A molecular marker, method and application for identifying the corolla color trait of cotton

Abstract

The present invention belongs to the field of molecular markers, and particularly relates to a molecular marker for identifying the corolla color trait of cotton, a method and an application thereof. The InDel molecular marker has a genotype of ATAACAATAACAACGA or A at the 10,920,236th base on chromosome A07 of cotton. An excellent InDel locus closely linked to the pink corolla trait of upland cotton provided by the present invention can be used to observe the flower color of plants, quickly screen new cotton varieties with bright corolla colors and ornamental values, and can also be used for cotton genetic background analysis and screening, promoting the breeding of hybrid varieties, identifying excellent loci with potential application values and molecular marker-assisted selection breeding of flower colors, and has broad application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of molecular markers, and particularly relates to a molecular marker for identifying the corolla color trait of cotton, a method and an application thereof. Background Art

[0002] The diversity of flower colors adds different colors to nature, enhances the ornamental value of plants, and increases commercial value. Secondly, flower colors can reduce the damage caused by ultraviolet and visible light to plants. As an important reproductive organ of plants, its important biological function is to reproduce offspring. Flower colors provide important visual signals during the pollination process of plants, can attract insects, and increase the preference of pollinators during natural pollination. Flower colors, as a reliable indicator of the presence of nectar, directly affect the visitation rate of pollinators.

[0003] Cotton is one of the most important crops in the world. Cotton bears fruit and produces lint, which is the main source of textile fibers in the world. The improvement of yield, quality and excellent traits has attracted the enthusiastic attention of breeders. Using biotechnology to improve cotton has been proven to be a very useful means. In recent years, with the continuous development of third-generation sequencing technology, single-molecule DNA sequencing has high resolution, and the identification of SNPs and InDels in specific sequences is more accurate, which has greatly promoted the application of molecular markers in breeding. Molecular marker-assisted selection breeding can quickly and directionally improve the yield, quality and excellent traits of crops, providing a new strategy for promoting cotton genetic improvement. The corolla color of cultivated upland cotton is mostly white, and pink flowers are extremely rare. This characteristic is an identifiable marker that can be applied to the hybridization of cotton and the breeding of conventional varieties, increasing the ornamental and commercial value of new varieties and improving the probability of insect pollination.

[0004] InDel (Insertion-Deletion) polymorphism molecular markers refer to the phenomenon that the sequences at the same locus in the genomes of different individuals of the same species or related species change, mainly manifested as the insertion or deletion of nucleotide fragments of different sizes. InDel markers have rich polymorphisms, cover the entire genome, and the number is second only to SNPs and much higher than SSRs. Moreover, they have the characteristics of high accuracy, stable variation and easy genotyping, and are widely used in fields such as population genetic analysis of animals and plants, molecular-assisted breeding and medical diagnosis. With the development of InDel markers on functional genes and combined with fine mapping of genes, the markers can be applied to screen functional genes and further develop and utilize excellent genes. The purpose of the present invention is to discover an InDel marker closely related to the pink corolla trait, detect this marker in a large number of varieties, provide a new method for the molecular detection of the pink corolla trait, and at the same time promote the application of molecular marker-assisted breeding in the diversity of corolla colors. Summary of the Invention

[0005] Aiming at the deficiencies of the prior art, the purpose of the present invention is to provide an InDel molecular marker for identifying the pink flower trait of cotton, and the application of this InDel molecular marker in identifying the pink flower trait of cotton.

[0006] The above purpose is achieved through the following preparation process:

[0007] The present invention provides an InDel molecular marker for identifying the corolla color trait of cotton, characterized in that the genotype of the base at the 10,920,236th position on chromosome A07 of cotton is ATAACAATAACAACGA or A.

[0008] The present invention also provides the application of the above InDel molecular marker in identifying the corolla color trait of cotton. Further preferably, the cotton is the TM-1 upland cotton standard line reference genome.

[0009] As a further improvement of the above technical solution, when the genotype is A, it is a cotton variety with a pink corolla, and when the genotype is ATAACAATAACAACGA, it is a cotton variety with a white corolla.

[0010] The present invention also provides a method for identifying the corolla color trait of cotton, including the following steps:

[0011] Step S1: Extract the DNA of the cotton tissue to be detected;

[0012] Step S2: Design specific amplification primers with the sequence composed of the site where the InDel molecular marker is located and its upstream and downstream bases as the target sequence. Using the DNA as a template, perform PCR amplification with the specific amplification primers to obtain an amplification product;

[0013] Step S3: Perform polyacrylamide gel electrophoresis on the amplification product to obtain amplification bands;

[0014] Step S4: Judge the corolla color trait of cotton according to the amplification bands.

[0015] As a further improvement of the above technical solution, if the size of the amplification band is 90bp, the material is a pink flower variety; if the size of the amplification band is 105bp, the material is a white flower variety.

[0016] As a further improvement of the above technical solution, the sequence of the specific amplification primers is:

[0017] Upstream primer InPF15F: AGCCTCGGCCTCAGATCTTA;

[0018] Downstream primer InPF15R: TGTTGCTTGTTTCTGCACGG.

[0019] The present invention also provides an InDel marker primer for detecting the pink flower trait of cotton. The InDel marker primer is designed with the sequence composed of the locus where the InDel molecular marker is located and the upstream and downstream bases as the target sequence. The InDel marker primer sequences are as follows:

[0020] Forward primer InPF15F: AGCCTCGGCCTCAGATCTTA;

[0021] Reverse primer InPF15R: TGTTGCTTGTTTCTGCACGG.

[0022] The present invention also provides a kit for detecting the pink flower trait of cotton, and the kit contains the above InDel marker primer.

[0023] The present invention also provides an application of the above InDel marker primer in cotton molecular marker-assisted breeding.

[0024] The present invention also provides an application of the above InDel marker primer in breeding cotton varieties with pink flowers.

[0025] The beneficial effects of the present invention are as follows:

[0026] The present invention has found 1 excellent InDel locus that is closely linked to the pink corolla trait of upland cotton. It can be used to observe the flower color of plants, quickly screen new cotton varieties with brightly colored corollas and ornamental value, and can also be used for cotton genetic background analysis and screening, promoting the breeding of hybrid varieties, identifying excellent loci with potential application value and molecular marker-assisted selection breeding of flower color, and has broad application prospects.

[0027] The InDel molecular marker associated with the pink flower trait of cotton provided by the present invention is directly presented in the form of DNA, can be detected at various development stages and different tissue organs of cotton, and is not restricted by the environment and season, and there are no problems such as expression affecting it. By extracting the cotton tissue DNA and performing PCR amplification using the specific primers in the present invention, the amplification product with a size of 90 bp is the material with a pink corolla, and the amplification product with a size of 105 bp is the material with a white corolla, so as to achieve rapid, large-scale and automated detection of the sample to be tested.

[0028] The InDel molecular marker of the present invention is closely linked to the pink corolla trait, and can accurately screen pink corollas and white corollas, which has far-reaching significance for analyzing the evolution of flower color and the molecular mechanism of flower color formation during the cotton evolution process. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1For the corollas of Xinluzao 74 (left, white) and Zhe Y52 (right, pink);

[0030] Figure 2 For the polyacrylamide gel electrophoresis results of PCR products of the DNA of two parents and 30 F 2 progeny cotton amplified with InPF15F / InPF15R primers; (Note: M: DS2000; 1: Pink-corolla upland cotton (Zhe Y52); 2: White-corolla upland cotton (Xinluzao 74); 3 - 17: Pink-corolla F2 progeny; 18 - 32: White-corolla F2 progeny; Red arrow indicates the electrophoresis band (90bp) of the PCR product unique to the pink-corolla material);

[0031] Figure 3 For the polyacrylamide gel electrophoresis results of PCR products of the DNA of 7 cottons with different corolla colors amplified with InPF15F / InPF15R primers; (Note: M: DS2000; 1: Pink-corolla upland cotton (Zhe Y52); 2 - 3: White-corolla upland cotton (Xinluzao 74, Xinluzao 33); 4 - 5: Red-corolla upland cotton (Hongyemian, Yahongzhu); 6 - 7: Yellow-corolla sea-island cotton (Xinhai 3, Xinhai 21); Red arrow indicates the electrophoresis band (90bp) of the PCR product unique to the pink-corolla material). Detailed implementation manners

[0032] The following further describes the present application in conjunction with the accompanying drawings. It is necessary to point out here that the following detailed implementation manners are only used to further illustrate the present application and cannot be understood as limiting the protection scope of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application according to the above application content.

[0033] 1. Materials

[0034] The methods used in this embodiment are all conventional methods known to those skilled in the art unless otherwise specified. The reagents and other materials used are all commercially available products unless otherwise specified.

[0035] 2. Methods

[0036] 2.1. Screening of InDel molecular markers related to the pink-corolla trait

[0037] 2.1.1. Experimental materials and population construction

[0038] The pink-corolla variety Zhe Y52 introduced from the cotton germplasm resource bank was crossed with the Xinjiang early-maturing upland cotton variety Xinluzao 74 ( Figure 1 ), to obtain F 1 , F 1 was self-crossed to obtain F 2 , F 2A total of 1,246 strains were used as a genetic population for research. This experiment was conducted in the experimental field of the College of Agriculture, Shihezi University, Xinjiang. All materials were planted in the same plot with completely consistent environmental conditions, and field management was carried out uniformly to reduce the errors caused by human factors in the experiment.

[0039] 2.1.2. Field investigation of the pink corolla trait in cotton

[0040] For F 2 Each individual plant in the population was investigated for flower color traits. The investigation results conform to Mendel's law of segregation, and the segregation ratio of pink flowers to white flowers is 3:1, indicating that the pink corolla phenotype is a dominant trait controlled by a single nuclear gene.

[0041] 2.1.3. BSR high-throughput sequencing

[0042] Based on the above genetic analysis results, pink-flowered and white-flowered individual plants in the F 2 population were sampled separately to construct mixed pools with different flower color traits for BSR high-throughput sequencing. The sequencing results were compared with the reported cotton genome database to ensure the accuracy of the sequencing results. According to the detected InDel loci and combined with the phenotypes of the samples, the candidate intervals and differential SNP / InDel loci closely linked to the pink corolla trait were located, and the base at position 10,920,236 on chromosome 7 of cotton was found and named No.1.

[0043] 2.1.4. InDel detection

[0044] Using genotyping technology, the accuracy of the above InDel results was verified in the individual plants of the F 2 population to obtain reliable analysis results. First, specific extension primers were designed according to the InDel loci as shown in Table 2 below:

[0045] Table 1. InDel loci

[0046]

[0047] Table 2. InDel specific primers

[0048]

[0049] The above specific primers can also be used to prepare a kit for detecting the pink flower trait in cotton. The kit contains the above InDel marker primers and is applied to the breeding of cotton pink flower varieties and cotton molecular marker-assisted breeding.

[0050] Then, the target sequence was amplified by PCR. The specific reaction system and procedure are as follows:

[0051] Table 3. PCR reaction system

[0052]

[0053] The PCR reaction procedure is as follows:

[0054] Table 4. PCR reaction procedure

[0055]

[0056] The results showed that among the 1246 F 2 populations to be detected, the amplified product sizes of the single pink flower plants at the InPF15 locus were all 90 bp, and the number was 891 plants, while the amplified product sizes of the single white flower plants at the InPF15 locus were all 105 bp, and the number was 355 plants ( Figure 2 ). The above results indicate that the InDel locus InPF15 is closely linked or co-segregating with the cotton pink corolla trait. It can be used as a molecular marker for the molecular detection of the cotton pink corolla trait, and can also be used for cotton genetic background analysis and screening, as well as molecular marker-assisted selection breeding of cotton flower color traits, with broad application prospects.

[0057] 2.2. Method for identifying cotton pink corolla trait using InDel markers

[0058] This example provides a method for detecting cotton pink corolla using an InDel molecular marker closely linked to the cotton pink corolla trait, including the following steps:

[0059] (1) Extract the DNA of the cotton leaves to be tested using the CTAB method;

[0060] ① Weigh 2 g of leaves into a centrifuge tube, quickly use a tissue grinder to grind thoroughly after liquid nitrogen shock, add 1 ml of CTAB solution after 65 °C water bath, mix well and place in a water bath, heat water bath at 65 °C for 30 min, and invert once every 8 min.

[0061] ② After the water bath, take out the centrifuge tube, centrifuge at 4 °C for 10 min, take the supernatant and add 800 μl of a chloroform and isoamyl alcohol mixture with a volume ratio of 24:1, slowly invert up and down until evenly mixed and not stratified, and centrifuge at 12000 rpm at 4 °C for 10 min.

[0062] ③ Repeat the previous step

[0063] ④ Aspirate the supernatant and transfer it to another 1.5 ml centrifuge tube. Add 2 volumes of ice-cold isoamyl alcohol (previously placed in a -20 °C refrigerator) and 200 μl of sodium acetate solution, slowly invert until flocculent DNA is formed, and let stand for 30 min.

[0064] ⑤Centrifuge at 12,000 rpm for 10 min at 4°C, pour off the waste liquid, wash twice with 70% (v / v) ethanol solution, and wash once with absolute ethanol.

[0065] ⑥Dry overnight, add ddH 2 O to dissolve the DNA until completely dissolved, and store at 4°C for later use.

[0066] (2) Using genotyping technology, design specific primers according to the InDel molecular markers, and the sequences are as follows:

[0067] Forward primer InPF15F: AGCCTCGGCCTCAGATCTTA;

[0068] Reverse primer InPF15R: TGTTGCTTGTTTCTGCACGG;

[0069] (3) Using the cotton tissue DNA as a template, perform PCR amplification with the designed specific primers. The PCR amplification system and procedure are the same as in 2.1.4.

[0070] (4) Polyacrylamide gel electrophoresis

[0071] Perform polyacrylamide gel electrophoresis on the PCR products. The specific method is as follows:

[0072] ①Wash the glass plates for making the gel with water and wipe them with alcohol to ensure no water stains and stains are left.

[0073] ②Fix a frosted glass and a polished glass with clips and place them horizontally on the table with the frosted side down. Seal the edges with tape to ensure that the original gel solution will not leak.

[0074] ③Slowly pour the prepared polyacrylamide gel into the glass mold and quickly insert the comb.

[0075] ④Let it stand at room temperature until it solidifies, about 8 min.

[0076] ⑤Pull out the comb and use a syringe to adjust the channels to ensure that the channels are not bent.

[0077] ⑥Fix the glass plates in the electrophoresis tank with clips and add the pre-prepared 1×TBE electrophoresis buffer.

[0078] ⑦Add 2 μl of 5×Loading Buffer to the PCR products, mix well, and centrifuge for later use.

[0079] ⑧Load 3 μl using a micropipette. After loading, turn on the power supply at 220 V for 1.5 h to perform electrophoresis.

[0080] (5) Fixation and color development of the electrophoresis products

[0081] ① After electrophoresis, carefully take out the gel in the glass mold and place it in the fixing solution, and slowly fix it on a shaker for 8 min;

[0082] ② Take out the gel from the fixing solution and put it into the silver staining solution, and slowly stain it on a shaker for 6 min;

[0083] ③ Quickly wash the gel with deionized water;

[0084] ④ Put the gel into the developing solution and slowly develop it on a shaker until bands appear;

[0085] ⑤ After development, wash the gel twice with distilled water;

[0086] ⑥ Observe and take pictures using a gel imager.

[0087] The results showed that the pink corolla material had its unique band pattern, which was completely different from the electrophoretic band patterns of white, red, and yellow corolla materials. The InPF15F / InPF15R marker showed polymorphism in the pink flower material and other flower color materials. PAGE gel electrophoresis could clearly distinguish the bands (90 bp) of the DNA amplification products of the pink corolla, and the electrophoretic bands were significantly smaller than those of the DNA amplification products of other corolla colors (white, red, yellow) (105 bp)( Figure 3 ), and the InPF15F / InPF15R marker was closely linked (co-segregated) to the cotton pink corolla trait. By using genomic visualization software to align the DNA sequences of the pink flower material and the white flower material, it could be clearly seen that the pink flower material had a 15-base deletion of TAACAATAACAACGA at the 70th base position relative to the white flower material. The nucleotide sequence of the InDel marker amplification product was:

[0088] AGCCTCGGCCTCAGATCTTA TCAAAGCGTAGTTTTCTTGTAAATTTAGATGAAT ACAACAATAACAACA ATAACAATAACAACGACCGTGCAGAAACAAGCAACA。

[0089] Among them, the underlined part indicates the primer binding position, and the bold part is the 15-base deletion position in the genome of the pink corolla material. The nucleotide sequence of the amplification product without base deletion is shown in SEQ ID NO.1, and the nucleotide sequence of the amplification product with a 15-base deletion is shown in SEQ ID NO.2.

[0090] The above-described embodiments merely represent several implementation manners of the present invention. The description thereof is relatively specific and detailed, but it should not be construed as a limitation to the scope of the patent of the present invention. It should be noted that for those of ordinary skill in the art, several improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention.

Claims

1. Application of an InDel molecular marker for identifying the corolla color trait of cotton in identifying the corolla color trait of cotton, characterized in that, the nucleotide sequences of the InDel molecular marker are shown in SEQ ID NO.1 and SEQ ID NO.2, wherein the genotype of the InDel locus is ATAACAATAACAACGA or A; when the genotype is A, it is a cotton variety with pink corolla.

2. A method for identifying the corolla color trait of cotton, characterized in that, it includes the following steps: Step S1, extract the DNA of the cotton tissue to be detected; Step S2, design specific amplification primers with the sequence composed of the base at the InDel molecular marker locus and its upstream and downstream bases as the target sequence, use the DNA as a template, and perform PCR amplification with the specific amplification primers to obtain an amplification product; the nucleotide sequences of the InDel molecular marker are shown in SEQ ID NO.1 and SEQ ID NO.2; wherein the genotype of the InDel locus is ATAACAATAACAACGA or A; The sequences of the specific amplification primers are: Upstream primer InPF15F: AGCCTCGGCCTCAGATCTTA; Downstream primer InPF15R: TGTTGCTTGTTTCTGCACGG; Step S3, perform polyacrylamide gel electrophoresis on the amplification product to obtain an amplification band; Step S4, judge the corolla color trait of cotton according to the amplification band; If the size of the amplification band is 90 bp, the material to be detected is a cotton variety with pink corolla.

3. An InDel marker primer for detecting the pink corolla trait of cotton, characterized in that, the InDel marker primer is designed with the sequence composed of the base at the InDel molecular marker locus and its upstream and downstream bases as the target sequence, the nucleotide sequences of the InDel molecular marker are shown in SEQ ID NO.1 and SEQ ID NO.2; wherein the genotype of the InDel locus is ATAACAATAACAACGA or A; The sequences of the InDel marker primer are: Upstream primer InPF15F: AGCCTCGGCCTCAGATCTTA; Downstream primer InPF15R: TGTTGCTTGTTTCTGCACGG.

4. A kit for detecting the pink corolla trait of cotton, characterized in that, this kit contains the InDel marker primer described in claim 3.

5. Application of the InDel marker primer described in claim 3 in breeding cotton varieties with pink flowers.

Images