Plant attenuated mutant and its use in production of foreign protein

Abstract

The application discloses a plant attenuated mutant and application thereof in production of exogenous proteins, and belongs to the technical field of biology. The attenuated mutant is that the 182th amino acid lysine of a proteinase of a zucchini yellow mosaic virus auxiliary component is changed into arginine. The attenuated mutant of the zucchini yellow mosaic virus can be used for efficiently producing alcohol dehydrogenase (ADH) and acetaldehyde dehydrogenase (ALDH), and the plant used for production does not appear necrosis.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a plant attenuated mutant and its application in the production of exogenous proteins. Background Technology

[0002] Exogenous gene expression can achieve efficient expression of target proteins. Because plants are easy to cultivate and manage, and plant viruses do not infect livestock or humans, making them safe to use, research on the industrial and pharmaceutical production of plant-based proteins in a factory-scale manner has received considerable attention worldwide. Plant viral diseases have long plagued various agricultural production processes. Plant viruses accumulate rapidly within plants, impacting their growth and development. In recent years, the modification of plant viruses into plant virus expression vectors has garnered widespread attention. Plant virus expression vectors offer advantages such as high expression levels, rapid proliferation, ease of genetic manipulation, broad host range, and ease of purification and preservation of exogenous proteins, making them highly popular in applications. Especially in expressing oral vaccines and pharmaceutical proteins within plants, compared to other methods of producing oral vaccines and pharmaceutical proteins, they significantly reduce costs and are convenient to administer. These advantages make plants potentially the largest bioreactor for producing exogenous proteins. However, research progress on plant virus expression vectors in my country has been slow. Existing plant virus expression vectors suffer from drawbacks such as immobility or lethality, and safe and efficient plant virus expression vectors are still lacking.

[0003] Zucchini yellow mosaic virus (ZYMV) is an important member of the Potato Virus Y genus, primarily infecting cucurbitaceous crops. Amino acid mutations at certain sites in the ZYMV accessory component—the protease (HC-Pro)—significantly reduce the virus's pathogenicity. Therefore, the ZYMV mutant has the potential to be developed into a safe and efficient plant virus expression vector.

[0004] Alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) are key enzymes in the metabolism of ethanol in the human liver, together forming the ADH oxidation system. Alcohol dehydrogenase and aldehyde dehydrogenase have wide applications in food science and pharmaceutical research, resulting in significant market demand. Currently, these enzymes are mainly obtained from animal livers, but production costs are high due to severe limitations in raw materials. Exogenous expression of ADH and ALDH using microorganisms is also an option, but the proteins often fail to fold properly, leading to low protein activity. Therefore, developing new methods for producing ADH and ALDH is a current technical challenge. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide a plant attenuated mutant and its application in the production of exogenous proteins.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a virulent mutant of zucchini yellow mosaic virus, wherein the virulent mutant is formed by mutating the 182nd amino acid lysine of the zucchini yellow mosaic virus auxiliary component protease (HC-Pro) to arginine; the amino acid sequence of the mutated HC-Pro is shown in SEQ ID NO.2.

[0008] In a second aspect, the present invention provides the application of the above-mentioned attenuated mutant of the small zucchini yellow mosaic virus in the expression of exogenous proteins.

[0009] In the above applications, the exogenous protein is alcohol dehydrogenase or acetaldehyde dehydrogenase.

[0010] A third aspect of the present invention provides a method for expressing exogenous proteins using plant attenuated mutants, comprising the following steps:

[0011] (1) Insert the gene fragment expressing the exogenous protein into the attenuated mutant of zucchini yellow mosaic virus to obtain the attenuated mutant plant virus expression vector.

[0012] (2) Transform the attenuated mutant plant virus expression vector into Agrobacterium to obtain recombinant bacteria; use the recombinant bacteria to infect plants, and collect plant leaves 10-30 days after infection, and extract and purify the exogenous protein.

[0013] Preferably, in step (1), the gene fragment is a fragment containing the ADH gene or the ALDH2 gene, and its nucleotide sequence is shown in SEQ ID NO.10 or SEQ ID NO.11.

[0014] Preferably, in step (2), the plant is a cucumber, and the two cotyledons and part of the true leaves are soaked when the first true leaf of the cucumber plant is fully unfolded.

[0015] The beneficial effects of this invention are:

[0016] (1) The attenuated mutant of the zucchini yellow mosaic virus of the present invention has significantly reduced pathogenicity; however, the amount of virus accumulation in the plant is not significantly different from that of the wild type, making it suitable as a plant virus expression vector.

[0017] (2) The attenuated mutant of the zucchini yellow mosaic virus of the present invention can be used to efficiently produce alcohol dehydrogenase (ADH) and acetaldehyde dehydrogenase (ALDH). Attached Figure Description

[0018] Figure 1 ZYMV K182R Schematic diagram of the genome structure of the expression vector.

[0019] Figure 2 ZYMV K182R - The effect of ADH on the expression of exogenous proteins in plants.

[0020] Figure 3 ZYMV K182R - ALDH2 application effect diagram for expressing exogenous proteins in plants. Detailed Implementation

[0021] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0022] As mentioned earlier, expressing exogenous proteins using plant virus expression vectors has many advantages, but safe and efficient plant virus expression vectors are still lacking. Alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) are key enzymes in the human liver's ethanol metabolism, with significant market demand, but effective exogenous expression methods are currently lacking.

[0023] Based on this, the present invention has conducted in-depth research on the production of alcohol dehydrogenase and acetaldehyde dehydrogenase using plant virus expression vectors.

[0024] Zucchini yellow mosaic virus (ZYMV) has a wide host range, providing a basis for its development into a plant virus expression vector. Therefore, this invention uses ZYMV as the research object and develops and designs a weakened mutant of ZYMV. Studies have shown that mutations in the HC-Pro gene can alter the symptoms caused by ZYMV infection. Although there are reports on mutating the HC-Pro gene of ZYMV to change its infectivity, the location of the HC-Pro mutation and the resulting functional changes are unpredictable. Moreover, when using the weakened mutant of ZYMV as a plant virus expression vector to produce exogenous proteins, weakened virulence is only one of the performance requirements. To obtain superior exogenous protein expression, the viral accumulation in the plant after inoculation with the weakened mutant of ZYMV is also a key performance indicator that needs to be considered.

[0025] Based on the above performance considerations, this invention, through extensive experiments, discovered that mutating the 182nd amino acid lysine to arginine in the auxiliary component of the zucchini yellow mosaic virus—the protease (HC-Pro)—significantly reduces its pathogenicity; furthermore, the virus accumulation is not significantly different from the wild type. Therefore, the ZYMV attenuated mutant ZYMV... K182R Suitable as a plant virus expression vector for producing exogenous proteins.

[0026] The amino acid sequence of the zucchini yellow mosaic virus accessory component protease (HC-Pro) before mutation is shown in SEQ ID NO.1, and is as follows:

[0027]

[0028] The amino acid sequence of the mutated HC-Pro, an accessory component of the zucchini yellow mosaic virus, is shown in SEQ ID NO.2, and is as follows:

[0029]

[0030] ZYMV attenuated mutant ZYMV K182R Gene fragments such as ADH and ALDH2 were embedded in the vector and transferred into plants to express exogenous proteins. The results showed that ADH and ALDH2 could be efficiently expressed in plants using the expression vector, and the expressed proteins had high activity. The plants expressing exogenous proteins grew normally. Therefore, the expression of exogenous proteins using attenuated strains has a very broad application prospect, hence this invention.

[0031] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0032] The experimental materials used in the embodiments of this invention are all conventional experimental materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions were performed according to conventional experimental methods or the operating instructions recommended by the supplier. The ZYMV used in this invention has the NCBI accession number MK033873.1.

[0033] Example 1: Construction of ZYMV attenuated mutant

[0034] Using pCamZYMV-GFP as a template (constructed based on section 2.2.3 of the Master's thesis "Genetic Diversity and Pathogenicity Analysis of Yellow Mosaic Virus in Small Zucchini" from Shandong Agricultural University), a site-directed mutagenesis was performed at position 182 of the HC-Pro of ZYMV to obtain a ZYMV attenuated mutant, which was named pCamZYMV.K182R The specific method is as follows:

[0035] Mutation primers were designed, and site-directed mutations were performed on the 182nd amino acid site of HC-Pro zucchini yellow mosaic virus according to the method of Liu et al. (2008). The names and sequences of the mutated primers are shown in Table 1.

[0036] Table 1: Names and sequences of ZYMV HC-Pro mutant primers

[0037]

[0038] Among them, primers 3 and 4 performed site-directed mutations on amino acid position 182 of the ZYMV HC-Pro amino acid sequence, changing lysine to arginine.

[0039] Using pCamZYMV-GFP as a template, the PCR mutation system consisted of: 10 μL of 5×PCR Buffer, 1 μL of dNTP (10 mM), 1 μL of mutation primer F (10 μM), 1 μL of mutation primer R (10 μM), 10 ng of template plasmid, 0.3 μL of Phusion DNA polymerase, and ddH2O to a final volume of 50 μL.

[0040] PCR mutation program: 98℃ / 30sec; 98℃ / 10sec, Tmno+3℃ / 20sec, 72℃ / 5min, 20 cycles; 98℃ / 10sec; Tmpp / 20sec; 72℃ / 15min; store at 4℃.

[0041] After the mutation PCR was completed, 1 μL of Dpn I was added to each reaction system, mixed thoroughly, and digested at 37°C for 4 h.

[0042] After the PCR reaction system was treated with Dpn I, 125 μL of anhydrous ethanol (2.5 × volume) and 5 μL of 3M NaAc (pH 8.0) were added, mixed well, and the precipitate was allowed to stand overnight. The reaction was then carried out at 12000 rpm for 10 min, and the supernatant was discarded. The precipitate was washed with 1 mL of 75% ethanol and the supernatant was discarded. The precipitate was dried and dissolved in 10 μL of ddH2O.

[0043] The mutant precipitate was transformed into E. coli, and the transformed cells were evenly spread on a substrate containing Kans. + Single colonies were selected and cultured on LB agar plates containing antibiotics. Plasmids were extracted and sequenced. If the sequencing was correct, a ZYMV attenuated mutant with a 182-site mutation was obtained.

[0044] Example 2: Amplification of ADH and ALDH2 gene fragments and construction of expression vector for attenuated mutant plant viruses

[0045] 1. Amplification of ADH and ALDH2 gene fragments

[0046] Using total RNA from human blood as a template, RT-PCR was used to amplify various gene fragments. The embodiments provided in this invention were all performed under standard experimental conditions, and the primer sequences used are shown in the table below:

[0047] Table 2: Primer sequences for ADH and ALDH2 gene fragment amplification

[0048]

[0049] Primers 5 and 6 were used to amplify ADH and perform homologous recombination with ZYMV, primers 7 and 8 were used to amplify ALDH2 and perform homologous recombination with ZYMV, and primer 9 was used to add a homologous arm when ligating the amplified ADH and ALDH2 to ZYMV. The nucleotide sequence of the amplified ADH gene is shown in Seq ID No. 10, and the nucleotide sequence of the ALDH2 gene is shown in Seq ID No. 11.

[0050] Using total RNA from human blood as a template, ADH and ALDH2 gene fragments were amplified by RT-PCR.

[0051] The PCR amplification system and steps for ADH and ALDH2 genes are as follows:

[0052]

[0053]

[0054] Take a PCR tube and prepare a 50 μL amplification system using Phanta enzyme. Add 25 μL 2×Phantabuffer, 2 μL Forward Primer, 2 μL Reverse Primer, 1 μL dNTP, 1 μL infectious cloning plasmid or PCR product, 1 μL Phanta DNA polymerase, and finally add RNase-free ddH2O to a final volume of 50 μL. After preparation, gently tap to mix, briefly insulate, and place in the PCR instrument to run the Phanta enzyme amplification program.

[0055]

[0056] 2. Construction of expression vector for attenuated mutant plant viruses

[0057] pCamZYMV K182R Using the template, the homologous recombination vector was amplified. The primers used were as follows:

[0058] Table 3: ZYMV K182R Vector amplification primer sequences

[0059] Sequence (5'-3') Seq ID Number TCCTGATTGGAGCATTACAG Seq ID No.12 ACTCAGACAACTGTAGCAGACG Seq ID No.13

[0060] Primers 12 and 13 were used to amplify ZYMV. K182R Carrier.

[0061] pCamZYMV K182R Using the template, the homologous recombination vector was amplified. The amplification system and procedure were as follows:

[0062]

[0063]

[0064] After adding all materials and mixing well, place the mixture into the PCR instrument and set the running program:

[0065]

[0066] The ligation of the attenuated mutant and the gene fragment was performed. After gel extraction, the product was used to ligate the vector and fragment using homologous recombinase. The total ligation system was 10 μL, containing 5.0 μL of homologous recombinase, 2.0 μL of vector, and 3.0 μL of fragment. After mixing, the system was briefly centrifuged and incubated at 50°C for 15 min in a metal bath or run at 50°C for 15 min in a PCR instrument. The ligation product could be directly transformed into *E. coli*. The ligated plasmid was verified by sequencing to obtain pCamZYMV. K182R -ADH and pCamZYMV K182R -ALDH2 are two plant virus expression vectors.

[0067] Example 3: Plant inoculation with attenuated mutant plant virus expression vector and expression of exogenous proteins

[0068] 1. Test method:

[0069] The attenuated mutant plant virus expression vector pCamZYMV obtained in Example 2 was used. K182R -ADH and pCamZYMV K182R -ALDH2 was transformed into Agrobacterium GV3101. Recombinant bacteria were obtained after colony PCR verification. Single colonies were then inoculated into liquid LB medium containing kanamycin (50 μg / mL), rifamycin (50 μg / mL), and cultured at 28°C with shaking until the logarithmic growth phase.

[0070] The bacterial cells were collected by centrifugation and resuspended in a transfection reagent containing 10 mmol / L MgCl2, 10 mmol / L MES, and 150 μmol / L AS. The concentrations were adjusted to achieve the desired OD value. 600The concentration was approximately 0.5, and the mixture was left to stand at room temperature for 3 hours. Using a 5mL disposable syringe (without the needle), the Agrobacterium tumefaciens solution was drawn up and applied to the two cotyledons and part of the true leaves of the cucumber plant when the first true leaf had fully unfolded. The treated plants were then placed in a 23℃ light incubator (16 hours light / 8 hours dark alternation).

[0071] Wild-type ZYMV was used as a control, and transfection reagent alone was used as a mock.

[0072] The attenuated mutant plant virus expression vector pCamZYMV K182R -ADH and pCamZYMV K182R After inoculating cucumber plants with ALDH2, the symptoms of the inoculated plants were observed; virus accumulation was detected by ELISA; and gene and protein expression were detected. ADH activity was measured using an alcohol dehydrogenase detection kit (TE0473, Regen Biotech); the detection method is described in the instruction manual.

[0073] The activity of acetaldehyde dehydrogenase was determined according to the method of Lu Jian et al. (patent number CN 107815458 B), and the following detection system was prepared:

[0074]

[0075] Take a cuvette, and after the system is fully prepared, add the enzyme solution last. Then, measure the absorbance at 340 nm every minute for 4 minutes. The formula for calculating the enzyme activity in the reaction system is:

[0076]

[0077] 2. Test Results:

[0078] (1)pCamZYMV K182R -ADH vaccination results:

[0079] ZYMV was infiltrated with Agrobacterium. K182R -ADH expression vector was inoculated onto cucumbers. On day 30 after inoculation, observations of the cucumbers showed that the inoculated ZYMV... K182R Cucumber leaves expressing the -ADH expression vector exhibited mosaic and malformation. Figure 2 A), but the difference from the MOCK group was not significant.

[0080] The amount of virus accumulated in cucumber leaves was detected by ELISA on day 10 after inoculation. The results showed that, compared with the wild type, the mutation of lysine to arginine at position 182 of the auxiliary component of zucchini yellow mosaic virus (ZYMV) protease (HC-Pro) had no significant effect on the accumulation of ZYMV.

[0081] Total RNA was extracted from the collected samples. The mRNA from cucumber leaves was detected using ZYMV-NIb-F and ADH2-R primers. The sequences of the ZYMV-NIb-F and ADH2-R primers are as follows:

[0082] ZYMV-NIb-F:GAACTGGCACGCTACCTACAAG; (Seq ID No.14)

[0083] ADH2-R: ATGGTGGACCTCGTAAAACGTCAGGACGGTACG. (Seq ID No.15)

[0084] The results showed that a band the size of the ADH gene could be amplified. Figure 2 B). Western blotting analysis showed that proteins of the target size could be detected using HA antibody, and the ZYMV CP protein could also be detected using ZYMV-CP antibody. Figure 2 C).

[0085] Cucumber leaf samples were collected on days 6, 8, 10, 12, and 14 post-inoculation. Western blotting analysis showed that the accumulation of HA-tagged ADH reached its highest level on day 10. Figure 2 Therefore, samples were collected 10 days post-inoculation and protein purification was performed using agarose beads conjugated with HA antibody. The purified ADH was analyzed by SDS-PAGE, and the grayscale values ​​of the purified ADH bands were compared with those of the BSA standard sample using ImageJ. The mass of purified ADH was determined to be 13.32 μg based on the grayscale ratio and the standard curve. Figure 2 E).

[0086] The above results show that ZYMV K182R -ADH can be systematically transmitted in cucumber, expressing 13.32 μg of ADH per gram of cucumber plant leaves. The activity of purified ADH was detected using an alcohol dehydrogenase kit, and the calculated alcohol dehydrogenase activity was 1.093 U / μg / min.

[0087] (2)pCamZYMV K182R -ALDH2 vaccination results:

[0088] ZYMV was infiltrated with Agrobacterium. K182R The -ALDH2 expression vector was inoculated into cucumbers, and the cucumbers were observed 30 days later. Mosaicism was found in the leaves of the cucumber system. Figure 3A) Subsequently, total RNA was extracted from cucumber leaf samples and reverse transcribed. cDNA was then amplified by PCR using primers ZYMV-NIB-F and ALDH2-R. The sequences of primers ZYMV-NIB-F and ALDH2-R are as follows:

[0089] ZYMV-NIb-F:GAACTGGCACGCTACCTACAAG; (Seq ID No.14)

[0090] ALDH2-R ATGGTGGACCTCGTATGAGTTCTTCTGAGGCAC. (Seq ID No.16)

[0091] The results showed that a band the size of the ALDH2 gene could be amplified. Figure 3 B). Western blotting analysis at 30 days post-vaccination using HA antibody showed the detection of ALDH2, and ZYMV CP protein was also detected using ZYMV CP antibody. Figure 3 C).

[0092] Next, leaves from cucumber plants were collected on days 6, 8, 10, 12, and 14 post-inoculation, and total protein was extracted for Western blotting. The results showed that ALDH2 accumulation was highest on day 14. Figure 3 Therefore, samples were collected 14 days post-inoculation and ALDH2 was purified using HA antibody-conjugated agarose beads. The purified product was analyzed by SDS-PAGE, and the grayscale values ​​of the purified ALDH2 band were compared with those of the BSA standard sample using ImageJ. Based on the grayscale ratio and standard curve, the mass of purified ALDH2 was determined to be 10.18 μg. Figure 3 E).

[0093] The above results show that ZYMV K182R -ALDH2 can be systematically transmitted in cucumbers, expressing 10.18 μg of ALDH2 per gram of cucumber plant leaves. The acetaldehyde dehydrogenase activity was measured to be 0.049 U / μg / min using the acetaldehyde dehydrogenase activity assay.

[0094] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A method for expressing exogenous proteins using attenuated plant mutants, characterized in that, Includes the following steps: (1) Insert the gene fragment expressing the exogenous protein into the attenuated mutant of zucchini yellow mosaic virus to obtain the attenuated mutant plant virus expression vector. (2) Transform the attenuated mutant plant virus expression vector into Agrobacterium to obtain recombinant bacteria; use the recombinant bacteria to infect plants, and collect plant leaves 10-14 days after infection, and extract and purify the exogenous protein. The attenuated mutant is formed by mutating the 182nd amino acid, lysine, of the zucchini yellow mosaic virus auxiliary component-protease to arginine. The amino acid sequence of the mutated zucchini yellow mosaic virus auxiliary component-protease is shown in SEQ ID NO.

2. The exogenous protein is alcohol dehydrogenase or acetaldehyde dehydrogenase; In step (1), the gene fragment is a fragment containing the ADH gene or the ALDH2 gene, and its nucleotide sequence is shown in SEQ ID NO. 10 or SEQ ID NO. 11; the insertion position of the gene fragment is located between the NIB and CP of the attenuated mutant of the small zucchini yellow mosaic virus. In step (2), the plant is a cucumber, and the two cotyledons and part of the true leaves are soaked when the first true leaf of the cucumber plant is fully unfolded; The method of using recombinant bacteria to infect plants is as follows: the recombinant bacteria are suspended in a solution containing 10 mmol / L MgCl2, 10 mmol / L LMES and 150 μmol / L AS, the concentration is adjusted so that its OD600 is 0.4-0.6, and the solution is left to stand at room temperature for 2-4 hours, and then the plant leaves are soaked in the solution.

Images