Application of miR-1910-5p antagonists in the treatment of pathological neovascularization
By detecting miR-1910-5p biomarkers and applying antagonists, the problems of side effects and insignificant efficacy in the treatment of pathological neovascularization have been solved, enabling early diagnosis and safe and effective treatment of neovascular diseases.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-03
- Publication Date
- 2026-05-26
AI Technical Summary
Existing pathological angiogenesis mechanisms are complex, and treatment options have problems such as side effects and insignificant efficacy. In particular, in neovascular eye diseases and malignant tumors, anti-VEGF drug therapy involves intraocular injection trauma, high cost, and limited effectiveness.
The goal is to develop miR-1910-5p as a biomarker for the diagnosis and treatment of neovascular diseases. By detecting its expression level and inhibiting its function with miR-1910-5p antagonists, the occurrence and development of pathological neovascularization can be slowed down.
It improves the early diagnosis and prediction capabilities of neovascular diseases, provides safe and effective treatment options, reduces adverse reactions, and is applicable to the treatment of various neovascular eye diseases and malignant tumors.
Smart Images

Figure HDA0003780364920000011 
Figure HDA0003780364920000012 
Figure HDA0003780364920000021
Abstract
Description
Technical Field
[0001] This invention relates to the application of microRNA-1910-5p (miR-1910-5p) in the diagnosis and treatment of neovascular diseases. Background Technology
[0002] Pathological angiogenesis is a hallmark of malignant tumors and various ischemic and inflammatory diseases. Blood vessels are the body's transport system; blood delivers oxygen and nutrients to cells and removes waste products. During physiological processes such as embryonic development and tissue morphology, the continued growth of tissues and organs depends on the formation of new blood vessels. New blood vessel formation in tissues and organs mainly occurs through two pathways: angiogenesis, which refers to the formation of new blood vessels from existing ones through budding; and neovascularization, which is the process of de novo vessel formation or the formation of new blood vessels from existing ones. Both pathways are essential for the formation of vascular networks under physiological conditions and require the regulation of the relationship between pro-angiogenic and anti-angiogenic molecules to maintain a relative balance. However, in some diseases, this balance is disrupted, triggering abnormal angiogenesis and leading to pathological angiogenesis. Currently, the mechanisms of pathological angiogenesis are widely debated, and the vascular regulation mechanism is highly complex, involving multiple cellular processes and signaling pathways, and regulated by various pro- and anti-angiogenic factors. Therefore, regulating these factors and pathways may offer new targets for the treatment of pathological angiogenesis.
[0003] Pathological angiogenesis is involved in a variety of diseases, and is especially common in malignant tumors.
[0004] The role of pathological angiogenesis in malignant tumors: To maintain the high proliferative state of malignant tumor cells, tumor tissue needs to rapidly form new vascular networks to transport oxygen and necessary nutrients for growth. Tumor cells can secrete high levels of pro-angiogenic factors, which help form pathological vascular networks characterized by immaturity and high permeability, leading to discontinuous or even defective perfusion of tumor tissue and the formation of a hypoxic tumor microenvironment. This makes tumor tissue more invasive and can also hinder the tumor-killing effects of immune cells.
[0005] ① Retinoblastoma (RB): RB is the most representative ocular tumor. It is the most common primary malignant tumor of the orbit in children, accounting for approximately 3% of all childhood cancers. RB is divided into hereditary and non-hereditary types, with the hereditary type accounting for about 40%, mostly caused by a mutation in the RB1 allele. Clinical manifestations in children are mainly leukocoria and strabismus, with no racial, regional, or gender differences in incidence. In most cases, chemotherapy is the primary treatment and can be used in combination with local therapy. For children who fail chemotherapy or have advanced disease, enucleation is usually necessary. Studies have shown that angiogenesis is crucial for the progression of RB, and quantitative analysis of angiogenesis helps identify patients with a high rate of RB tumor spread. Furthermore, some studies have shown that inhibiting angiogenesis in RB tumors by targeting different sites can significantly inhibit tumor growth, metastasis, and spread.
[0006] ② Ovarian Tumors: Ovarian tumors are among the most common tumors of the female reproductive tract, with the highest mortality rate and the worst prognosis. The pathogenesis and progression mechanisms of malignant ovarian tumors are complex and diverse. Numerous studies have shown that the progressive growth and metabolism of ovarian tumors require continuous angiogenesis to maintain. Simultaneously, increased angiogenesis reflects the growth and invasion of ovarian tumors, indicating a higher tendency for metastasis and malignant progression. Anti-angiogenic therapy has become an important treatment for advanced ovarian cancer cases, with drugs such as bevacizumab and nintedanib.
[0007] ③ Colorectal Cancer: Colorectal cancer is the most common malignant tumor of the gastrointestinal tract in clinical practice, and its incidence and mortality rates are increasing year by year. Approximately 20% of colorectal cancer patients have metastases at initial diagnosis, and about 30% to 50% of patients with primary colon cancer will relapse and die from metastatic cancer. The 5-year survival rate for patients with metastatic colorectal cancer is approximately 10%. Angiogenesis plays an important role in tumor growth and metastasis of colorectal cancer. Currently, there are four FDA-approved anti-angiogenic drugs for metastatic colorectal cancer. Bevacizumab is the only anti-angiogenic drug approved by the US FDA for first-line treatment of metastatic colorectal cancer. Other anti-angiogenic agents include ramucirumab, aflibercept, and regorafenib.
[0008] ④ Nasopharyngeal carcinoma: Currently, the main treatment for nasopharyngeal carcinoma is a combination of radiotherapy and chemotherapy. Furthermore, combining this with anti-angiogenic therapy is expected to further improve the treatment outcome. Studies have shown that patients with locally advanced nasopharyngeal carcinoma who have undergone treatment with the anti-angiogenic drug bevacizumab combined with cisplatin and helical tomotherapy have achieved a complete remission rate as high as 80%, with no serious toxic side effects observed.
[0009] ⑤ Bladder Cancer: Bladder cancer is one of the most common malignant tumors of the urinary system. In recent years, with the continuous improvement of people's living standards and the extension of life expectancy, the incidence of bladder cancer has been increasing year by year. Current treatment methods for bladder cancer include radical cystectomy, radiotherapy, and chemotherapy. Despite these treatments, the 5-year survival rate remains low. In recent years, VEGF or VEGFR inhibitors have been used alone or in combination with other drugs to treat patients with advanced bladder cancer, but their efficacy still requires further research.
[0010] Furthermore, pathological neovascularization is also one of the main pathological features of neovascular eye diseases. Neovascular eye diseases are among the most difficult-to-treat ophthalmic diseases and a major cause of irreversible vision impairment. The occurrence of neovascular eye diseases is due to local ischemia and hypoxia in the eye, leading to the formation of new blood vessels. These mainly include corneal neovascularization (CNV), diabetic retinopathy (DR), age-related macular degeneration (AMD), central retinal vein occlusion (CRVO), branch retinal vein occlusion (BRVO), neovascular glaucoma (NVG), and retinopathy of prematurity (ROP). Details are as follows:
[0011] ① Corneal Neovascularization (CNV): Corneal transparency is crucial for maintaining the eye's normal refractive state. Under normal circumstances, the cornea maintains transparency in a stable "vascular-free state" under the combined influence of various factors. In certain pathological conditions, such as inflammatory diseases, chemical burns, ocular surface hypoxia caused by contact lenses, genetic diseases, congenital diseases, and limbal stem cell deficiency, the balance between corneal angiogenesis factors and angiogenesis inhibitors is disrupted, allowing the limbal capillary network to gradually invade the cornea and form CNV. It is estimated that approximately 14 million patients with corneal diseases develop corneal neovascularization each year, of whom 12% will lose vision, with severe cases leading to complete vision loss. Current clinical treatments mainly include drug therapy and surgery. Drug therapy includes anti-inflammatory drugs and vascular endothelial growth factor inhibitors, while surgical treatment primarily involves ocular surface reconstruction surgery. Despite the numerous treatment options for CNV, the results remain less than ideal.
[0012] ② Diabetic retinopathy (DR): According to the latest report from the World Health Organization, there are as many as 422 million people with diabetes worldwide, and this number is expected to reach 642 million by 2040. DR is one of the common and serious microvascular complications of diabetes. Based on the degree of damage to the retinal blood vessels, the disease is divided into nonproliferative diabetic retinopathy (NPDR) and proliferative diabetic retinopathy (PDR). NPDR is characterized by tortuous blood vessels, retinal hemorrhage, microaneurysms, and lipid exudation. When abnormal neovascularization occurs, it develops into PDR. Current local treatment interventions mainly include intravitreal injection of anti-vascular endothelial growth factor (VEGF) drugs, glucocorticoids, and laser photocoagulation. These methods can, to some extent, slow the progression of the disease and salvage the visual function of some patients.
[0013] ③ Age-related macular degeneration (AMD): AMD is one of the leading causes of vision loss in the elderly worldwide. The incidence of AMD is increasing year by year. This disease is characterized by degeneration of the retinal pigment epithelium and atrophy of photoreceptors in the macular region, ultimately leading to irreversible central vision loss. Age-related macular degeneration can be divided into dry and wet types, with choroidal neovascularization being the main characteristic of wet AMD. Currently, treatment methods for wet AMD include laser photocoagulation, photodynamic therapy, drug therapy, and surgery. Anti-VEGF therapy has become the first-line treatment for wet AMD, but anti-VEGF drugs are expensive, and some patients still require repeated intravitreal injections; ineffective and refractory cases are also not uncommon.
[0014] ③ Retinal Vein Occlusion: Retinal vein occlusion (RVO) is a common retinal vascular disorder characterized by retinal vein filling, proximal vessel occlusion, and distal vessel dilation. The retina becomes ischemic and hypoxic, leading to hemorrhage and edema. Based on the location of the occluded vessel, RVO can be divided into central retinal vein occlusion (CRVO) and branch retinal vein occlusion (BRVO), with the latter being more common. The incidence of RVO is as high as 0.86%-1.63%, and the incidence increases with age. Intravitreal injection of anti-VEGF drugs is currently the primary treatment for RVO complicated by macular edema. Anti-VEGF drugs mainly work by binding to VEGF receptors, inhibiting angiogenesis, and reducing the degree of macular edema, thereby effectively improving vision.
[0015] ⑤ Neovascular glaucoma: This is a common and refractory type of glaucoma in ophthalmology, usually secondary to RVO, DR, old retinal detachment, and ocular tumors. Its incidence increases year by year with the increase in the incidence of the primary disease. Its typical clinical features are iris neovascularization and varying degrees of intraocular pressure elevation. Patients usually experience severe pain, serious vision impairment, and even loss of light perception. Early control of the primary disease and the use of various methods to lower intraocular pressure are currently the main treatment options. Anti-VEGF drugs can also be used to reduce intraoperative bleeding and the occurrence of intraoperative and postoperative complications.
[0016] In summary, the pathogenesis of pathological neovascularization-related diseases is complex, and treatment regimens vary in clinical applicability and side effects. Therefore, clinical practice should employ multi-target anti-angiogenic therapy based on the patient's specific condition. Currently, anti-VEGF drugs, represented by ranibizumab, bevacizumab, and pazopanib, are widely used as first-line treatments for pathological neovascularization, but they still have certain side effects. For example, in neovascular eye diseases, anti-VEGF drugs require: 1. repeated intraocular injections, which are invasive procedures and can cause complications such as endophthalmitis, intraocular pressure elevation, and retinal detachment; 2. high cost, limiting treatment for some patients; and 3. poor efficacy against existing pathological vessels, with minimal effect in some patients.
[0017] Therefore, actively exploring new angiogenesis regulation pathways has always been the breakthrough point in the treatment of pathological neovascularization. Clinically, there is an urgent need for another drug that can target, effectively and safely intervene in and treat pathological neovascularization, and can be used as a supplementary treatment when anti-VEGF therapy cannot achieve ideal results.
[0018] MicroRNAs (miRNAs) play a crucial role in pathological angiogenesis. miRNAs are key molecules regulating signal transduction pathways. Essentially, they are small, endogenous non-coding RNA molecules synthesized within cells, cleaved, transported to the cytoplasm, and further cleaved into mature miRNAs. Mature miRNAs bind to target messenger RNA molecules (mRNAs), causing degradation or translational repression of the target mRNA, thus playing a vital role in the post-transcriptional regulation of gene expression. Notably, a common characteristic of miRNAs is their ability to target hundreds or even thousands of genes pleiotropically, with some acting in organ- or cell-specific ways. Currently, numerous studies have demonstrated the important regulatory roles of miRNAs in various diseases, such as malignant tumors, cardiovascular diseases, neurodegenerative diseases, and retinal diseases. Research has shown that miRNA expression differs significantly between normal physiological and pathological conditions of the eye, playing a crucial regulatory role in neovascular eye diseases such as CNV, DR, and RB. Furthermore, small nucleic acid drugs based on miRNAs have been used in clinical treatment. Small nucleic acid drugs represent a completely new class of drugs, distinct from small molecule drugs and antibody drugs. Their composition is a nucleotide sequence, and their mechanism of action involves acting on mRNA to inhibit the expression of target proteins through gene silencing, thereby achieving therapeutic goals. In 2021, the world's first miRNA and its antagonist, the miR-132 antagonist CDR123L, was used clinically to treat heart failure. Currently, there are still some gaps in the field of small nucleic acid-based drug therapy for neovascular diseases; therefore, developing a miRNA-based drug to alleviate neovascular diseases is of great significance. Summary of the Invention
[0019] The purpose of this invention is to provide a biomarker for neovascular diseases, miR-1910-5p, and its application in the diagnosis and treatment of neovascular diseases.
[0020] To achieve the above objective, the technical solution adopted is as follows: a biomarker for neovascular diseases, wherein the biomarker is miR-1910-5p, and the nucleotide sequence of miR-1910-5p is shown in SEQ ID NO:1.
[0021] This invention provides the application of miR-1910-5p as a biomarker in the preparation of reagents or kits for the diagnosis or prognosis of neovascular diseases.
[0022] Preferably, the nucleotide sequence of miR-1910-5p is as shown in SEQ ID NO:1 (CCAGUCCUGUGCCUGCCGCCU).
[0023] This invention provides the application of a reagent for detecting miR-1910-5p expression levels in the preparation of products for the diagnosis or prognosis of neovascular diseases.
[0024] Preferably, the reagent for detecting miR-1910-5p expression level includes the MiR-X miRNA First-Strand Synthesis Kit (Clontech Laboratories Inc.), with the forward primer 5'-3' sequence: CAGTCCTGTGCCTGCCGC, and the reverse primer provided by the MiR-X miRNA First-Strand Synthesis Kit.
[0025] Preferably, the product is a reagent kit.
[0026] This invention provides the application of miR-1910-5p antagonists in the preparation of medicaments for treating neovascular diseases.
[0027] Preferably, the sequence of the miR-1910-5p antagonist is as shown in SEQ ID NO:3 (AGGCGGCAGGCACAGGACUGG). More preferably, at least one nucleotide in the sequence of the miR-1910-5p antagonist is modified. More preferably, the modification is at least one of thiomodification and cholesterol modification. More preferably, the sequence of the miR-1910-5p antagonist is: A * G * GCGGCAGGCACAGGA * C * U * G * G, * indicates that the nucleotide has been modified with thio.
[0028] Preferably, the neovascular disease is ocular neovascularization or a tumor; preferably, the ocular neovascularization is corneal neovascularization or retinal neovascularization, and the tumor is a tumor related to neovascularization.
[0029] Preferably, the tumor is a tumor involving vascular endothelial cells. More preferably, the tumor is a malignant tumor. Even more preferably, the tumor is retinoblastoma, human cervical cancer, nasopharyngeal carcinoma, or bladder cancer.
[0030] This invention provides a product for the diagnosis or prognosis of neovascular diseases, including a reagent for detecting the expression level of miR-1910-5p.
[0031] This invention provides a medicament for treating neovascular diseases, comprising a miR-1910-5p antagonist. Preferably, the sequence of the miR-1910-5p antagonist is shown in SEQ ID NO:3. More preferably, at least one nucleotide in the sequence of the miR-1910-5p antagonist is modified. More preferably, the modification is at least one of thiomodification and cholesterol modification. More preferably, the sequence of the miR-1910-5p antagonist is: A * G * GCGGCAGGCACAGGA * C * U * G * G, * indicates that the nucleotide has been modified with thio.
[0032] Beneficial effects:
[0033] This invention discovers and provides a novel endogenous small molecule biomarker for neovascular diseases, miR-1910-5p, and its applications. Detecting its expression level helps in the early prediction of neovascular diseases, greatly improving the timeliness of diagnosis and treatment. Detecting its expression level also provides a reference for the diagnosis and prognosis of early neovascular eye diseases (including CNV and retinal neovascularization) and malignant tumors (retinoblastoma, human cervical cancer, nasopharyngeal carcinoma, bladder cancer, and all other tumors related to neovascularization).
[0034] This invention provides a miR-1910-5p antagonist for treating neovascular diseases and its application. The miR-1910-5p antagonist is a small nucleic acid drug based on miRNA. By inhibiting the expression of miR-1910-5p, it weakens the silencing effect on genes related to inhibiting angiogenesis, thereby slowing down the occurrence and development of early neovascularization. This achieves the purpose of inhibiting the development of pathological neovascularization in the eye and malignant tumors. Compared with other drugs, it avoids the adverse reactions of other drugs and can effectively and safely inhibit the occurrence and development of pathological neovascularization.
[0035] In addition, miR-1910-5p antagonists can be used in clinical treatment of neovascular eye diseases and malignant tumors caused by different reasons and under different clinical backgrounds, and they have the advantages of good therapeutic effect and high safety. Attached Figure Description
[0036] Figure 1 miR-1910-5p promotes angiogenesis in human venous endothelial cells (HUVECs).
[0037] Figure 2 miR-1910-5p is increased in body fluid and tissue samples of pathological angiogenesis-related diseases.
[0038] Figure 3 miR-1910-5p expression is increased in neovascularized corneas of mice, and miR-1910-5p antagonists can slow the progression of corneal neovascularization in vivo.
[0039] Figure 4 miR-1910-5p expression is increased in the neovascularized retina of mice, and miR-1910-5p antagonists can slow the progression of retinal neovascularization in vivo.
[0040] Figure 5 The effect of miR-1910-5p antagonists on inhibiting the growth and angiogenesis of retinoblastoma in vivo.
[0041] Figure 6 The miR-1910-5p antagonist slows down the growth and angiogenesis of cervical cancer in vivo.
[0042] Figure 7 The miR-1910-5p antagonist slows down the growth and angiogenesis of nasopharyngeal carcinoma in vivo.
[0043] Figure 8 miR-1910-5p antagonists have the effect of slowing the growth and angiogenesis of bladder cancer in vivo. Detailed Implementation
[0044] To better illustrate the purpose, technical solution, and advantages of this invention, the invention will be further described below in conjunction with the accompanying drawings and specific embodiments. Unless otherwise specified, all raw materials involved in the following embodiments are commercially available general products. The 1910-5p antagonist is the miR-1910-5p antagonist.
[0045] Example 1: miR-1910-5p mimics promote the proliferation, migration and tube formation of vascular endothelial cells in vitro, while their inhibitors can alleviate the above phenotypes.
[0046] Vascular endothelial cells play a crucial role in pathological angiogenesis and can serve as ideal therapeutic targets in diseases such as neovascular eye diseases and malignant tumors. First, we used in vitro cell proliferation, scratch, and tube formation assays to clarify the effects of miR-1910-5p on human vascular endothelial cells. The validation was conducted from the following aspects:
[0047] (1) HUVEC culture:
[0048] HUVECs were cultured in ECM medium containing 1% ECGS and 5% FBS at a constant temperature of 37°C, saturated humidity, and 5% CO2 to allow for adherent cell growth. Cells were passaged using trypsin digestion, with passages every 3–4 days.
[0049] (2) HUVEC transfection:
[0050] miR-1910-5p mimic (5'-3' sequence: CCAGUCCUGUGCCUGCCGCCU) and mimic control (5'-3' sequence: UUUGUACUACACAAAAGUACUG), miR-1910-5p inhibitor (5'-3' sequence: AGGCGGCAGGCACAGGACUGG) and miR-1910-5p inhibitor control (5'-3' sequence: CAGUACUUUUGUGUAGUACAAA) were all purchased from Qingke Biotechnology (Guangzhou, China). The specific steps follow the Lipofectamine 3000 small RNA transfection protocol, as follows: ① Prepare the liposome complex: Dilute the Lipo3000 reagent with an appropriate amount of Opti medium and mix thoroughly; ② Prepare the small RNA premix: Dilute the miR-1910-5p mimic and control with an equal volume of Opti medium to a final concentration of 50 nM, and dilute the miR-1910-5p inhibitor and control to a final concentration of 100 nM, and mix thoroughly; ③ Prepare the small RNA-lipid complex: Add the small RNA premix to the liposome complex (1:1 ratio) and incubate at 37°C for 15 minutes; ④ Transfection: Add the small RNA-lipid complex to HUVEC and treat for 24–72 hours.
[0051] (3) Experiment on the effect of miR-1910-5p mimic on promoting vascular endothelial cell migration:
[0052] HUVECs were seeded into six-well plates. When the cell density reached 90% confluence, the medium was replaced with serum-free ECM and cultured for another 24 hours. When the cell density approached 100% confluence, a sterile ruler was placed on the surface of the six-well plate, and a 200 μL micropipette tip was used to draw a straight line perpendicular to the plate with the same force in each well, creating a cell-free area. After the scratching, the cells were washed three times with PBS to remove any detached or suspended cells. At this point, an image was taken under an optical microscope and recorded as hour 0. After taking the image, HUVECs were transfected with miR-1910-5p mimics and their controls, as well as the inhibitor and its control, following the same transfection method described above. The cells were then cultured at 37°C in a 5% CO2 incubator. At 24 hours, an image was taken under a microscope to record the migration of cells from each well to the scratched area, ensuring the location was the same as at hour 0. The area of the scratched area was statistically analyzed using ImageJ software, and the migration rate at different time points was calculated. Migration rate = (Original scratch area - Scratch area at each time point) / Original scratch area × 100%.
[0053] Figure 1Figures A and B in the middle show representative images and statistical analysis of HUVECs under optical microscopes at 0h and 24h after different treatments. It can be seen that compared with the corresponding control group, the miR-1910-5p mimic can promote HUVEC migration, while the miR-1910-5p inhibitor has an inhibitory effect on HUVEC migration (scale bar: 100μm).
[0054] (4) Experiment on the effect of miR-1910-5p mimic on promoting vascular endothelial cell tube formation:
[0055] Matrigel was thawed overnight at 4°C. HUVEC cells were then transfected with miR-1910-5p mimics and controls according to the HUVEC transfection method described above for 24 hours. The following day, 50 μL Matrigel was added to each well of a pre-chilled 96-well plate and incubated for 2 hours at 5% CO2, 21% O2, and 37°C to allow the Matrigel to solidify. Simultaneously, the transfected cells were digested after 24 hours and then cultured at 4 × 10⁻⁶ cells / well. 4 Cells / well were cultured in 96-well plates for 6 hours. The formation of the vascular network was then observed and photographed under a microscope. Three fields of view were randomly selected from each well. ImageJ software was used to statistically analyze the vascular network nodes, connections, and network count. Each experiment was repeated three times with three replicate wells.
[0056] Figure 1 The middle CD represents representative images of HUVECs under an optical microscope during tube formation experiments treated with different mixed culture media, along with statistical analysis of the number of branch nodes, connections, and vascular network lumens formed. Similar to the results of the scratch assay, the miR-1910-5p simulant promoted HUVEC tube formation, significantly increasing the number of nodes, connections, and vascular network lumens formed (scale bar 100 μm).
[0057] (5) Experiment on the promotion of angiogenesis in the aortic rings of mice by miR-1910-5p mimic.
[0058] C57 / BL6J mice were euthanized by cervical dislocation. The mice were soaked in 75% alcohol for 15 minutes. Under a stereomicroscope on a clean bench, the mouse thoracic aorta was bluntly dissected. Excess fat, tissue, and microvascular branches around the blood vessels were carefully removed using microscissors and ophthalmic forceps, taking care to avoid excessive traction that could damage the aorta. The dissected aorta was transferred to pre-cooled serum-free culture medium, and excess blood was gently flushed out using a 1ml sterile syringe. The aorta should be kept moist throughout the process. After removing the thoracic aorta, it was placed in pre-warmed type II collagenase (2g / L) and incubated at 37°C for 6–7 minutes until the adventitia loosened. Then, the adventitia was gently grasped with ophthalmic forceps and gently pulled away in the opposite direction, similar to "removing a sleeve." Arterial rings were cut into approximately 0.5 mm long pieces, and placed in serum-free culture medium. Simultaneously, miR-1910-5p mimics and controls (to a final concentration of 100 nM) were transferred to each aortic ring using the HUVEC transfection method described above. The rings were then incubated at 37°C in a 5% CO2 incubator for 24 hours. The next day, Matrigel gel containing growth factors was dissolved on ice. 50 μL of Matrigel gel was added to each well of a 96-well plate, and the plate was incubated at 37°C for 15 minutes to allow Matrigel polymerization. After the Matrigel gel solidified, an aortic ring was placed in each well, and another 50 μL of Matrigel was added to cover each ring. The 96-well plate was then returned to the 37°C incubator for 15 minutes. Once Matrigel polymerization had occurred, 100 μL of DMEM medium containing 10% FBS was added to each well. The growth status of the aortic rings, the number of newly formed microvessels, and branching were observed and recorded daily under a bright-field microscope.
[0059] Figure 1 Image E shows representative images and statistical analysis of neovascularization area in the mouse aorta after different treatments. The mouse aortic angiogenesis experiment indicates that, compared with the control group, the miR-1910-5p mimic significantly promoted budding and significantly increased the neovascularization area.
[0060] (6) Experiment on the effect of miR-1910-5p mimic on the proliferation of vascular endothelial cells:
[0061] After transfecting HUVEC cells with miR-1910-5p mimics and their controls according to the above HUVEC transfection method for 24 hours, at a dose of 2×10⁻⁶... 3Cells / well were cultured in 96-well plates. After 24, 48, and 72 hours of culture, 10 μL of CCK8 solution was added to each well, and the cells were incubated for 2–4 hours. During this period, the color change of the culture medium was observed, and the absorbance at 450 nm was measured using a microplate reader (Bio-Tek, USA). Each experiment was repeated three times, with three replicate wells.
[0062] The activity of CCK-8 cells was measured using the above method, and the results are as follows: Figure 1 As shown in F, Figure 1 The middle F represents the growth and proliferation of vascular endothelial cells 24 hours after transfection. Cell viability assays using CCK-8 assays show that the miR-1910-5p mimic significantly promoted the proliferation of HUVECs compared to its control.
[0063] The above in vitro experiments show that miR-1910-5p mimics can promote the proliferation, migration, and tube formation of vascular endothelial cells, while their inhibitors can effectively weaken these functions. Therefore, miR-1910-5p holds promise as a therapeutic target for neovascular diseases.
[0064] Example 2: miR-1910-5p was increased in body fluid and tissue samples of pathological angiogenesis-related diseases.
[0065] 1. miR-1910-5p expression is significantly increased in the tear fluid of patients with corneal neovascularization.
[0066] Tear collection: Twelve patients with corneal neovascularization who visited the Ophthalmology Outpatient Department of the Second Affiliated Hospital of Guangzhou Medical University between June and November 2021 were selected as study subjects (diseases included: corneal leukoma, fungal keratitis, post-corneal transplant rejection, ocular trauma, etc.). Twelve patients with normal ocular surface structure and function were selected as control subjects. The patients were randomly divided into three groups. Sterile, disposable capillary tear collection devices were used to collect tears from each patient. Tears from four patients in each group were mixed to form one sample and stored at -80°C. RNA was extracted from all collected tear samples. Tear sample extraction was approved by the Medical Ethics Committee of the Second Affiliated Hospital of Guangzhou Medical University (ethics number: 2021-hs-63-02).
[0067] The results are as follows Figure 2 As shown: Figure 2 In the middle section, "A" refers to the diagnostic name for an eye disease accompanied by corneal neovascularization. Figure 2 Image B is a representative image of the anterior segment of a patient with corneal neovascularization. Figure 2 C represents the expression of miR-1910-5p in the patient's tears. Figure 2As can be seen from the C-cell curve, the content of miR-1910-5p in the tears of patients with corneal neovascularization was significantly increased, and its relative expression level was approximately (11.21±2.05) times that of the control group.
[0068] 2. miR-1910-5p expression was significantly increased in the vitreous fluid of patients with diabetic retinopathy.
[0069] Vitreous Fluid Collection: Twelve patients diagnosed with diabetic retinopathy and treated at the Department of Ophthalmology, The Second Affiliated Hospital of Guangzhou Medical University, between June and November 2021 were selected as the study subjects. Simultaneously, twelve patients who underwent vitrectomy without retinal neovascularization were selected as the control group. The patients were randomly divided into three groups. Vitreous fluid collection was performed using a 23G needle (equivalent to a 2ml syringe), connected to a 1ml syringe plunger. The needle was inserted obliquely through the sclera at a depth of 4.0mm (3.5mm for aphakic eyes) beyond the lower limbus, and then vertically advanced approximately half the needle length into the vitreous cavity. The needle was withdrawn, and 0.3ml of vitreous fluid was extracted. Vitreous fluid samples from four patients in each group were combined and stored at -80°C. RNA was extracted after collecting and mixing all samples. The vitreous fluid sample extraction procedure was approved by the Medical Ethics Committee of The Second Affiliated Hospital of Guangzhou Medical University.
[0070] The results are as follows Figure 2 As shown in Figure D, the content of miR-1910-5p in the vitreous fluid of DR patients was significantly increased, and its relative expression level was approximately (1.98±1.20) times that of the control group.
[0071] 3. miR-1910-5p was highly expressed in nude mouse xenograft models of retinoblastoma (WERI-RB) and human cervical cancer (HeLa).
[0072] For specific experimental methods, please refer to Examples 5 and 6. The results are as follows: Figure 2 As shown in Figure E: The expression level of miR-1910-5p was quantitatively detected by real-time PCR. Tumor tissues from a nude mouse xenograft model of retinoblastoma and human cervical cancer cells were used as experimental groups, while normal mouse retina and uterine tissues were used as control groups. The results showed that the expression level of miR-1910-5p was increased by approximately 1.41±0.02 and 1.53±0.02 times, respectively, compared with the control tissues.
[0073] The above experimental results show that miR-1910-5p can serve as a biomarker for pathological neovascularization-related diseases such as corneal neovascularization, retinal neovascularization, retinoblastoma, and human cervical cancer cells, and can provide new insights for the diagnosis and treatment of these diseases.
[0074] Example 3: The effect of miR-1910-5p antagonist on inhibiting corneal neovascularization in vivo.
[0075] (1) Establish a mouse model of corneal neovascularization induced by corneal alkali burn.
[0076] To further verify the role of miR-1910-5p in corneal neovascularization and whether its antagonists can slow down neovascularization, a mouse corneal neovascularization model induced by alkali burns was used. The specific method was as follows: C57 / BL6J mice were used. A 2mm diameter circular filter paper was soaked in 1.0mol / L NaOH solution, removed with sterile forceps, and excess alkali was wiped off with a cotton swab. The paper was then applied to the center of the right cornea of the mouse and timed for 40 seconds. The filter paper was then removed, creating a grayish-white alkali burn area of equal size. The eyeball and conjunctival sac were then rinsed with physiological saline for 1 minute. The right cornea of each mouse underwent alkali chemical burn treatment, while the left eye was left untreated.
[0077] All animal experimental procedures strictly followed the "Ethical Regulations for the Use of Animals" issued by Zhongshan Ophthalmic Center of Sun Yat-sen University, with ethics number SYXK(YUE)2019-166. All animal husbandry, experimental procedures, and euthanasia principles complied with the "Requirements for Animal Experimentation Handling Regulations" issued by the Association for the Study of Vision and Ophthalmology (ARVO).
[0078] (2) miR-1910-5p expression was significantly increased in neovascular cornea.
[0079] The model was established according to the above method. Corneal tissue samples were collected on days 0, 4, and 8 after modeling to extract corneal RNA. The expression level of miR-1910-5p was quantitatively detected by real-time quantitative PCR. The kit for detecting the expression level of miR-1910-5p was the MiR-XTM miRNA First-Strand Synthesis Kit (Clontech Laboratories Inc.). The forward primer 5'-3' sequence was: CAGTCCTGTGCCTGCCGC, and the reverse primer was provided by the kit.
[0080] The results are as follows Figure 3 As shown ( Figure 3 In a mouse model of corneal neovascularization, a alkali burn was used to construct the model. Over time, the expression of corneal miR-1910-5p increased significantly, increasing by about 1.52 times compared to the unmodeled cornea at 4 days and by about 2.40 times at 8 days.
[0081] (3) miR-1910-5p antagonists can slow down the development of corneal neovascularization.
[0082] On days 2 and 4 after modeling as described above, mice were injected subconjunctivally with physiological saline (10 μl) and miR-1910-5p antagonist (sequence: A). * G * GCGGCAGGCACAGGA * C * U * G * G, * indicates that the nucleotide is thiolated) and its control (sequence: UCUACUCUUUCUAGGAGGUUGUGA) (10ul, 5nmol). On day 4 of modeling, obvious scarring was visible on the corneal surface of the modeled mice, accompanied by corneal neovascularization growing towards the center of the cornea. On day 10 of modeling, the above three groups of experimental mice were sacrificed, and the following indicators were mainly detected: ① Anterior segment photography of mice: to observe the degree of inflammation, degree of opacity, number, length and area of neovascularization after corneal alkali burn; ② Expression level of miR-1910-5p in neovascular cornea; ③ Immunofluorescence staining of corneal smears with CD31 to detect neovascularization and use it for quantitative analysis. The specific process of corneal smearing is as follows: the muscles, fascia and other tissues on the surface of fresh eyeball tissue were trimmed, the eyeball was fixed in 4% paraformaldehyde for 1 hour and then transferred to PBS, and excess tissue was carefully removed with forceps. Under a surgical microscope, a puncture knife was used to puncture the pericorneal area to release the internal pressure of the eyeball. The anterior portion of the eye is cut from the posterior part of the eyeball using surgical scissors, preserving the limbus. The cornea is then fixed in 4% paraformaldehyde for 20 minutes. It is blocked with 5% BSA for 1 hour, incubated overnight at 4°C with primary antibody (CD31, BDPharmingen, catalog number 553370), and the next day incubated with secondary antibody at room temperature for 2 hours (Alexa Fluor 488, Invitrogen, catalog number A-21434). Corneal slice images are acquired using a Nikon microscope, and the area of corneal neovascularization is statistically analyzed using ImageJ.
[0083] Figure 3 Figures B and C show anterior segment photography and corneal slide immunofluorescence staining and their statistical analysis, respectively. On day 10 of alkali burn modeling, anterior segment photography showed that the degree of neovascularization was significantly reduced in the subconjunctival injection group of miR-1910-5p antagonist compared with the blank group and the control group; the CD31 quantitative results of corneal slide immunofluorescence staining also indicated that the corneal neovascularization area was significantly reduced in the subconjunctival injection group of miR-1910-5p antagonist.
[0084] The above experimental results show that subconjunctival injection of miR-1910-5p antagonist can reduce the development of corneal neovascularization to a certain extent, indicating that miR-1910-5p antagonist can be used to treat corneal neovascularization.
[0085] Example 4: The effect of miR-1910-5p antagonist on inhibiting retinal neovascularization in vivo.
[0086] (1) Establish a mouse model of oxygen-induced retinopathy (OIR).
[0087] Newborn C57BL / 6J mice were randomly divided into a control group, an antagonist control group, and a miR-1910-5p antagonist group. On day 7 after birth, the mice, along with their lactating mothers, were placed in an animal experimental chamber connected to an oxygen analyzer. O2 was introduced at a flow rate of 1.5 L / min. After several chamber washes, the oxygen concentration was stabilized at 75% ± 2%, the chamber temperature was maintained at 23 ± 2°C, and sunlight was provided. The oxygen chamber was regularly opened daily for cleaning, dressing changes (to keep it dry), and food and water changes. Normal lactating mothers were alternated with those in the chamber. On day 15 after birth, the mice and their lactating mothers were returned to a normal air environment (21% O2) to induce retinal neovascularization. The specific method of intravitreal injection in mice is as follows:
[0088] Under a dissecting microscope, the mouse's head was fixed in position to fully expose the eyeball. A scleral puncture was performed 1 mm posterior to the corneal limbus, avoiding blood vessels. A 33G Hamilton microinjector was inserted obliquely into the vitreous cavity at approximately a 45-degree angle, avoiding the lens. While keeping the needle stationary, the syringe was slowly injected to allow for a slow release of the medication. After injection, the needle was slowly withdrawn after 30 seconds. The puncture site was immediately sealed with a sterile cotton swab and the conjunctiva covered. Postoperatively, hydroxymethylcellulose gel was applied to the eye to ensure the ocular surface remained moist until the mouse recovered. The mouse was returned to its cage after full recovery. An electric heating blanket was used during the surgery and recovery process to maintain warmth and ensure successful recovery, preventing postoperative illness and death.
[0089] All animal experimental procedures strictly followed the "Ethical Regulations for the Use of Animals" issued by Zhongshan Ophthalmic Center of Sun Yat-sen University, with ethics number SYXK(YUE)2019-166. All animal husbandry, experimental procedures, and euthanasia principles complied with the "Requirements for Animal Experimentation Handling Regulations" issued by the Association for the Study of Vision and Ophthalmology (ARVO).
[0090] Modeling was performed according to the above method. Retinal RNA was extracted on days 12 and 15 after modeling. The expression level of miR-1910-5p was quantitatively detected by real-time quantitative PCR (qPCR). The kit used was theMiR-X miRNA First-Strand Synthesis Kit (Clontech Laboratories Inc.). The forward primer 5'-3' sequence was: CAGTCCTGTGCCTGCCGC, and the reverse primer was provided by the kit.
[0091] The results are as follows Figure 4 As shown ( Figure 4 In a mouse retinal neovascularization model constructed in vivo via oxygen induction, the expression of miR-1910-5p in the retina significantly increased over time, increasing by approximately 1.77 times compared to the unmodeled retina at 12 days and by approximately 3.73 times at 15 days.
[0092] (2) miR-1910-5p antagonists can slow down the development of retinal neovascularization.
[0093] In newly induced mice, inject 5 μl of physiological saline into the vitreous cavity and administer miR-1910-5p antagonist (sequence: A) to the vitreous cavity. * G * GCGGCAGGCACAGGA * C * U * G * G, * indicates that the nucleotide is thiolated) and its control (sequence: UCUACUCUUUCUAGGAGGUUGUGA) (5ul, 5nmol), once every 4 days, for a total of 2 injections.
[0094] Fifteen days later, the mice in the three groups were sacrificed, and their eyeballs were fixed and frozen for sectioning. Immunofluorescence staining was performed on the sections, following this procedure: Muscles, fascia, and other tissues on the surface of the fresh eyeball were trimmed. The eyeballs were fixed with 4% freshly prepared PFA and incubated overnight at 4°C. The next day, the eyeballs were dehydrated for 2 hours with 10% sucrose solution, followed by overnight dehydration with 30% sucrose solution. The dehydrated eyeball tissue was then immersed in OCT embedding gel. After the OCT was completely embedded in the eyeball tissue, the embedding mold was placed in a -80°C freezer. After the tissue was completely frozen, it was sectioned. Using a cryostat, the eyeball tissue was cut into 10μm thick sections, labeled, and stored at -80°C for later use. The specific steps for immunofluorescence are as follows: After eluting OCT from the slides, they were blocked with 5% BSA for 1 hour, incubated overnight at 4°C with primary antibody (CD31, BD Pharmingen, catalog number 553370), and then incubated with secondary antibody at room temperature for 2 hours the next day (Alexa Fluor 488, Invitrogen, catalog number A-21434). After photographing, the area of neovascularization was statistically analyzed using ImageJ.
[0095] Test results as follows Figure 4 As shown in Figures A and C. On day 15 of OIR, immunofluorescence staining and CD31 quantification of retinal frozen sections showed a significant reduction in neovascularization area in the intravitreal injection group of miR-1910-5p antagonist. These experimental results demonstrate that intravitreal injection of miR-1910-5p antagonist can effectively inhibit the development of retinal neovascularization, indicating that miR-1910-5p antagonist can be used to treat retinal neovascularization.
[0096] Example 5: miR-1910-5p antagonist inhibits angiogenesis and growth of retinoblastoma in vivo.
[0097] (1) Culture of human retinoblastoma cell line (WERI-Rb1).
[0098] The human retinoblastoma cell line WERI-Rb1 was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in an RPMI-1640 (Gibco, CA, USA) containing 10% fetal bovine serum (FBS). It was then cultured in a 37°C cell culture incubator containing a mixture of 21% O2, 5% CO2, and 94% N2.
[0099] (2) Establish a nude mouse xenograft model of human retinoblastoma.
[0100] Take female nude mice aged 4-6 weeks, and add 5*10 to a 50ul volume of... 6One WERI-Rb1 cell was mixed with an equal volume of 50 μL of matrix gel and subcutaneously injected into the left scapular region of nude mice. The growth of the subcutaneous tumor was observed daily after inoculation. One week later, 10 μL of 10 nmol miR-1910-5p antagonist (control) and miR-1910-5p antagonist (sequence: A) were injected into the peritumoral region of successfully modeled nude mice. * G * GCGGCAGGCACAGGA * C * U * G * G (* indicates nucleotides that have been thiolated) and an equal volume of PBS were administered, once every 3 days for a total of 7 injections. After 21 days, the tumor size of the mice was measured, and the tumor volume was calculated every 5 days using the formula: (length × width) 2 ) / 2.
[0101] After euthanizing nude mice, subcutaneous tumors were dissected and weighed. Tumor tissue was fixed overnight in 4% paraformaldehyde, then dehydrated for 2 hours the following day in 10% sucrose solution, followed by overnight dehydration in 30% sucrose solution. The dehydrated tumor tissue was then immersed in OCT embedding gel. After the OCT was completely embedded in the tumor tissue, the embedding mold was placed in a -80°C freezer. After the tissue was completely frozen, it was sectioned. After washing away the OCT from the sections, they were blocked with 5% BSA for half an hour, and immunofluorescence staining was used to detect CD31 angiogenesis in the tumor. The sections were incubated with secondary antibody at room temperature in the dark for 1 hour, followed by DAPI for 5 minutes, and then mounted with an anti-fluorescence quencher.
[0102] The results are as follows Figure 5 As shown: Figure 5 Image A shows a representative morphological image of mice injected peritumorally with PBS, a miR-1910-5p antagonist (as opposed to miR-1910-5p antagonist), and a representative image of CD31 stained with tumor immunofluorescence. (Source: [Insert Source Here]) Figure 5 As can be seen from A and 5B, the tumor volume in the miR-1910-5p antagonist group was significantly smaller than that in the other two groups, and the tumor weight was also significantly lower than that in the other two groups. Figure 5 C is a statistical graph of the area positive for CD31 by immunofluorescence staining, combined with Figure 5 As can be seen from A, the area of neovascularization region stained by CD31 in the tumor of mice in the miR-1910-5p antagonist group was also significantly reduced compared with the other two groups.
[0103] Example 6: miR-1910-5p antagonist inhibits angiogenesis and growth of cervical cancer in vivo.
[0104] (1) Culture of human cervical cancer cells (HeLa).
[0105] Human cervical cancer cells (HeLa) were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in DMEM medium containing 10% fetal bovine serum (FBS). Cells were then cultured in a 37°C cell culture incubator containing a mixture of 21% O2, 5% CO2, and 94% N2.
[0106] (2) Human cervical cancer xenograft model in nude mice.
[0107] HeLa, a human cervical cancer cell line in the logarithmic growth phase, was used to prepare a single-cell suspension with 0.25% trypsin. Four- to six-week-old female nude mice were used, and 100 μL of the suspension contained 2*103 cells. 6 A suspension of cells was subcutaneously inoculated into the left scapular region of nude mice. The growth of subcutaneous tumors in the nude mice was observed daily after inoculation. One week later, 10 μL of 10 nmol miR-1910-5p antagonist (control) and miR-1910-5p antagonist (sequence: A) were injected into the peritumoral region of successfully modeled nude mice. * G * GCGGCAGGCACAGGA * C * U * G * G (* indicates nucleotides that have been thiolated) and an equal volume of PBS were administered, once every 3 days for a total of 7 injections. After 21 days, the tumor size of the mice was measured, and the tumor volume was calculated every 5 days using the formula: (length × width) 2 ) / 2.
[0108] After euthanizing nude mice, subcutaneous tumors were dissected and weighed. Tumor tissue was fixed overnight in 4% paraformaldehyde, then dehydrated for 2 hours the following day in 10% sucrose solution, followed by overnight dehydration in 30% sucrose solution. The dehydrated tumor tissue was then immersed in OCT embedding gel. After the OCT was completely embedded in the tumor tissue, the embedding mold was placed in a -80°C freezer. After the tissue was completely frozen, it was sectioned. After washing away the OCT from the sections, they were blocked with 5% BSA for half an hour, and immunofluorescence staining was used to detect CD31 angiogenesis in the tumor. The sections were then incubated with secondary antibody for 1 hour at room temperature in the dark, followed by DAPI for 5 minutes, and finally mounted with an anti-fluorescence quencher.
[0109] The results are as follows Figure 6 As shown: Figure 6 Image A shows a representative morphological image of mice injected peritumorally with PBS, a miR-1910-5p antagonist (as opposed to miR-1910-5p antagonist), and a representative image of CD31 stained with tumor immunofluorescence. (Source: [Insert Source Here]) Figure 6 As can be seen from A and 6B, the tumor volume in the miR-1910-5p antagonist group was significantly smaller than that in the other two groups, and the tumor weight was also significantly lower than that in the other two groups. Figure 6C is a statistical graph of the area positive for CD31 by immunofluorescence staining, combined with Figure 6 As can be seen from A, the area of neovascularization region stained by CD31 in the tumor of mice in the miR-1910-5p antagonist group was also significantly reduced compared with the other two groups.
[0110] Example 7: miR-1910-5p antagonist inhibits angiogenesis and growth of nasopharyngeal carcinoma in vivo.
[0111] (1) Culture of human nasopharyngeal carcinoma cells (HK1).
[0112] Human nasopharyngeal carcinoma cells HK1 were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in RPMI-1640 medium containing 10% fetal bovine serum (FBS). Cells were then cultured in a 37°C cell culture incubator containing a mixture of 21% O2, 5% CO2, and 94% N2.
[0113] (2) Human nasopharyngeal carcinoma xenograft model.
[0114] Human nasopharyngeal carcinoma cells (HK1) in the logarithmic growth phase were used to prepare a single-cell suspension with 0.25% trypsin. Four- to six-week-old female nude mice were used, and 100 μL of suspension containing 2*103 cells was prepared. 6 A suspension of cells was subcutaneously inoculated into the left scapular region of nude mice. The growth of subcutaneous tumors in the nude mice was observed daily after inoculation. One week later, 10 μL of 10 nmol miR-1910-5p antagonist (control) and miR-1910-5p antagonist (sequence: A) were injected into the peritumoral region of successfully modeled nude mice. * G * GCGGCAGGCACAGGA * C * U * G * G (* indicates nucleotides that have been thiolated) and an equal volume of PBS were administered, once every 3 days for a total of 7 injections. After 21 days, the tumor size of the mice was measured, and the tumor volume was calculated every 5 days using the formula: (length × width) 2 ) / 2.
[0115] After euthanizing nude mice, subcutaneous tumors were dissected and weighed. Tumor tissue was fixed overnight in 4% paraformaldehyde, then dehydrated for 2 hours the following day in 10% sucrose solution, followed by overnight dehydration in 30% sucrose solution. The dehydrated tumor tissue was then immersed in OCT embedding gel. After the OCT was completely embedded in the tumor tissue, the embedding mold was placed in a -80°C freezer. After the tissue was completely frozen, it was sectioned. After washing away the OCT from the sections, they were blocked with 5% BSA for half an hour, and immunofluorescence staining was used to detect CD31 angiogenesis in the tumor. The sections were then incubated with secondary antibody for 1 hour at room temperature in the dark, followed by DAPI for 5 minutes, and finally mounted with an anti-fluorescence quencher.
[0116] The results are as follows Figure 7 As shown: Figure 7 Image A shows a representative morphological image of mice injected peritumorally with PBS, a miR-1910-5p antagonist (as opposed to miR-1910-5p antagonist), and a representative image of CD31 stained with tumor immunofluorescence. (Source: [Insert Source Here]) Figure 7 As can be seen from A and 7B, the tumor volume in the miR-1910-5p antagonist group was significantly smaller than that in the other two groups, and the tumor weight was also significantly lower than that in the other two groups. Figure 7 C is a statistical graph of the area positive for CD31 by immunofluorescence staining, combined with Figure 7 As can be seen from A, the area of neovascularization region stained by CD31 in the tumor of mice in the miR-1910-5p antagonist group was also significantly reduced compared with the other two groups.
[0117] Example 8: miR-1910-5p antagonist inhibits bladder tumor angiogenesis and growth in vivo.
[0118] 1) Culture of human bladder cancer cells (UMUC3).
[0119] Human bladder cancer cells (UMUC3) were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in DMEM medium containing 10% fetal bovine serum (FBS). Cells were cultured in a 37°C cell culture incubator containing a mixture of 21% O2, 5% CO2, and 94% N2.
[0120] (2) Human bladder cancer cell xenograft model in nude mice.
[0121] Logarithmic growth phase human bladder cancer cells UMUC3 were collected and prepared into a single-cell suspension using 0.25% trypsin. 4-6 week old female nude mice were used, and 100 μL of the suspension contained 2*103 cells. 6 A suspension of cells was subcutaneously inoculated into the left scapular region of nude mice. The growth of subcutaneous tumors in the nude mice was observed daily after inoculation. One week later, 10 μL of 10 nmol miR-1910-5p antagonist (control) and miR-1910-5p antagonist (sequence: A) were injected into the peritumoral region of successfully modeled nude mice. * G * GCGGCAGGCACAGGA * C * U * G * G (* indicates nucleotides that have been thiolated) and an equal volume of PBS were administered, once every 3 days for a total of 7 injections. After 21 days, the tumor size of the mice was measured, and the tumor volume was calculated every 5 days using the formula: (length × width) 2 ) / 2.
[0122] After euthanizing nude mice, subcutaneous tumors were dissected and weighed. Tumor tissue was fixed overnight in 4% paraformaldehyde, then dehydrated for 2 hours the following day in 10% sucrose solution, followed by overnight dehydration in 30% sucrose solution. The dehydrated tumor tissue was then immersed in OCT embedding gel. After the OCT was completely embedded in the tumor tissue, the embedding mold was placed in a -80°C freezer. After the tissue was completely frozen, it was sectioned. After washing away the OCT from the sections, they were blocked with 5% BSA for half an hour, and immunofluorescence staining was used to detect CD31 angiogenesis in the tumor. The sections were then incubated with secondary antibody for 1 hour at room temperature in the dark, followed by DAPI for 5 minutes, and finally mounted with an anti-fluorescence quencher.
[0123] The results are as follows Figure 8 As shown: Figure 8 Image A shows a representative morphological image of mice injected peritumorally with PBS, a miR-1910-5p antagonist (as opposed to miR-1910-5p antagonist), and a representative image of CD31 stained with tumor immunofluorescence. (Source: [Insert Source Here]) Figure 8 As can be seen from A and 8B, the tumor volume in the miR-1910-5p antagonist group was significantly smaller than that in the other two groups, and the tumor weight was also significantly lower than that in the other two groups. Figure 8 C is a statistical graph of the area positive for CD31 by immunofluorescence staining, combined with Figure 8 As can be seen from A, the area of neovascularization region stained by CD31 in the tumor of mice in the miR-1910-5p antagonist group was also significantly reduced compared with the other two groups.
[0124] Combined with Examples 5, 6, 7 and 8, the results showed that administration of miR-1910-5p antagonists to tumor tissues (retinoblastoma and cervical epithelial carcinoma) could effectively reduce the degree of neovascularization in tumor tissues, thereby inhibiting tumor proliferation. This indicates that miR-1910-5p antagonists are expected to become one of the candidate drugs for the treatment of malignant tumors.
[0125] Summarize:
[0126] Both in vivo and in vitro experiments have shown that miR-1910-5p significantly promotes angiogenesis. Furthermore, administration of miR-1910-5p antagonists can slow the progression of neovascularization in the cornea, retina, and tumor tissues. Therefore, miR-1910-5p has potential for clinical translation. It can serve as a biomarker for neovascular diseases, and detecting its expression level can provide some reference for the treatment and prognosis of patients with these diseases. Simultaneously, its antagonists can be used as small nucleic acid drugs to treat neovascular diseases, providing a new treatment option.
[0127] The innovation of this invention lies in:
[0128] 1. miR-1910-5p can be used as a new biomarker for detecting CNV.
[0129] Our in vitro and in vivo experiments revealed that miR-1910-5p promotes angiogenesis, and its levels were significantly increased in the cornea of a mouse model of alkali burn injury and in the tears of CNV patients. The levels further increased with the severity of neovascularization. Therefore, the significantly elevated levels of miR-1910-5p in the tears and corneal tissue of CNV patients can serve as a biomarker for the diagnosis and prognosis of CNV.
[0130] 2. miR-1910-5p antagonists may be considered as candidate treatments for CNV.
[0131] We have previously demonstrated that miR-1910-5p antagonists can slow down the development of CNV in mice. Therefore, miR-1910-5p antagonists are expected to be a candidate drug to further enrich CNV treatment options.
[0132] 3. miR-1910-5p antagonists may be candidate drugs for the treatment of pathological retinal neovascularization.
[0133] 4. miR-1910-5p also shows promise in neovascular diseases such as tumors.
[0134] Given that various neovascularization diseases share the same molecular pathways or targets in their pathogenesis, and considering the findings of miR-1910-5p studies in retinal neovascularization, retinoblastoma, cervical epithelial carcinoma, nasopharyngeal carcinoma, and bladder cancer (see Examples 4, 5, 6, 7, and 8), miR-1910-5p can also serve as a biomarker for other neovascularization diseases, and its antagonists can also play a role in the treatment of neovascularization diseases in other tissues and sites.
[0135] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. Application of reagents for detecting miR-1910-5p expression levels in the preparation of products for the diagnosis or prognosis of neovascular diseases; The neovascular diseases mentioned are corneal neovascularization, retinal neovascularization, retinoblastoma, cervical cancer, nasopharyngeal carcinoma, or bladder cancer.
2. The application as described in claim 1, characterized in that, The product in question is a reagent kit.
3. The use of miR-1910-5p antagonists in the preparation of drugs for treating neovascular diseases; the sequence of the miR-1910-5p antagonist is shown in SEQ ID NO:3; The neovascular diseases mentioned are corneal neovascularization, retinal neovascularization, retinoblastoma, cervical cancer, nasopharyngeal carcinoma, or bladder cancer.
4. The application as described in claim 3, characterized in that, At least one nucleotide in the sequence of the miR-1910-5p antagonist is modified.
5. The application as described in claim 4, characterized in that, The modification is at least one of thiomodification and cholesterol modification.