzymes (HMGS, HMGR, ERG8, ERG19, and IDI1) of the MVA pathway from acetyl-CoA to dimethylallyl pyrophosphate.

[0011] Finally, on the basis of the above engineering bacteria, the copy numbers of the key enzymes ERG20 or PTS are optimized to increase the expression levels of the key enzymes ERG20LPTS or PTS, and a recombinant strain with high-yield patchouli alcohol is obtained.

[0012] The primary object of the present invention is to provide a method for constructing an engineering bacterium for efficiently producing patchouli alcohol.

[0013] Another object of the present invention is to provide an engineering bacterium for efficiently producing patchouli alcohol obtained by the above construction method.

[0014] Another object of the present invention is to provide the application of the above engineering bacterium for efficiently producing patchouli alcohol.

[0015] The technical solution of the present invention is outlined as follows:

[0016] A method for constructing an engineering bacterium for efficiently producing patchouli alcohol uses Pichia pastoris as the starting strain, integrates the fusion gene A into the Pichia pastoris genome, and strengthens the MVA pathway; wherein:

[0017] The fusion gene A is obtained by connecting the farnesyl pyrophosphate synthase encoding gene ERG20 and the patchouli alcohol synthase encoding gene PTS;

[0018] The nucleotide sequence of the patchouli alcohol synthase encoding gene PTS is shown in SEQ ID NO.1, and the nucleotide sequence of the farnesyl pyrophosphate synthase encoding gene ERG20 is shown in NCBI accession number: XP_002490436.1.

[0019] As a preferred embodiment of the present invention, the connection method of the farnesyl pyrophosphate synthase encoding gene ERG20 and the patchouli alcohol synthase encoding gene PTS is: the C-terminus of the farnesyl pyrophosphate synthase encoding gene ERG20 and the N-terminus of the patchouli alcohol synthase encoding gene PTS are connected by a linker peptide.

[0020] More preferably, the linker peptide is a flexible linker peptide, including but not limited to GSG, GGGS, GSGGGGS.

[0021] As a preferred embodiment of the present invention, the enhanced MVA pathway is to integrate the key genes of the MVA pathway into the genome of the engineered bacterium.

[0022] More preferably, the key genes of the MVA pathway include HMGS, HMGR, ERG8, ERG19 and IDI1; the Gene ID of HMGS is 8198573, the Gene ID of HMGR is 8198637, the Gene ID of ERG8 is 8198218, the Gene ID of ERG19 is 8196843, and the Gene ID of IDI1 is 8197017.

[0023] Even more preferably, the enhanced MVA pathway is to sequentially integrate the expression cassette of HMGS, the expression cassette of HMGR, the expression cassette of IDI1, and the dual expression cassette of ERG8 and ERG19 into the genome of the engineered bacterium.

[0024] As a preferred embodiment of the present invention, the construction method further includes additionally integrating one or more copies of the fusion gene A, or additionally integrating one or more copies of the fusion gene A and one or more copies of the patchouli alcohol synthase encoding gene PTS; as a preferred embodiment of the present invention, the construction method further includes additionally integrating two copies of the fusion gene A; or integrating two copies of the fusion gene and one copy of the patchouli alcohol synthase encoding gene PTS into the genome of Pichia pastoris. As a most preferred embodiment of the present invention, the construction method further includes additionally integrating two copies of the fusion gene A and one copy of the patchouli alcohol synthase encoding gene PTS.

[0025] As a preferred embodiment of the present invention, the Pichia pastoris is Pichia pastoris GS115.

[0026] As a preferred embodiment of the present invention, the promoters of the expression cassettes of the fusion gene A and the patchouli alcohol synthase encoding gene PTS are both the PAOXm promoter, and the base sequence is as shown in SEQ ID NO.3, and the terminators are both the TAOX terminator, and the base sequence is as shown in SEQ ID NO.4; the promoter of the expression cassette of the key gene of the MVA pathway is the PAOX1 promoter, and the base sequence is as shown in SEQ ID NO.2, and the terminator is the TAOX terminator, and the base sequence is as shown in SEQ ID NO.4.

[0027] As a preferred embodiment of the present invention, the integration of the fusion gene A and the patchouli alcohol synthase encoding gene PTS, and the integration of the key genes of the MVA pathway are both achieved through the plasmid pPICZA. That is, using the plasmid pPICZA as a backbone, an expression cassette containing the gene to be integrated is cloned to obtain a recombinant plasmid containing the expression cassette of the gene to be integrated. Then, the positive recombinant plasmid obtained by screening is transformed into Pichia pastoris competent cells, and positive clone transformants are screened to obtain an engineering bacterium for highly efficient production of patchouli alcohol.

[0028] Further preferably, after obtaining the engineering bacterium for highly efficient production of patchouli alcohol, excision of the resistance gene is required: inoculate the positive clone transformant into BMMY liquid medium containing 1% methanol, add 1% methanol every 24 h for induction, and continuously induce for 3 days to excise the resistance gene. Take about 10 μl of the bacterial solution and streak it on a YPD plate, culture for 2 - 3 days, pick a single colony and first streak it on a YPDZ (YPD supplemented with Zeocin antibiotic) plate, and then streak it on a YPD plate, culture at 30 °C for 2 - 3 days. If the single colony only grows on the YPD plate and does not grow on the corresponding YPDZ plate, it preliminarily indicates that the Zeocin resistance of the strain has been successfully excised.

[0029] An engineering bacterium for highly efficient production of patchouli alcohol is obtained by the above construction method.

[0030] In order to evaluate the production capacity of the recombinant bacterium, the present invention conducted a fermentation scale-up test. In the fermentation scale-up process of the present invention, a high-density fermentation method with dual-stage regulation of the growth stage and the product synthesis stage was achieved by using the AOX promoter induction expression system of the high-yield engineering strain, and high production of patchouli alcohol was realized.

[0031] The fermentation culture process is divided into two stages: in the first stage, glycerol is used as the carbon source to enable the rapid growth of the bacteria. After the bacterial biomass reaches a certain concentration and the glycerol is exhausted, the second-stage fermentation begins; the second stage is the patchouli alcohol production stage, adding methanol as the carbon source and also as an inducer to initiate the large-scale synthesis of patchouli alcohol, and finally obtaining a high yield of patchouli alcohol.

[0032] The application of the above engineering bacterium for highly efficient production of patchouli alcohol in the fermentation production of patchouli alcohol.

[0033] As a preferred embodiment of the present invention, the fermentation in a 2 L system is as follows: a single colony is first inoculated into 50 mL of YPD medium, cultured at 30 ± 2 °C and 250 ± 50 rpm for 20 ± 2 hours; then, 4% of the seed culture is transferred to 100 mL of YPD medium and cultured under the same conditions and for the same time period; finally, 8% of the seed culture is inoculated into 2 L of BSM medium for fed-batch fermentation; the fed-batch fermentation includes the following three fermentation processes:

[0034] The first process is the batch growth stage: adjust the relevant parameters, with the temperature at 30 °C, pH at 5.5, stirring speed at 1200 rpm, air flow rate at 2 L / (L·min), and the dissolved oxygen (DO) concentration maintained at 30% - 40%. Conduct the initial cell growth in the BSM medium for 18 - 24 h.

[0035] The second process is the glycerol feeding stage: Add a 50% (w / w) glycerol solution containing 1.2% (v / v) PTM1 at a flow rate of 13 - 23 g / (L·min). Appropriately adjust the flow rate according to the dissolved oxygen concentration to ensure no accumulation of glycerol. When the OD600 reaches 300, stop adding glycerol and let the cells deplete the glycerol. The temperature, pH, stirring speed, and air flow rate during this process are the same as above.

[0036] The third process is the methanol induction stage: Adjust the relevant parameters, with the temperature at 25 °C, pH at 6.0, stirring speed at 1200 rpm, air flow rate at 2 L / (L·min), and the dissolved oxygen concentration controlled at about 20% - 30%. Add a 50% (w / w) methanol solution containing 1.2% (v / v) PTM1: First, add it at a rate of 3 g / L / h, and increase the rate by 1 - 2 g / L / h every 1 - 2 h until the flow rate reaches 8 - 9 g / L / h. If there is no accumulation of methanol, this flow rate can be maintained throughout the remaining fermentation process and adjusted appropriately according to the dissolved oxygen if necessary. Add 10% dodecane after culturing for 20 h.

[0037] Further preferably, the formulation of the BSM medium is as follows: 4% glycerol, 0.093% CaSO4·2H2O, 1.147% MgSO4, 1.82% K2SO4, 0.413% KOH, 2.67% H3PO4, 0.435% trace metal solution PTM1 solution.

[0038] The formulation of the trace metal solution PTM1 solution is as follows: 0.05% CoCl2·6H2O, 0.6% CuSO4·5H2O, 6.5% FeSO4·7H2O, 0.002% H3BO3, 0.008% NaI, 0.5% H2SO4, 0.02% Na2MoO4·2H2O, 2% ZnCl2, 0.3% MnSO4·H2O, 0.02% biotin.

[0039] The present invention has the following beneficial effects compared with the prior art:

[0040] The Pichia pastoris strain for high - yield patchouli alcohol provided by the present invention, through a two - stage fermentation process, the yield of patchouli alcohol reaches 2.47 g / L, which is the current highest production level and there is still room for further improvement.

[0041] The present invention confirms the production potential of developing high-yield patchouli alcohol in Pichia pastoris, providing some guidance for the efficient production of other sesquiterpenes or other terpenes in Pichia pastoris. Detailed implementation manners

[0042] The present invention will be further described in detail below in combination with specific preparation examples and application examples, but the implementation manners of the present invention are not limited thereto.

[0043] The media involved in the following examples and their preparation:

[0044] YPD medium: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose (for YPD solid medium, 20 g / L agar powder needs to be additionally added). Zeocin antibiotic is added to the medium as required.

[0045] BMGY medium: 10 g / L yeast extract, 20 g / L peptone, 13.4 g / L YNB, 0.1 mM, pH 6.0 potassium phosphate buffer pH 6.0, 10 g / L glycerol.

[0046] BMMY medium: 10 g / L yeast extract, 20 g / L peptone, 13.4 g / L YNB, 0.1 mM, pH 6.0 potassium phosphate buffer pH 6.0, 10 g / L methanol.

[0047] Fermentation medium in the bioreactor / base salt medium (BSM): 4% glycerol, 0.093% CaSO4·2H2O, 1.147% MgSO4, 1.82% K2SO4, 0.413% KOH, 2.67% H3PO4, 0.435% trace metal solution PTM1 solution. Trace metal solution PTM1 solution: 0.05% CoCl2·6H2O, 0.6% CuSO4·5H2O, 6.5% FeSO4·7H2O, 0.002% H3BO3, 0.008% NaI, 0.5% H2SO4, 0.02% Na2MoO4·2H2O, 2% ZnCl2, 0.3% MnSO4·H2O, 0.02% biotin.

[0048] The patchouli alcohol detection methods involved in the following examples:

[0049] a. The standard product of patchouli alcohol is purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.

[0050] b. Preparation of patchouli alcohol standard product solution: Weigh 20 mg of patchouli alcohol standard product, dissolve it in dodecane, and make up the volume to 20 mL in a volumetric flask. The concentration of the standard product stock solution is 10 mg / mL.

[0051] c. Qualitative and quantitative analysis of patchouli alcohol by gas chromatography: The GC system (Agilent 7820A, USA) was equipped with an HP-5 chromatographic column (30 m × 0.25 mm, 0.25 μm film thickness) and a flame ionization detector (FID). The oven temperature was first maintained at 90 °C for 0.5 min, then gradually increased to 120 °C at a rate of 20 °C / min, then increased to 160 °C at a rate of 3 °C / min, held for 5 minutes, and finally increased to 250 °C at a rate of 20 °C / min and held for 10 min. Patchouli alcohol was quantified by the external standard method.

[0052] Biomaterials involved in the following examples:

[0053] Plasmid pPICZA-P AOX1 -loxp71-Lac-cre-66-His, that is, pZACH disclosed in the literature "Recycling of a selectable marker with a self-excisable plasmid in Pichia pastoris".

[0054] Plasmid pPICZA-P AOXm -loxp71-Lac-cre-66-His, based on the above pPICZA-P AOX1 -loxp71-Lac-cre-66-His, obtained by inserting the PAOXm promoter between the BglII and PmlI sites. The difference between PAOXm and PAOX1 is that: a cis-acting element in the region from -203 bp to -190 bp is repeated, and at the same time, the region from -777 bp to -712 bp (this region is related to glucose repression or regulation of glucose repression genes) is deleted. Specifically, the nucleotide sequence of PAOX1 is shown in SEQ ID NO.2, the nucleotide sequence of PAOXm is shown in SEQ ID NO.3, and the nucleotide sequence of TAOX is shown in SEQ ID NO.4.

[0055] Example 1: Construction of recombinant bacteria 1-8

[0056] Obtaining of the target gene: According to the nucleotide sequence of the patchouli alcohol synthase-encoding gene PTS provided on NCBI (NCBI number 589912511, 1659 bp), after specific codon optimization by the inventor, the optimized patchouli alcohol synthase-encoding gene PTS was synthesized by Shanghai Jierui Biotechnology Co., Ltd. and inserted into the plasmid pPICZA-P AOXm -loxp71-Lac-cre-66-His. The nucleotide sequence of the optimized PTS is shown in SEQ ID NO.1. The vector used in the present invention is Cre / loxP ZeoR Resistance cycling vector, insert PTS with suitable restriction sites to obtain plasmid pPICZA-P AOXm -PTS-loxp71-Lac-cre-66-His.

[0057] Using the Pichia pastoris GS115 genome as a template, with primers ERG20-F and ERG20-R, PCR amplify the nucleotide sequence of the ERG20 gene (Gene ID is 8197764), and insert it into the Cre / loxP Zeo R resistance cycling vector to obtain plasmid pPICZA-P AOXm -ERG20-loxp71-Lac-cre-66-His.

[0058] Construct a dual-expression cassette plasmid: using primers MluI-Cas-PAOX-F and MluI-Cas-TAOX-R, PCR amplify with the above PICZA-P AOXm -ERG20-loxp71-Lac-cre-66-His plasmid as a template to obtain the P AOXm -ERG20-TAOX1 expression cassette, and insert it into the MluI site of plasmid pPICZA-P AOXm -PTS-loxp71-Lac-cre-66-His to obtain pPICZA-P AOXm -ERG20-P AOXm -PTS-loxp71-Lac-cre-66-His.

[0059] Taking pPICZA-P AOXm -ERG20-GSG-PTS-loxp71-Lac-cre-66-His as an example, use primers ERG20-F, ERG20-gsg-PTS-R and PTS-gsg-ERG20-F, PTS-R respectively, and use pPICZA-P AOXm -ERG20-P AOXm -PTS-loxp71-Lac-cre-66-His as a template, PCR amplify the fragments of ER20 and PTS with Linker GSG respectively, obtain the ERG20-GSG-PTS fragment by fusion PCR, and then insert it into the Cre / loxP Zeo R resistance cycling vector to obtain plasmid pPICZA-P AOXm -ERG20-GSG-PTS-loxp71-Lac-cre-66-His. Similarly, construct plasmid pPICZA-P AOXm-PTS-GSG-ERG20-loxp71-Lac-cre-66-His, pPICZA-P AOXm -ERG20-GGGS-PTS-loxp71-Lac-cre-66-His, pPICZA-P AOXm -PTS-GGGS-ERG20-loxp71-Lac-cre-66-His, pPICZA-P AOXm -ERG20-GSGGGGS-PTS-loxp71-Lac-cre-66-His, pPICZA-P AOXm -PTS-GSGGGGS-ERG20-loxp71-Lac-cre-66-His.

[0060] The ring-shaped ligation system was transformed into Escherichia coli Top10F' competent cells, screened by zeocin-resistant plates, and verified by colony PCR and sequencing. The successful construction of the positive recombinant plasmid was obtained.

[0061] The recombinant plasmid was linearized with the restriction endonuclease Kpn2I. It was transformed into Pichia pastoris GS115 competent cells by electroporation and screened by zeocin-resistant YPD plates to obtain recombinant strains.

[0062] The vector used in this invention is a Cre / loxP ZeoR-resistant circular vector, and zeocin resistance needs to be excised before fermentation. The Pichia pastoris recombinant transformants with zeocin resistance were inoculated into BMMY liquid medium containing 1% methanol, and 1% methanol was added every 24 h for induction for 3 consecutive days. About 10 μl of the bacterial solution was streaked on the YPD plate to obtain single colonies as much as possible. It was cultured for 2 - 3 days. Single colonies were picked with toothpicks and streaked first on the YPDZ plate and then on the YPD plate. It was cultured at 30 °C for 2 - 3 days. If the single colonies only grew on the YPD plate and did not grow on the corresponding YPDZ plate, it preliminarily indicated that the Zeocin resistance of the strain was successfully excised.

[0063] Using recombinant strain 1: GS115-pPICZA-P AOXm -PTS-His as the control strain, recombinant strain 2: GS115-pPICZA-P AOXm -PTS-P AOXm -ERG20-His, recombinant strain 3: GS115-pPICZA-P AOXm -PTS-GSG-ERG20-His, recombinant strain 4: GS115-pPICZA-P AOXm -ERG20-GSG-PTS-His, recombinant strain 5: GS115-pPICZA-PAOXm -PTS-GGGS-ERG20-His, Recombinant Strain 6: GS115-pPICZA-P AOXm -ERG20-GGGS-PTS-His, Recombinant Strain 7: GS115-pPICZA-P AOXm -PTS-GSGGGGS-ERG20-His, Recombinant Strain 8: GS115-pPICZA-P AOXm Three transformants of each of the -ERG20-GSGGGGS-PTS-His strains were inoculated into 10 mL of BMGY liquid medium containing 1% glycerol at 30 °C and shaken at 250 rpm overnight. They were transferred to 25 mL of BMMY liquid medium with an initial OD = 0.5, supplemented with 1% methanol and 10% n-dodecane, and 1% methanol was added every 24 h. Fermentation was carried out for 120 h at the same temperature and rotation speed as above.

[0064] After fermentation, the upper organic layer of the fermentation broth was aspirated, centrifuged at 6000 g for 10 min, the treated sample was aspirated with a 1 mL syringe, and then filtered through an organic filter head into a sample vial for gas phase detection. Each sample was injected continuously twice. Through the standard curve, the yield of patchouli alcohol was calculated by substituting the peak value.

[0065] The results showed that compared with recombinant strain 1 (yield 4.14 mg / L) and recombinant strain 2 (yield 5.81 mg / L), the fusion expression of ERG20 and PTS could increase the yield of patchouli alcohol to a certain extent. Among them, the yields of recombinant strain 3 (yield 5.92 mg / L), recombinant strain 5 (yield 6.31 mg / L) and recombinant strain 7 (yield 6.30 mg / L) with the C-terminus of PTS connected to the N-terminus of ERG20 were slightly higher than those of recombinant strain 1 and 2; especially, the yields of recombinant strain 4 (yield 13.63 mg / L), recombinant strain 6 (yield 13.70 mg / L) and recombinant strain 8 (yield 12.91 mg / L) obtained by connecting the C-terminus of ERG20 to the N-terminus of PTS were respectively better than those of recombinant strain 3, 5 and 7 with the C-terminus of PTS connected to the N-terminus of ERG20, and the yields of patchouli alcohol were nearly 2.5 times higher. This indicates that the present invention successfully constructed a Pichia pastoris engineering bacterium for efficient production of patchouli alcohol and explored the optimal expression mode of ERG20 and PTS.

[0066] The primers used in the above method are as follows:

[0067] PTS-F: 5’-GTACT CACGTG ATGGAATTGTACGCTCAATCCG-3’

[0068] PTS-R: 5’-ATGCG GCGGCCGCTCAGTATGGAACTGGATGCAAGTA-3’

[0069] ERG20-gsg-PTS-F: 5’-ATAC GGATCTGGA ATGTCCAAAGAAGTAGCAGCTAAG-3’

[0070] PTS-gsg-ERG20-R: 5’-ACAT TCCAGATCC GTATGGAACTGGATGCAAGTACAATT-3’

[0071] PTS-gsg-ERG20-F: 5’-CAAA GGATCTGGA ATGGAATTGTACGCTCAATCCGTTG-3’

[0072] ERG20-gsg-PTS-R: 5’-CCAT TCCAGATCC TTTGGTTCTCTTGTAGATCTTGTCA-3’

[0073] ERG20-F: 5’-GTACA CACGTG ATGTCCAAAGAAGTAGCAGCTAAG-3’

[0074] ERG20-R: 5’-GTATC GCGGCCGC TTATTTGGTTCTCTTGTAGATCTT-3’

[0075] ERG20-gggs-PTS-F: 5’-ATAC GGAGGAGGATCT ATGTCCAAAGAAGTAGCAGCTAAG-3’

[0076] PTS-gggs-ERG20-R: 5’-ACAT AGATCCTCCTCC GTATGGAACTGGATGCAAGTACAA-3’

[0077] PTS-gggs-ERG20-F: 5’-CAAA GGAGGAGGATCT ATGGAATTGTACGCTCAATCCGTT-3’

[0078] ERG20-gggs-PTS-R: 5’-CCAT AGATCCTCCTCC TTTGGTTCTCTTGTAGATCTTGTC-3’

[0079] PTS-gsggggs-ERG20-F: 5’-A GGATCTGGAGGAGGAGGATCT ATGGAATTGTACGCTCAATCCGTT-3’

[0080] ERG20-gsggggs-PTS-R: 5'-CCATAGATCCTCCTCCTCCAGATCCTTTGGTTCTCTTGTAGATCTTGT-3'

[0081] ERG20-gsggggs-PTS-F: 5'-ATAC GGATCTGGAGGAGGAGGATCT ATGTCCAAAGAAGTAGCAGCTA-3'

[0082] PTS-gsggggs-ERG20-R: 5'-ACAT AGATCCTCCTCCTCCAGATCC GTATGGAACTGGATGCAAGTAC-3'

[0083] MluI-Cas-PAOX-F: 5'-GACAC ACGCGT GATCTAACATCCAAAGACGAAAGG-3'

[0084] MluI-Cas-PAOX-R: 5'-GTCTCC ACGCGT TCTCACTTAATCTTCTGTACTCTG-3'.

[0085] Example 2: Construction of Recombinant Strain 9

[0086] In order to increase the supply of precursor FPP in the cytoplasm of Pichia pastoris, in the present invention, five key enzymes of the MVA pathway from acetyl-CoA to IPP / DMAPP were overexpressed by using the above-mentioned resistance cycle vectors.

[0087] First, the present invention constructed pPICZA-P AOX1 -ERG8-loxp71-Lac-cre-66-His, pPICZA-P AOX1 -HMGR-loxp71-Lac-cre-66-His, pPICZA-P AOX1 -HMGS-loxp71-Lac-cre-66-His, pPICZA-P AOX1 -IDI1-loxp71-Lac-cre-66-His, pPICZA-P AOX1Five recombinant plasmids, namely -ERG19-loxp71-Lac-cre-66-His, were used to construct recombinant strain 9 for high-yield production of patchouli alcohol. The above gene sequences are from Pichia pastoris GS115 (the Gene ID of the coding gene for HMGS is 8198573, the Gene ID of the coding gene for HMGR is 8198637, the Gene ID of the coding gene for ERG8 is 8198218, the Gene ID of the coding gene for ERG19 is 8196843, and the Gene ID of the coding gene for IDI1 is 8197017).

[0088] The plasmid pPICZA-P with the promoter AOX1 and terminator TAOX was used in the present invention AOX1 -loxp71-Lac-cre-66-His to construct the plasmid for the expression of the above genes. Taking pPICZA-P AOX1 -ERG8-loxp71-Lac-cre-66-His as an example, primers ERG8-F and ERG8-R were used respectively, and the genomic DNA of the above Pichia pastoris was used as the template for PCR amplification, and the fragment was inserted into the corresponding restriction enzyme sites of PICZA-P AOX1 -loxp71-Lac-cre-66-His to obtain the plasmid pPICZA-P AOX1 -ERG8-loxp71-Lac-cre-66-His. Similarly, the remaining single-expression cassette plasmids pPICZA-P AOX1 -HMGS-loxp71-Lac-cre-66-His, pPICZA-P AOX1 -HMGR-loxp71-Lac-cre-66-His and pPICZA-P AOX1 -IDI1-loxp71-Lac-cre-66-His, pPICZA-P AOX1 -ERG19-loxp71-Lac-cre-66-His were constructed.

[0089] Using primers MluI-Cas-PAOX-F and MluI-Cas-TAOX-R, PCR amplification was carried out with the above pPICZA-P AOX1 -ERG8-loxp71-Lac-cre-66-His plasmid as the template to obtain the P AOX1 -ERG8-TAOX1 expression cassette, which was inserted into the MluI restriction enzyme site of the pPICZA-P [[ID=*]] AOX1 -ERG19-loxp71-Lac-cre-66-His plasmid to obtain the double-expression cassette plasmid pPICZA-P AOX1 -ERG8-P AOX1-ERG19-loxp71-Lac-cre-66-His。

[0090] The recombinant plasmid pPICZA-P AOX1 -HMGR-loxp71-Lac-cre-66-His was linearized with the restriction endonuclease Kpn2I and integrated into the His site of the recombinant bacterium 6 genome by electrotransformation to obtain the recombinant bacterium 6 with further integrated HMGR expression cassette. Referring to the above steps, using the aforementioned recombinant plasmid, the expression cassettes of HMGS, IDI1, and the double expression cassette of ERG8 and ERG19 were continuously integrated to obtain the recombinant bacterium 9. After 120 h of fermentation culture and gas phase detection, the yield of patchouli alcohol reached 63.10 mg / L, which was 4.6 times that of the recombinant bacterium 6.

[0091] The primers used in the above method are as follows:

[0092] HMGS-F: 5'-GTATCT CACGTG ATGTCTCGTCCAAGTAACATAGGTATCA-3'

[0093] HMGS-R: 5'-GTATCA GCGGCCGC TTAGTTTTTAACCTGGTATTCACGTCTGTACT-3'

[0094] HMGR-F: 5'-CGC CACGTG CTCTAGTCAAGACTTACAATTAAAATGCTTACTGGGTTGTCCAAGATATGTG-3'

[0095] HMGR-R: 5'-ATA GCGGCCGC CTCAAGATTTAATGCAAATCTTAGATTGTTCCG-3'

[0096] IDI1-F: 5'-GTATCT CACGTG ATGACTACGTCCGCGTATCAC-3'

[0097] IDI1-R: 5'-GTATCA GCGGCCGC TTACAGCATACGATCAATAGTCTCATTTCT-3'

[0098] ERG19-F: 5'-GTATCT CACGTG ATGTGTCTTCAAAGTATCGTCATTGATC-3'

[0099] ERG19-R: 5'-GTATCA GCGGCCGCTTAAGGAGCAACTAAAAACATGTCGG-3’

[0100] ERG8-F: 5’-GTACT CACGTG ATGAAAGCTTTCAGCGCTCCGAG-3’

[0101] ERG8-R: 5’-ATGCG GCGGCCGC CTATTCTGCAAATAAATAGCTCTGGA-3’.

[0102] Example 3: Construction of Recombinant Bacterium 10

[0103] Although the overexpression of the above five genes in the MVA pathway significantly increased the patchouli alcohol production of engineering bacterium 6, the further overexpression of the remaining two genes in the MVA pathway, ERG10 (Gene ID: 8197878) and ERG12 (Gene ID: 8197654), led to a decrease in patchouli alcohol production. Therefore, in order to further increase the production of patchouli alcohol and better utilize FPP accumulated in the cytoplasm to synthesize patchouli alcohol, the effects of multiple copies of ERG20LPTS and PTS on patchouli alcohol production were explored.

[0104] In order to further increase the production of patchouli alcohol in the present invention, on the basis of the above recombinant bacterium 9, the expression level of the key enzyme in the downstream pathway of patchouli alcohol synthesis in the FPP synthesis pathway in the cytoplasm of the strain was further enhanced. In the present invention, primers MluI-Cas-PAOX-F and MluI-Cas-TAOX-R were used, and PCR amplification was performed using the above pPICZA-P AOXm -PTS-loxp71-Lac-cre-66-His plasmid as a template to obtain the P AOXm -PTS-TAOX1 expression cassette, which was inserted into the MluI site of the PICZA-P AOXm -ERG20-GGGS-PTS-loxp71-Lac-cre-66-His plasmid (constructed by the method of Reference Example 1) to obtain pPICZA-P AOXm -ERG20-GGGS-PTS-P AOXm -PTS-loxp71-Lac-cre-66-His. Similarly, pPICZA-P AOXm -ERG20-GGGS-PTS-P AOXm -ERG20-GGGS-PTS-loxp71-Lac-cre-66-His was constructed.

[0105] The recombinant plasmid was linearized with the restriction endonuclease Kpn2I and integrated into the His site of the genome of recombinant strain 9 by electrotransformation.

[0106] The recombinant strain 10 was obtained by overexpressing an additional copy number of ERG20LPTS and PTS. After 120 h of fermentation culture and gas phase detection, it was found that the yield of patchouli alcohol was further increased, reaching 115.29 mg / L.

[0107] Example 4: Evaluation of the production capacity of patchouli alcohol by recombinant strain 10

[0108] To evaluate the production capacity of recombinant strain 10, fed-batch fermentation was carried out in a 5 L tank fermenter. A single colony was first inoculated into a 250 mL Erlenmeyer flask containing 50 mL of YPD medium and cultured at 30 °C and 250 rpm for about 20 hours. Then, 4% of the seed culture was transferred to a 500 mL Erlenmeyer flask containing 100 mL of YPD medium and cultured under the same conditions and for the same time. Finally, 8% of the seed culture was inoculated into the BSM medium in the 5 L fermenter for fed-batch fermentation. According to the reference protocol in the "Pichia pastoris Fermentation Process Guide" (Invitrogen), a 50% (w / v) glycerol solution containing 1.2% (v / v) of PTM1 and a methanol solution containing 1.2% (v / v) of PTM1 were used as the feeding strategy.

[0109] The fermentation process of the present invention is divided into three fermentation processes:

[0110] The first process is the batch growth stage: adjusting relevant parameters, the temperature is 30 °C, the pH is 5.5, the stirring speed is 1200 rpm, the air flow rate is 2 L / (L·min), and the dissolved oxygen (DO) concentration is maintained at 30% - 40%. Initial cell growth is carried out in the BSM medium for 18 - 24 h;

[0111] The second process is the glycerol feeding stage: adding a 50% (w / w) glycerol solution containing 1.2% (v / v) of PTM1 at a flow rate of 13 - 23 g / (L·min), appropriately adjusting the flow rate according to the dissolved oxygen concentration, and ensuring that there is no accumulation of glycerol; when OD600 reaches 300, stop adding glycerol and let the cells deplete the glycerol; the temperature, pH, stirring speed, and air flow rate are the same as above during this process;

[0112] The third process is the methanol induction stage: adjust the relevant parameters, with the temperature at 25 °C, pH at 6.0, stirring speed at 1200 rpm, air flow rate at 2 L / (L·min), dissolved oxygen concentration controlled at about 20% - 30%, and add a methanol solution containing 1.2% (v / v) of PTM1 at 50% (w / w): first, feed at a rate of 3 g / L / h, increase by 1 - 2 g / L / h every 1 - 2 h until the feeding rate reaches 8 - 9 g / L / h. If there is no methanol accumulation, this feeding rate can run through the entire remaining fermentation process and can be adjusted appropriately according to the dissolved oxygen if necessary; after culturing for 20 h, add 10% dodecane.

[0113] Through the fed-batch fermentation of the recombinant bacteria 10 in the above 5 L tank in the present invention, the yield of patchouli alcohol reaches 2.47 g / L.

[0114] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the described embodiments, and any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A method for constructing an engineered bacterium for highly efficient production of patchouli alcohol, characterized in that: Using Pichia pastoris as the starting strain, the fusion gene A is integrated into the genome of Pichia pastoris, and the MVA pathway is strengthened; wherein: The fusion gene A described above is a gene encoding farnesyl pyrophosphate synthase ERG20 and a gene encoding patchoulol synthase PTS connected to obtain; The patchouli alcohol synthase encoding gene PTS has a nucleotide sequence as shown in SEQ ID NO.1, and the farnesyl pyrophosphate synthase encoding gene ERG20 has a nucleotide sequence as shown in NCBI accession number: XP_002490436.1; The farnesyl pyrophosphate synthase encoding gene ERG20 and the patchoulol synthase encoding gene PTS are connected in the following way: the C-terminus of the farnesyl pyrophosphate synthase encoding gene ERG20 and the N-terminus of the patchoulol synthase encoding gene PTS are connected by a linker peptide; The enhanced MVA pathway is to integrate the key genes of the MVA pathway into the genome of the engineered bacterium; the key genes are HMGS , HMGR , ERG8 , ERG19 and IDI1; The Gene ID of the coding gene of HMGS is 8198573, the Gene ID of the coding gene of HMGR is 8198637, the Gene ID of the coding gene of ERG8 is 8198218, the Gene ID of the coding gene of ERG19 is 8196843, and the Gene ID of the coding gene of IDI1 is 8197017; The described construction method includes integrating two copies of the fusion gene A and one copy of the patchoulol synthase-encoding gene into the Pichia pastoris genome PTS; The Pichia pastoris described above is Pichia pastoris GS115.

2. The method for constructing an engineered bacterium for highly efficient production of patchouli alcohol according to claim 1, wherein: Fusion gene A and patchouli alcohol synthase encoding gene PTS The promoters of the expression cassettes are all AOXm promoters, and the base sequences are as shown in SEQ ID NO.

3. The terminators are all TAOX terminators, and the base sequences are as shown in SEQ ID NO.

4. The promoter of the expression cassette of the key gene in the MVA pathway is the AOX1 promoter, and the base sequence is as shown in SEQ ID NO.

2. The terminator is the TAOX terminator, and the base sequence is as shown in SEQ ID NO.4; The integration of the fusion gene A and the patchouli alcohol synthase encoding gene PTS, as well as the integration of the key genes of the MVA pathway, are all achieved through the plasmid pPICZA.

3. An engineered bacterium for efficiently producing patchouli alcohol, characterized in that: Obtained by the construction method described in any one of claims 1 to 2.

4. The application of the engineered bacterium described in claim 3 in the fermentation production of patchouli alcohol.

5. The application according to claim 4, wherein: The fermentation is as follows in a 2L system: A single colony is first inoculated into 50 mL of YPD medium and cultured at 30 ± 2 °C and 250 ± 50 rpm for 20 ± 2 hours; then, 4% of the seed culture is transferred to another 100 mL of YPD medium and cultured under the same conditions and for the same time; finally, 8% of the seed culture is inoculated into 2L of BSM medium for fed-batch fermentation.

6. The application according to claim 5, characterized in that: The fed-batch fermentation described above includes the following three fermentation processes: The first process is the batch growth stage: Adjust relevant parameters, the temperature is 30 °C, the pH is 5.5, the stirring speed is 1200 rpm, the air flow rate is 2 L / (L·min), and the dissolved oxygen concentration is maintained at 30% - 40%, and the initial cell growth is carried out in the BSM medium for 18 - 24 h; The second process is the glycerol feeding stage: A 50% w / w glycerol solution containing 1.2% v / v PTM1 is added at a flow rate of 13 - 23 g / (L·min), and the flow rate is appropriately adjusted according to the dissolved oxygen concentration to ensure that there is no accumulation of glycerol; when OD600 reaches 300, the addition of glycerol is stopped and the cells are allowed to deplete the glycerol; the temperature, pH, stirring speed, and air flow rate during this process are the same as above; The third process is the methanol induction stage: Adjust relevant parameters, the temperature is ​ The formulation of the trace metal solution PTM1 solution is as follows: 0.05% CoCl2·6H2O, 0.6% CuSO4·5H2O, 6.5% FeSO4·7H2O, 0.002% H3BO3, 0.008% NaI, 0.5% H2SO4, 0.02% Na2MoO4·2H2O, 2% ZnCl2, 0.3% MnSO4·H2O, and 0.02% biotin.