Primer probe combination, reagent and application

Abstract

The present application relates to the technical field of in vitro detection, in particular to primer probe combination, reagent and application, and provides primer probe combination, reagent or kit for detecting HPV DNA and mRNA, which aims at simply, quickly and accurately detecting multiple types of HPV DNA and mRNA in a single reaction to achieve the purpose of typing.The present application uses asymmetric PCR technology-melting curve technology to perform fluorescent PCR detection and typing on the DNA or mRNA fragments of the 9 types of HPV 16, 18, 31, 33, 45, 52, 58, 59 and 68 in a single tube.

Description

Technical Field

[0001] This invention relates to the field of in vitro detection technology, and particularly to primer-probe combinations, reagents, and applications. Background Technology

[0002] Cervical cancer is one of the most common cancers affecting women worldwide, and studies have shown that 99.7% of cervical cancers are caused by human papillomavirus (HPV). HPV can also cause many other cancers, such as penile cancer, vaginal cancer, vulvar cancer, anal cancer, and oropharyngeal cancer.

[0003] HPV is a small, non-enveloped, circular double-stranded DNA virus with a genome approximately 8000 base pairs (bp) long, divided into three functional regions: the early transcription region (E region), the late transcription region (L region), and the non-transcriptional region (long control region, LCR). HPV's E6 and E7 genes are oncogenes that regulate p53 and pdz domain proteins and target the retinoblastoma protein (pRb) family.

[0004] Methods for detecting HPV mainly include Pap smears, in situ hybridization, cytological examination, and HPV nucleic acid detection. p16 immunohistochemical staining can also serve as a potential surrogate marker for HPV detection. Currently, HPV nucleic acid detection and TCT testing are relatively effective methods and play a significant role in cervical cancer screening.

[0005] However, real-time PCR has technical limitations when multiple mutations or multiple samples need to be detected simultaneously in a single reaction tube. These limitations can be overcome by post-PCR probe-based fluorescence melting curve analysis (FMCA), a technique that detects multiple mutations based on the shift in melting temperature (Tm). The number of mutations that can be detected can be further increased by using multiple probes labeled with different fluorescent groups.

[0006] Literature reports that HPV genome integration occurs during the progression from low-grade lesions to cancer. During integration, the E6 / E7 genes persist, while the L1 gene may be lost, posing a risk of false negatives in detection. Studies have found that the L1 / E1 region of HPV18 is more prone to loss; in almost all HPV18-positive cervical cancers, the viral genome integrates into the human genome, while in HPV16-positive cervical cancers, ≤60% of the viral genome integrates. Therefore, detecting mRNA would have higher sensitivity.

[0007] Several methods for detecting HPV nucleic acid based on real-time quantitative PCR technology already exist in China, but their genotyping capabilities are limited. The application of multicolor melting curve technology can solve this problem. Existing patented technologies use mRNA as a template for amplification, which can perform multiple genotyping, but primer and probe design is difficult and costly, and the reaction system is complex. Using DNA as a template for amplification carries the risk of false negatives, especially for HPV16 and HPV18, which significantly impacts subsequent diagnosis and treatment.

[0008] Currently, most melting curve products on the market use DNA or RNA as targets for nucleic acid detection, which have drawbacks such as low sensitivity and low specificity to varying degrees.

[0009] Problems with existing technologies also include:

[0010] 1) Limited typing capabilities. Most HPV typing reagents are sold in individual vials, which is costly.

[0011] 2) Must be stored at -20℃. Most commercially available reagent kits are stored at -20℃.

[0012] 3) Complex operation. Most reagents have complex principles and are difficult to design primers and probes. Summary of the Invention

[0013] In view of this, the primer-probe combination, reagents and applications provided by the present invention can easily, quickly and accurately detect multiple types of HPV DNA and mRNA in a single reaction to achieve the purpose of genotyping.

[0014] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0015] The present invention provides primers, including primer 1, primer 2, primer 3, primer 4, primer 5, primer 6, primer 7, primer 8, primer 9, primer 10, primer 11, primer 12, primer 13, primer 14, primer 15, primer 16 or primer 17;

[0016] Primer 1 has the following characteristics:

[0017] (1) A nucleotide sequence as shown in SEQ ID NO:1; or

[0018] (2) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (1), and whose function is the same as or similar to that of (1); or

[0019] (3) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (1) or (2);

[0020] Primer 2 has the following characteristics:

[0021] (4) A nucleotide sequence as shown in SEQ ID NO:2; or

[0022] (5) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (4), and whose function is the same as or similar to that of (4); or

[0023] (6) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (4) or (5);

[0024] The primer 3 has the following characteristics:

[0025] (7) A nucleotide sequence as shown in SEQ ID NO:3; or

[0026] (8) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (7), and whose function is the same as or similar to that of (7); or

[0027] (9) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (7) or (8);

[0028] The primer 4 has the following characteristics:

[0029] (10) A nucleotide sequence as shown in SEQ ID NO:4; or

[0030] (11) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (10), and whose function is the same as or similar to that of (10); or

[0031] (12) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (10) or (11);

[0032] The primer 5 has the following characteristics:

[0033] (13) A nucleotide sequence as shown in SEQ ID NO:6; or

[0034] (14) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (13), and whose function is the same as or similar to that of (13); or

[0035] (15) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (13) or (14);

[0036] Primer 6 has the following characteristics:

[0037] (16) A nucleotide sequence as shown in SEQ ID NO:7; or

[0038] (17) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (16), and whose function is the same as or similar to that of (16); or

[0039] (18) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (16) or (17);

[0040] The primer 7 has the following characteristics:

[0041] (19) A nucleotide sequence as shown in SEQ ID NO:8; or

[0042] (20) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (19), and whose function is the same as or similar to that of (19); or

[0043] (21) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (19) or (20);

[0044] Primer 8 has the following characteristics:

[0045] (22) A nucleotide sequence as shown in SEQ ID NO:9; or

[0046] (23) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (22), and whose function is the same as or similar to that of (22); or

[0047] (24) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (22) or (23);

[0048] The primer 9 has the following characteristics:

[0049] (25) A nucleotide sequence as shown in SEQ ID NO:10; or

[0050] (26) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (25), and whose function is the same as or similar to that of (25); or

[0051] (27) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (25) or (26);

[0052] The primer 10 has the following characteristics:

[0053] (28) A nucleotide sequence as shown in SEQ ID NO:12; or

[0054] (29) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (28), and whose function is the same as or similar to that of (28); or

[0055] (30) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (28) or (29);

[0056] The primer 11 has the following characteristics:

[0057] (31) A nucleotide sequence as shown in SEQ ID NO:13; or

[0058] (32) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (31), and whose function is the same as or similar to that of (31); or

[0059] (33) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (31) or (32);

[0060] The primer 12 has the following characteristics:

[0061] (34) A nucleotide sequence as shown in SEQ ID NO:14; or

[0062] (35) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (34), and whose function is the same as or similar to that of (34); or

[0063] (36) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (34) or (35);

[0064] The primer 13 has the following characteristics:

[0065] (37) A nucleotide sequence as shown in SEQ ID NO:15; or

[0066] (38) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (37), and whose function is the same as or similar to that of (37); or

[0067] (39) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (37) or (38);

[0068] The primer 14 has the following characteristics:

[0069] (40) A nucleotide sequence as shown in SEQ ID NO:16; or

[0070] (41) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (40), and whose function is the same as or similar to that of (40); or

[0071] (42) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (40) or (41);

[0072] The primer 15 has the following characteristics:

[0073] (43) A nucleotide sequence as shown in SEQ ID NO:17; or

[0074] (44) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (43), and whose function is the same as or similar to that of (43); or

[0075] (45) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (43) or (44);

[0076] The primer 16 has the following characteristics:

[0077] (46) A nucleotide sequence as shown in SEQ ID NO:19; or

[0078] (47) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (46), and whose function is the same as or similar to that of (46); or

[0079] (48) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (46) or (47);

[0080] The primer 17 has the following characteristics:

[0081] (49) A nucleotide sequence as shown in SEQ ID NO:20; or

[0082] (50) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (49), and whose function is the same as or similar to that of (49); or

[0083] (51) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (49) or (50);

[0084] The number of items is 2 to 7.

[0085] The present invention also provides probes, including probe 1, probe 2, probe 3 or probe 4;

[0086] The probe 1 has:

[0087] (52) A nucleotide sequence as shown in SEQ ID NO:5; or

[0088] (53) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (52), and whose function is the same as or similar to that of (52); or

[0089] (54) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (52) or (53);

[0090] The probe 2 has:

[0091] (55) A nucleotide sequence as shown in SEQ ID NO:11; or

[0092] (56) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (55), and whose function is the same as or similar to that of (55); or

[0093] (57) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (55) or (8);

[0094] The probe 3 has:

[0095] (58) A nucleotide sequence as shown in SEQ ID NO:18; or

[0096] (59) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (58), and whose function is the same as or similar to that of (58); or

[0097] (60) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (58) or (59);

[0098] The probe 4 has:

[0099] (61) A nucleotide sequence as shown in SEQ ID NO:21; or

[0100] (62) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (61), and whose function is the same as or similar to that of (61); or

[0101] (63) A nucleotide sequence that is at least 70% homologous to the nucleotide sequence shown in (61) or (62);

[0102] The number of items is 2 to 7.

[0103] The present invention also provides primer probe sets, including one or more of combinations 1, 2, 3, 4, 5, 6, 7, 8 or 9;

[0104] The combination 1 includes the primer 1, the primer 2, and the probe 1 described above;

[0105] The combination 2 includes the primer 1, the primer 3, and the probe 1 described above;

[0106] The combination 3 includes the primer 1, the primer 4, and the probe 1 described above;

[0107] The combination 4 includes the primer 5, the primer 6, and the probe 2 described above;

[0108] The combination 5 includes the primer 5, the primer 7, and the probe 2 described above;

[0109] The combination 6 includes the primer 8, the primer 9, and the probe 2 described above;

[0110] The combination 7 includes the primer 10, the primer 11 and the probe 3 described above;

[0111] The combination 8 includes the primer 12, the primer 13 and the probe 3 described above;

[0112] The combination 9 includes the primer 14, the primer 15 and the probe 3.

[0113] In some specific embodiments of the present invention, the 5' end of probe 1 in the above primer-probe set is labeled with FAM and the 3' end is labeled with BHQ1.

[0114] In some specific embodiments of the present invention, the 5' end of probe 2 in the above primer-probe set is labeled ROX and the 3' end is labeled BHQ2.

[0115] In some specific embodiments of the present invention, the 5' end of probe 3 in the above primer-probe set is labeled CY5 and the 3' end is labeled BHQ2.

[0116] In some specific embodiments of the present invention, the primer-probe set described above further includes combination 10;

[0117] The combination 10 includes the primer 16, the primer 17 and the probe 4.

[0118] In some specific embodiments of the present invention, the 5' end of probe 4 in the above primer-probe set is labeled with HEX and the 3' end is labeled with BHQ1.

[0119] The present invention also provides the application of the above-described primers, probes, or primer-probe sets in the following aspects:

[0120] (I) HPV testing; and / or

[0121] (II) HPV typing; and / or

[0122] (III) Preparation of reagents, kits, or devices for detecting HPV; and / or

[0123] (IV) Preparation of reagents, kits or devices for HPV typing;

[0124] The HPV includes one or more of HPV 16, HPV 18, HPV 31, HPV 33, HPV 45, HPV 52, HPV 58, HPV 59 or HPV 68.

[0125] The present invention also provides reagents, including the primers, probes or primer-probe sets described above, and acceptable excipients or adjuvants.

[0126] In some specific embodiments of the present invention, the above-mentioned reagents include:

[0127] The concentration of restriction primers is 0.02–0.05 μM; and / or

[0128] The concentration of non-restrictive primers is 0.2–1 μM; and / or

[0129] The concentration of the probe is 0.2–0.4 μM;

[0130] The restriction primers include primer 1, primer 5, primer 8, primer 10, primer 12, primer 14, or primer 16.

[0131] The non-restrictive primers include primers 2, 3, 4, 6, 7, 9, 11, 13, 15, or 17.

[0132] The present invention also provides a kit comprising the above-described reagents, as well as acceptable excipients or adjuvants.

[0133] In some specific embodiments of the present invention, the above-mentioned kit includes: PCR reaction solution 1, PCR reaction solution 2, negative control and positive control;

[0134] The PCR reaction solution 1 includes:

[0135] (a) Tricine at pH 8.3; and / or

[0136] (b) DMSO; and / or

[0137] (c) NaN3; and / or

[0138] (d) UNG enzyme; and / or

[0139] (e) DNA polymerase; and / or

[0140] (f) dNTP;

[0141] The DNA polymerase includes rTth DNA polymerase;

[0142] The PCR reaction solution 2 includes one or more of Mn(OAc)2, Mg(OAc)2, KOAc or NaN3;

[0143] The negative control includes a pseudovirus solution containing a specific target DNA fragment of an internal standard;

[0144] The positive control includes a pseudovirus solution containing an internal standard specific target DNA fragment, or an HPV E6 / E7 or L1 region specific target fragment.

[0145] The present invention also provides a method for genotyping HPV 16, HPV 18, HPV 31, HPV 33, HPV 45, HPV 52, HPV 58, HPV 59 or HPV 68, including amplifying the sample using the above-mentioned primer and probe set and amplification reagents, obtaining the melting curve and the temperature corresponding to the melting peak, and obtaining the genotyping result by comparison when negative and positive controls are established;

[0146] Wherein, the fluorescence channel of probe 1 is channel 1, the fluorescence channel of probe 2 is channel 2, the fluorescence channel of probe 3 is channel 3, and the fluorescence channel of probe 4 is channel 4;

[0147] The comparison includes:

[0148] (i) If the temperature corresponding to the melting peak of channel 1 falls within 70±1.5℃, and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV16 positive; and / or

[0149] (ii) If the temperature corresponding to the melting peak of channel 1 falls within 60±1.5℃, and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV33 positive; and / or

[0150] (iii) If the temperature corresponding to the melting peak of channel 1 falls within 50±1.5℃, and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV58 positive; and / or

[0151] (iv) If the temperature corresponding to the melting peak of channel 2 falls within 69±1.5℃, and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV18 positive; and / or

[0152] (v) If the temperature corresponding to the melting peak of channel 2 falls within 61±1.5℃, and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV45 positive; and / or

[0153] (vi) If the temperature corresponding to the melting peak of channel 2 falls within 50±1.5℃, and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV59 positive; and / or

[0154] (vii) If the temperature corresponding to the melting peak of channel 3 falls within 67±1.5℃, and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV31 positive; and / or

[0155] (viii) If the temperature corresponding to the melting peak of channel 3 falls within 63±1.5℃, and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV52 positive; and / or

[0156] (ix) If the temperature corresponding to the melting peak of channel 3 falls within 49±1.5℃ and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV68 positive.

[0157] The primer-probe set and kit of the present invention have the following effects:

[0158] This invention enables the simple, rapid, and accurate detection of multiple HPV types of DNA and mRNA in a single reaction, achieving the purpose of genotyping. This invention utilizes asymmetric PCR technology—melting curve technology—to perform fluorescent PCR detection and genotyping of DNA and mRNA fragments from nine HPV types (16, 18, 31, 33, 45, 52, 58, 59, and 68) in a single tube.

[0159] Sensitivity experiments showed that using TE solution to dilute the HPV types within the detection range in the second-generation human papillomavirus whole genome typing reference to 1×10⁻⁶ was effective. 3 ~1×10 4 The primer / probe set of this invention was used to detect HPV types within the detection range, and the results showed that all HPV types were detected and accurately classified.

[0160] Specificity experiments showed that HPV types not within the detection range in the second-generation human papillomavirus whole genome typing reference sample could be diluted to 1×10⁻⁶ using TE solution. 4 ~1×10 5 The results of the copy / reaction assay showed that the primer and probe set of the present invention did not cross-react with other pathogens and other HPV types, and had good specificity.

[0161] Repeatability experiments show that the primer and probe set of the present invention can be used to detect HPV types 16, 18, 31, 33, 45, 52, 58, 59, and 68. The results show that the Tm values ​​of each type are small and the repeatability is good. Attached Figure Description

[0162] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0163] Figure 1 The Tm value and melting curve of HPV type 16 in the FAM channel are shown.

[0164] Figure 2 The Tm value and melting curve of HPV type 33 in the FAM channel are shown.

[0165] Figure 3 The Tm value and melting curve of HPV type 58 in the FAM channel are shown.

[0166] Figure 4 The Tm value and melting curve of HPV type 18 in the ROX channel are shown.

[0167] Figure 5 The Tm value and melting curve of HPV type 45 in the ROX channel are shown.

[0168] Figure 6 The Tm value and melting curve of HPV type 59 in the ROX channel are shown.

[0169] Figure 7 The Tm value and melting curve of HPV type 31 in the CY5 channel are shown.

[0170] Figure 8 The Tm value and melting curve of HPV type 52 in the CY5 channel are shown.

[0171] Figure 9 The Tm value and melting curve of HPV type 68 in the CY5 channel are shown.

[0172] Figure 10 The internal standard is shown in the Tm value and melting curve of the HEX channel;

[0173] Figure 11 The melting curve of mixed positive pseudoviruses of HPV types 16, 33, and 58 in the FAM channel is shown.

[0174] Figure 12 The melting curve of mixed positive pseudoviruses of HPV types 18, 45, and 59 in the ROX channel is shown.

[0175] Figure 13 The melting curve of mixed positive pseudoviruses of HPV types 31, 52, and 68 in the CY5 channel is shown.

[0176] Figure 14 The Tm value and melting curve of HPV type 58 in the FAM channel are shown.

[0177] Figure 15 The Tm value and melting curve of HPV type 52 in the CY5 channel are shown.

[0178] Figure 16 The Tm value and melting curve of HPV type 18 in the ROX channel are shown.

[0179] Figure 17 The Tm value and melting curve of HPV type 16 in the FAM channel are shown.

[0180] Figure 18 The Tm value and melting curve of HPV type 68 in the CY5 channel are shown.

[0181] Figure 19 The Tm values ​​and melting curves of HPV types 18, 45, and 59 in the ROX channel are shown.

[0182] Figure 20 The Tm values ​​and melting curves of HPV types 16, 33, and 58 in the FAM channel are shown.

[0183] Figure 21 The Tm value and melting curve of HPV type 58 in the FAM channel are shown.

[0184] Figure 22 The Tm value and melting curve of HPV type 52 in the CY5 channel are shown.

[0185] Figure 23 The Tm value and melting curve of HPV 59 in the ROX channel are shown. Detailed Implementation

[0186] This invention discloses primer-probe combinations, reagents, and applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0187] Existing melting curve products generally use DNA or RNA as targets for nucleic acid detection, which to varying degrees suffers from drawbacks such as complex operation, low sensitivity, and low specificity. However, the primer-probe combination or reagent of this invention uses E6 / E7 mRNA as a template for some types and L1 region DNA as a template for others, thus simultaneously ensuring sensitivity during genotyping and avoiding false negatives, which is beneficial for subsequent disease diagnosis and treatment. Currently, similar reagent kits on the market are generally stored at -20℃, while the reagent of this invention can be stored at 2–8℃ for one year. Most reagents have complex principles, difficult primer-probe design, and complex operation, while this invention is simple to operate and easy to implement.

[0188] The purpose of this invention is to enable the simple, rapid, and accurate detection of multiple HPV types' DNA and mRNA in a single reaction, thereby achieving genotyping. This invention utilizes asymmetric PCR technology—melting curve technology—to perform fluorescent PCR detection and genotyping of DNA and mRNA fragments from nine HPV types (16, 18, 31, 33, 45, 52, 58, 59, and 68) in a single tube.

[0189] Specifically:

[0190] 1. Primer and probe design

[0191] In this invention, specific primers and probes are designed for the E6 / E7 or L1 segments of HPV types 16, 18, 31, 33, 45, 52, 58, 59, and 68, which have high prevalence. The FAM and ROX channels are used to detect E6 / E7 mRNA, and the CY5 channel is used to detect L1 DNA.

[0192] This invention provides a primer set comprising at least one primer pair from ten primer pairs, the primer and probe sequences being as follows:

[0193] (1) Primer pairs and probes for detecting HPV16, the nucleotide sequences of which are shown in SEQ ID NO:1, 2 and 5 respectively;

[0194] (2) Primer pairs and probes for detecting HPV33, the nucleotide sequences of which are shown in SEQ ID NO:1, 3 and 5 respectively;

[0195] (3) Primer pairs and probes for detecting HPV58, the nucleotide sequences of which are shown in SEQ ID NO:1, 4 and 5 respectively;

[0196] (4) Primer pairs and probes for detecting HPV18, the nucleotide sequences of which are shown in SEQ ID NO:6, 7 and 11 respectively;

[0197] (5) Primer pairs and probes for detecting HPV45, the nucleotide sequences of which are shown in SEQ ID NO:6, 8 and 11 respectively;

[0198] (6) Primer pairs and probes for detecting HPV59, the nucleotide sequences of which are shown in SEQ ID NO:9, 10 and 11 respectively;

[0199] (7) Primer pairs and probes for detecting HPV31, the nucleotide sequences of which are shown in SEQ ID NO:12, 13 and 18 respectively;

[0200] (8) Primer pairs and probes for detecting HPV52, the nucleotide sequences of which are shown in SEQ ID NO:14, 15 and 18 respectively;

[0201] (9) Primer pairs and probes for detecting HPV68, the nucleotide sequences of which are shown in SEQ ID NO:16, 17 and 18 respectively.

[0202] (10) Primer pairs and probes used to detect internal standards, the nucleotide sequences of which are shown in SEQ ID NO:19, 20 and 21, respectively.

[0203] SEQ ID NO:1: TGCGACGTGAGGTATATGACTTTG

[0204] SEQ ID NO:2:GTTGTTCCATACAAACTATAACA

[0205] SEQ ID NO:3:AGATAAGAACCGAAACACAGT

[0206] SEQ ID NO:4:GATAGCAATCGTAAACACACT

[0207] SEQ ID NO:5:AGAGATGGGAATCCATATGCTGTATGTG

[0208] (5' end is labeled FAM, 3' end is labeled BHQ1)

[0209] SEQ ID NO:6:CCGACGAGCCGAACCACA

[0210] SEQ ID NO:7:GGACACACAAAGGACAGGGTGTTC

[0211] SEQ ID NO:8:CGGACACACAAAGGACAAGGTGCT

[0212] SEQ ID NO:9:GTTTCTTCCCAGGCTGCTACTGAT

[0213] SEQ ID NO:10:ATTTGAAAAGGTGCTAGATGCCG

[0214] SEQ ID NO:11:ATGTTGTGTATGTGTTGTAAGT

[0215] (5' base ROX,3' base BHQ2)

[0216] SEQ ID NO:12:GGATTTCCTGATACATCTTTT

[0217] SEQ ID NO:13:CAGGACCACCGGCATATCTATTA

[0218] SEQ ID NO:14:GGTTTTCCAGATACATCT

[0219] SEQ ID NO:15:GGTTTACCAGCATATTTGTTACTG

[0220] SEQ ID NO:16:GGGTTTCCCTACCTGATCCTAAT

[0221] SEQ ID NO:17:CAGTAACAAATATGCTGGTAAACC

[0222] SEQ ID NO:18:TAATCCTGAAACTCAACGCTTAGTTTG

[0223] (5' construct CY5,3' construct BHQ2)

[0224] SEQ ID NO:19:CTACTCCCAGGAGCAGGGAG

[0225] SEQ ID NO:20:GTGTCTGTTTGAGGTTGCTAGTG

[0226] SEQ ID NO:21:GGCAGAGCCATCTATTGCTTACATTTGCT

[0227] (The 5' end is labeled HEX, and the 3' end is labeled BHQ1)

[0228] The Taqman probe of the probe has a length of 10–40 bp, preferably 20–30 bp.

[0229] The 5' end of the probe can be labeled with a fluorescent reporter group, such as FAM, HEX, JOE, HEX, ROX, or CY5; the 3' end can be labeled with a fluorescent quencher group, such as BHQ1 or BHQ2.

[0230] Preferably, the Taqman probe for detecting HPV16, HPV33, and HPV58 is labeled with FAM at the 5' end and BHQ1 at the 3' end;

[0231] Preferably, the 5' end of the Taqman probe for detecting HPV18, HPV45, and HPV59 is labeled with ROX, and the 3' end is labeled with BHQ2;

[0232] Preferably, the 5' end of the Taqman probe for detecting HPV31, HPV52, and HPV68 is labeled CY5, and the 3' end is labeled BHQ2;

[0233] Preferably, the Taqman probe for detecting the internal standard is labeled HEX at the 5' end and BHQ1 at the 3' end.

[0234] In the primer and probe combination, SEQ ID NO:1, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, and SEQ ID NO:19 are restriction primers with a concentration of 0.02–0.05 μM; SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, and SEQ ID NO:20 are non-restrictive primers with a concentration of 0.2–1 μM; and the probe has a concentration of 0.2–0.4 μM.

[0235] This invention provides a primer and probe combination and typing reagent for detecting HPV DNA and mRNA, including PCR reaction solution 1, PCR reaction solution 2, negative control and positive control.

[0236] The PCR reaction solution 1 contains Tricine (pH 8.3), DMSO, NaN3, UNG enzyme, rTth DNA polymerase and dNTPs; the PCR reaction solution 2 includes Mn(OAc)2, Mg(OAc)2, KOAc and NaN3.

[0237] In some specific embodiments, the PCR reaction solution 1 includes: 100mM Tricine (pH 8.3), 2% DMSO, 0.02% NaN3, 0.3μL of UNG enzyme at a concentration of 1U / μL, 1μL of rTth enzyme at a concentration of 5U / μL, 0.3mM each of dATP, dGTP, dCTP, and dUTP, primers, and probes (the final concentrations of each primer and probe are: 0.02-0.05μM for restriction primers, 0.2-1μM for non-restriction primers, and 0.2-0.4μM each for specific probes), with the remainder being ultrapure water; the PCR reaction solution 2 includes 2mM Mn(OAc)2, 2mM Mg(OAc)2, 100mM KOAc, 0.02% NaN3, with the remainder being ultrapure water.

[0238] The DNA polymerase is rTth DNA polymerase.

[0239] Negative control: The negative control is a pseudovirus solution containing a specific target DNA fragment of the internal standard.

[0240] Positive control: The positive control is a pseudovirus solution containing an internal standard specific target DNA fragment, or an HPV E6 / E7 or L1 region specific target fragment.

[0241] 2. Nucleic acid extraction:

[0242] Nucleic acid was extracted from the samples using a magnetic bead method, along with negative and positive controls. After extraction, the nucleic acid can be used immediately for PCR testing, or transferred to centrifuge tubes and stored at -20°C for subsequent nucleic acid testing.

[0243] 3. Preparation of the reaction system:

[0244] The reaction volume is 40 μL. Add 10 μL of PCR reaction solution 1, 5 μL of PCR reaction solution 2, and 25 μL of nucleic acid extract to the amplification tubes in sequence, seal the tubes tightly, label them, centrifuge briefly, and transfer them to the PCR amplification area for PCR detection.

[0245] 4. On-machine testing:

[0246] The detection was performed on a SLAN 96 microcontroller. The project type was selected as "Standard Melting Curve," and the FAM, HEX, ROX, and Cy5 channels were selected simultaneously. The melting curve parameters were set to "Step Mode," with the "Scan Interval" set to 0.5℃ and the "Isothermal" setting to 15s. The PCR amplification program was as follows: 50℃ for 2 min; 60℃ for 30 min; 95℃ for 3 min; 95℃ for 15 s, 60℃ for 30 s, for 45 cycles. The melting curve analysis procedure was set as follows: 95℃ for 2 min; 40℃ for 2 min, gradually increasing the temperature to 80℃, collecting fluorescence signals once every 0.5℃ increase during this process.

[0247] 5. Results Analysis:

[0248] After the amplification reaction is complete, the instrument automatically saves the results, which can be analyzed automatically using software or manually by adjusting the baseline and threshold values.

[0249] Negative control: No melting peaks were observed in the FAM, ROX, and CY5 channels;

[0250] Positive control: Melting peaks were observed in the FAM, ROX, and CY5 channels, and the genotyping results were HPV16, HPV18, and HPV31, respectively.

[0251] The range of Tm values ​​for each type in each channel is shown in Table 1:

[0252] Table 1

[0253]

[0254]

[0255] 1) After both negative and positive controls meet the requirements, the sample results are analyzed. If the negative and positive controls do not meet the requirements, the test is invalid and must be repeated.

[0256] 2) If the internal standard has a melting peak at the corresponding Tm value, and each type in the FAM, ROX, and CY5 channels has a melting curve at the corresponding Tm value, then it can be judged as a positive type.

[0257] 3) If the internal standard has a melting peak at the corresponding Tm value, and the FAM, ROX, and CY5 channels do not have melting curves at the corresponding Tm value, then the corresponding type can be judged as negative.

[0258] 4) If the internal standard does not have a melting peak at the corresponding Tm value, then this test is not reliable and needs to be repeated.

[0259] Unless otherwise specified, the raw materials, reagents, consumables and instruments involved in this invention are all commercially available products and can be purchased from the market.

[0260] The present invention will be further illustrated below with reference to the embodiments:

[0261] Example 1: Primer and probe reagent combination for detecting HPV DNA and mRNA 1

[0262] (I) Primer and probe reagent combination 1

[0263] Specific primers and probes were designed for the E6 / E7 or L1 segments of HPV types 16, 18, 31, 33, 45, 52, 58, 59, and 68, which have high prevalence. The FAM and ROX channels were used to detect E6 / E7 mRNA, and the CY5 channel was used to detect L1 DNA.

[0264] The primer and probe sequences are as follows:

[0265] (1) Primer pairs and probes for detecting HPV16, the nucleotide sequences of which are shown in SEQ ID NO:1, 2 and 5 respectively;

[0266] (2) Primer pairs and probes for detecting HPV33, the nucleotide sequences of which are shown in SEQ ID NO:1, 3 and 5 respectively;

[0267] (3) Primer pairs and probes for detecting HPV58, the nucleotide sequences of which are shown in SEQ ID NO:1, 4 and 5 respectively;

[0268] (4) Primer pairs and probes for detecting HPV18, the nucleotide sequences of which are shown in SEQ ID NO:6, 7 and 11 respectively;

[0269] (5) Primer pairs and probes for detecting HPV45, the nucleotide sequences of which are shown in SEQ ID NO:6, 8 and 11 respectively;

[0270] (6) Primer pairs and probes for detecting HPV59, the nucleotide sequences of which are shown in SEQ ID NO:9, 10 and 11 respectively;

[0271] (7) Primer pairs and probes for detecting HPV31, the nucleotide sequences of which are shown in SEQ ID NO:12, 13 and 18 respectively;

[0272] (8) Primer pairs and probes for detecting HPV52, the nucleotide sequences of which are shown in SEQ ID NO:14, 15 and 18 respectively;

[0273] (9) Primer pairs and probes for detecting HPV68, the nucleotide sequences of which are shown in SEQ ID NO:16, 17 and 18 respectively.

[0274] (10) Primer pairs and probes used to detect internal standards, the nucleotide sequences of which are shown in SEQ ID NO:19, 20 and 21, respectively.

[0275] SEQ ID NO:1: TGCGACGTGAGGTATATGACTTTG

[0276] SEQ ID NO:2:GTTGTTCCATACAAACTATAACA

[0277] SEQ ID NO:3:AGATAAGAACCGAAACACAGT

[0278] SEQ ID NO:4:GATAGCAATCGTAAACACACT

[0279] SEQ ID NO:5:AGAGATGGGAATCCATATGCTGTATGTG

[0280] (5' end is labeled FAM, 3' end is labeled BHQ1)

[0281] SEQ ID NO:6: CCGACGAGCCGAACCACA

[0282] SEQ ID NO:7:GGACACACAAAGGACAGGGTGTTC

[0283] SEQ ID NO:8: CGGACACACAAAGGACAAGGTGCT

[0284] SEQ ID NO:9:GTTTCTTCCCAGGCTGCTACTGAT

[0285] SEQ ID NO:10:ATTTGAAAAGGTGCTAGATGCCG

[0286] SEQ ID NO:11:ATGTTGTGTATGTGTTGTAAGT

[0287] (The 5' end is labeled ROX, and the 3' end is labeled BHQ2)

[0288] SEQ ID NO:12:GGATTTCCTGATACATCTTTT

[0289] SEQ ID NO:13:CAGGACCACCGGCATATCTATTA

[0290] SEQ ID NO:14:GGTTTTCCAGATACATCT

[0291] SEQ ID NO:15: GGTTTACCAGCATATTTGTTACTG

[0292] SEQ ID NO:16:GGGTTTCCCTAACCTGATCCTAAT

[0293] SEQ ID NO:17:CAGTAACAAATATGCTGGTAAACC

[0294] SEQ ID NO:18:TAATCCTGAAACTCAACGCTTAGTTTG

[0295] (The 5' end is marked CY5, and the 3' end is marked BHQ2)

[0296] SEQ ID NO:19:CTACTCCCAGGAGCAGGGAG

[0297] SEQ ID NO:20:GTGTCTGTTTGAGGTTGCTAGTG

[0298] SEQ ID NO:21:GGCAGAGCCATCTATTGCTTACATTTGCT

[0299] (The 5' end is labeled HEX, and the 3' end is labeled BHQ1)

[0300] The Taqman probe of the probe has a length of 20–30 bp.

[0301] The Taqman probes used to detect HPV16, HPV33, and HPV58 are labeled with FAM at the 5' end and BHQ1 at the 3' end.

[0302] The Taqman probes for detecting HPV18, HPV45, and HPV59 are labeled with ROX at the 5' end and BHQ2 at the 3' end.

[0303] The Taqman probes for detecting HPV31, HPV52, and HPV68 are labeled with CY5 at the 5' end and BHQ2 at the 3' end.

[0304] The Taqman probe used for detecting the internal standard is labeled HEX at the 5' end and BHQ1 at the 3' end.

[0305] In the primer and probe combination, SEQ ID NO:1, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, and SEQ ID NO:19 are restriction primers with a concentration of 0.02–0.05 μM; SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, and SEQ ID NO:20 are non-restrictive primers with a concentration of 0.2–1 μM; and the probe has a concentration of 0.2–0.4 μM.

[0306] The primer, probe, and typing reagent combination for detecting HPV DNA and mRNA includes PCR reaction solution 1, PCR reaction solution 2, negative control, and positive control.

[0307] The PCR reaction solution 1 comprises: 100mM Tricine (pH 8.3), 2% DMSO, 0.02% NaN3, 0.3μL of UNG enzyme at a concentration of 1U / μL, 1μL of rTth enzyme at a concentration of 5U / μL, 0.3mM each of dATP, dGTP, dCTP, and dUTP, primers, and probes (the final concentrations of each primer and probe are: 0.02μM for restriction primers, 0.2μM for non-restriction primers, and 0.2μM each for specific probes), with the remainder being ultrapure water; the PCR reaction solution 2 comprises 2mM Mg(OAc)2, 100mM KOAc, 0.02% NaN3, with the remainder being ultrapure water.

[0308] The DNA polymerase is rTth DNA polymerase.

[0309] Negative control: The negative control is a pseudovirus solution containing a specific target DNA fragment of the internal standard.

[0310] Positive control: The positive control is a pseudovirus solution containing an internal standard specific target DNA fragment, or an HPV E6 / E7 or L1 region specific target fragment.

[0311] (II) Detection Methods

[0312] 1. Nucleic acid extraction:

[0313] Nucleic acid was extracted from the samples using a magnetic bead method, along with negative and positive controls. After extraction, the nucleic acid can be used immediately for PCR testing, or transferred to centrifuge tubes and stored at -20°C for subsequent nucleic acid testing.

[0314] 2. Preparation of the reaction system:

[0315] The reaction volume is 40 μL. Add 10 μL of PCR reaction solution 1, 5 μL of PCR reaction solution 2, and 25 μL of nucleic acid extract to the amplification tubes in sequence, seal the tubes tightly, label them, centrifuge briefly, and transfer them to the PCR amplification area for PCR detection.

[0316] 3. On-machine testing:

[0317] The detection was performed on a SLAN 96 microcontroller. The project type was selected as "Standard Melting Curve," and the FAM, HEX, ROX, and Cy5 channels were selected simultaneously. The melting curve parameters were set to "Step Mode," with the "Scan Interval" set to 0.5℃ and the "Isothermal" setting to 15s. The PCR amplification program was as follows: 50℃ for 2 min; 60℃ for 30 min; 95℃ for 3 min; 95℃ for 15 s, 60℃ for 30 s, for 45 cycles. The melting curve analysis procedure was set as follows: 95℃ for 2 min; 40℃ for 2 min, gradually increasing the temperature to 80℃, collecting fluorescence signals once every 0.5℃ increase during this process.

[0318] 4. Results Analysis:

[0319] After the amplification reaction is complete, the instrument automatically saves the results, which can be analyzed automatically using software or manually by adjusting the baseline and threshold values.

[0320] Negative control: No melting peaks were observed in the FAM, ROX, and CY5 channels;

[0321] Positive control: Melting peaks were observed in the FAM, ROX, and CY5 channels, and the genotyping results were HPV16, HPV18, and HPV31, respectively.

[0322] The range of Tm values ​​for each type in each channel is shown in Table 1:

[0323] Table 1

[0324]

[0325] 1) After both negative and positive controls meet the requirements, the sample results are analyzed. If the negative and positive controls do not meet the requirements, the test is invalid and must be repeated.

[0326] 2) If the internal standard has a melting peak at the corresponding Tm value, and each type in the FAM, ROX, and CY5 channels has a melting curve at the corresponding Tm value, then it can be judged as a positive type.

[0327] 3) If the internal standard has a melting peak at the corresponding Tm value, and the FAM, ROX, and CY5 channels do not have melting curves at the corresponding Tm value, then the corresponding type can be judged as negative.

[0328] 4) If the internal standard does not have a melting peak at the corresponding Tm value, then this test is not reliable and needs to be repeated.

[0329] (III) Experimental Results

[0330] Positive pseudovirus samples containing one or more of the following HPV types—16, 18, 31, 33, 45, 52, 58, 59, and 68—were tested using the detection method described in section (II). Results are shown below. Figures 1-13 .

[0331] Example 2: Primer and probe reagent combination for detecting HPV DNA and mRNA 2

[0332] Only the amount of primers and probes in PCR reaction solution 1 was adjusted; all other conditions remained the same as in Example 1.

[0333] The PCR reaction solution 1 comprises: 100mM Tricine (pH 8.3), 2% DMSO, 0.02% NaN3, 0.3μL of UNG enzyme at a concentration of 1U / μL, 1μL of rTth enzyme at a concentration of 5U / μL, 0.3mM each of dATP, dGTP, dCTP, and dUTP, primers, and probes (the final concentrations of each primer and probe are: 0.05μM for restriction primers, 0.1μM for non-restriction primers, and 0.4μM each for specific probes), with the remainder being ultrapure water; the PCR reaction solution 2 comprises 2mM Mn(OAc)2, 2mM Mg(OAc)2, 100mM KOAc, 0.02% NaN3, with the remainder being ultrapure water.

[0334] A sample containing one of HPV58 or HPV52 positive pseudoviruses was tested. Results are shown below. Figure 14 , Figure 15 .

[0335] Example 3: Primer and probe reagent combination for detecting HPV DNA and mRNA 3

[0336] Only the amount of primers and probes in PCR reaction solution 1 was adjusted; all other conditions remained the same as in Example 1.

[0337] The PCR reaction solution 1 comprises: 100mM Tricine (pH 8.3), 2% DMSO, 0.02% NaN3, 0.3μL of UNG enzyme at a concentration of 1U / μL, 1μL of rTth enzyme at a concentration of 5U / μL, 0.3mM each of dATP, dGTP, dCTP, and dUTP, primers, and probes (the final concentrations of each primer and probe are: 0.03μM for restriction primers, 0.45μM for non-restriction primers, and 0.4μM each for specific probes), with the remainder being ultrapure water; the PCR reaction solution 2 comprises 2mM Mn(OAc)2, 2mM Mg(OAc)2, 100mM KOAc, 0.02% NaN3, with the remainder being ultrapure water.

[0338] A sample containing one of HPV18 or HPV16 positive pseudoviruses was tested. Results are shown below. Figure 16 , Figure 17 .

[0339] Example 4: Sensitivity and Specificity Experiment

[0340] Sensitivity test: HPV types within the detection range in the second-generation human papillomavirus whole genome typing reference were diluted to 1×10⁻⁶ using TE solution. 3 ~1×10 4 The copies / reaction was used for detection, and the results are shown in Table 2. This shows that the HPV types within the detection range of the method provided by the present invention were all detected and could be accurately classified.

[0341] Table 2

[0342]

[0343] Specificity assay: HPV types not within the detection range in the second-generation human papillomavirus whole genome typing reference were diluted to 1×10⁻⁶ using TE solution. 4 ~1×10 5 The copies / reaction was performed for detection, and the results are shown in Table 3. This indicates that the method provided by the present invention has no cross-reaction with other pathogens and other HPV types, and has good specificity.

[0344] Table 3

[0345]

[0346]

[0347] Example 5: Repeatability Experiment

[0348] 1. The amounts of each component in each reaction solution were consistent with those described in Example 1 of the patent. A 68-type sample was tested in three replicates, and the results are as follows: Figure 18As shown, the differences in Tm values ​​among different types are small, and the repeatability is good.

[0349] 2. The amounts of each component in each reaction solution were consistent with those described in Example 1 of the patent. Mixed samples of types 18, 45, and 59 were tested in three replicates. The results are as follows: Figure 19 As shown, the differences in Tm values ​​among different types are small, and the repeatability is good.

[0350] 3. The amounts of each component in each reaction solution were consistent with those described in Example 1 of the patent. Mixed samples of types 16, 33, and 58 were tested, with two replicates. The results are as follows: Figure 20 As shown, the differences in Tm values ​​among different types are small, and the repeatability is good.

[0351] Comparative example: Other primer-probe combinations

[0352] The amount of each component used in each reaction solution is consistent with that described in Example 1 of the patent, and the detection is carried out according to the detection method described in Example 1. Multiple sets of primers of each type are prepared, and the best one is selected. The set with the higher melting peak height is selected for multiple combinations.

[0353] 1. Type 58 primer combination

[0354] The HPV58 experimental group was the final sequence combination selected, while the other two control groups used sequence combinations with poorer results. The detection concentration was 1×10⁻⁶. 5 Fake virus samples (copies / mL).

[0355] HPV 58 control group 1-R: 5'-ATACTCACTTATTTTAGATAGCAATCGT-3' (SEQ ID NO:22)

[0356] HPV 58 control group 2-R: 5'-CAATCGTAAACACACTTTACATACTG-3' (SEQ ID NO:23)

[0357] from Figure 21 The data shows that the melting peak height of the experimental group was significantly higher than that of the control group among the three combinations of HPV58, thus identifying the primers and probes of HPV58 as the experimental group.

[0358] 2. Primer combination of type 52

[0359] The HPV52 experimental group used the final sequence combination, while the other two control groups used sequence combinations with poorer results. The detection concentration was 1×10⁻⁶. 5 Fake virus samples (copies / mL).

[0360] HPV 52 control group 1-F: 5'-AGAATTAAATTGCCGGACCCTAAT-3' (SEQ ID NO:24)

[0361] HPV 52 control group 1-R: 5'-CCAAATTTATTAGGGTCCGGCAA-3' (SEQ ID NO:25)

[0362] HPV 52 control group 2-F: 5'-TTGCCGGACCCTAATAAATTTGGTT-3' (SEQ ID NO:26)

[0363] HPV 52 control group 2-R: 5'-TTATCTATACCAGGTTTACCAGCA-3' (SEQ ID NO:27)

[0364] from Figure 22 The data shows that the melting peak height of the experimental group was significantly higher than that of the control group among the three combinations of HPV52, thus confirming that the primers and probes for HPV52 were for the experimental group.

[0365] 3. Primer combination of type 59

[0366] The HPV59 experimental group used the final sequence combination, while the other two control groups used sequence combinations with poorer results. The detection concentration was 1×10⁻⁶. 5 Fake virus samples (copies / mL).

[0367] HPV 59 control group 1-F: 5'-ACCTCTTGTTTCTTCCCAGGC-3' (SEQ ID NO:28)

[0368] HPV 59 control group 1-R: 5'-AGGAATTGTAAATGCAGTGTTGG-3' (SEQ ID NO:29)

[0369] HPV 59 control group 2-F: 5'-ATTGCAACCTCTTGTTTCTTCCCAG-3' (SEQ ID NO:30)

[0370] HPV 59 control group 2-R: 5'-TGTAAATGCAGTGTTGGCAGTACTA-3' (SEQ ID NO:31).

[0371] from Figure 23 The data shows that the melting peak height of the experimental group was significantly higher than that of the control group among the three combinations of HPV59, thus identifying the primers and probes of HPV59 as the experimental group.

[0372] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer probe set characterized in that, It consists of combination 1, combination 2, combination 3, combination 4, combination 5, combination 6, combination 7, combination 8 and combination 9; Combination 1 consists of primer 1 with the sequence shown in SEQ ID NO:1, primer 2 with the sequence shown in SEQ ID NO:2, and probe 1 with the sequence shown in SEQ ID NO:5; The combination 2 consists of primer 1 with the sequence shown in SEQ ID NO:1, primer 3 with the sequence shown in SEQ ID NO:3, and probe 1 with the sequence shown in SEQ ID NO:5; The combination 3 consists of primer 1 with the sequence shown in SEQ ID NO:1, primer 4 with the sequence shown in SEQ ID NO:4, and probe 1 with the sequence shown in SEQ ID NO:5; The combination 4 consists of primer 5 with the sequence shown in SEQ ID NO:6, primer 6 with the sequence shown in SEQ ID NO:7, and probe 2 with the sequence shown in SEQ ID NO:11; The combination 5 consists of primer 5 with the sequence shown in SEQ ID NO:6, primer 7 with the sequence shown in SEQ ID NO:8, and probe 2 with the sequence shown in SEQ ID NO:11; The combination 6 consists of primer 8 with the sequence shown in SEQ ID NO:9, primer 9 with the sequence shown in SEQ ID NO:10, and probe 2 with the sequence shown in SEQ ID NO:11; The combination 7 consists of primer 10 with the sequence shown in SEQ ID NO:12, primer 11 with the sequence shown in SEQ ID NO:13, and probe 3 with the sequence shown in SEQ ID NO:18; The combination 8 consists of primer 12 with the sequence shown in SEQ ID NO:14, primer 13 with the sequence shown in SEQ ID NO:15, and probe 3 with the sequence shown in SEQ ID NO:18; The combination 9 consists of primer 14 with the sequence shown in SEQ ID NO:16, primer 15 with the sequence shown in SEQ ID NO:17, and probe 3 with the sequence shown in SEQ ID NO:

18.

2. The primer probe set of claim 1, wherein, It also includes combination 10; The combination 10 consists of primer 16 with the sequence shown in SEQ ID NO:19, primer 17 with the sequence shown in SEQ ID NO:20, and probe 4 with the sequence shown in SEQ ID NO:

21.

3. The application of the primer-probe set as described in claim 1 or 2 in the following aspects: (I) HPV testing for non-diagnostic purposes; and / or (II) HPV typing for non-diagnostic purposes; and / or (III) Preparation of reagents, kits, or devices for detecting HPV; and / or (IV) Preparation of reagents, kits or devices for HPV typing; The HPV includes one or more of HPV 16, HPV 18, HPV 31, HPV 33, HPV 45, HPV 52, HPV 58, HPV 59, or HPV 68.

4. An agent characterized in that, It includes the primer and probe set as described in claim 1 or 2, and acceptable excipients or auxiliaries.

5. The reagent as described in claim 4, characterized in that, include: The concentration of the restriction primers was 0.02–0.05 μM; and / or The concentration of non-restrictive primers is 0.2–1 μM; and / or The concentration of the probe is 0.2–0.4 μM; The restriction primers include primer 1, primer 5, primer 8, primer 10, primer 12, primer 14, or primer 16; The non-restrictive primers include primer 2, primer 3, primer 4, primer 6, primer 7, primer 9, primer 11, primer 13, primer 15, or primer 17.

6. A reagent kit, characterized in that, It includes the reagents as described in claim 4 or 5, as well as acceptable excipients or additives.

7. The kit according to claim 6, characterized in that, include: PCR reaction solution 1, PCR reaction solution 2, negative control and positive control; The PCR reaction solution 1 includes: (a) Tricine at pH 8.3; and / or (b) DMSO; and / or (c) NaN3; and / or (d) UNG enzyme; and / or (e) DNA polymerase; and / or (f) dNTP; The DNA polymerase includes rTth DNA polymerase; The PCR reaction solution 2 includes one or more of Mn(OAc)2, Mg(OAc)2, KOAc or NaN3; The negative control includes a pseudovirus solution containing a specific target DNA fragment of an internal standard; The positive control includes a pseudovirus solution containing an internal standard specific target DNA fragment, or an HPV E6 / E7 or L1 region specific target fragment.

8. A non-diagnostic genotyping method for HPV 16, HPV 18, HPV 31, HPV 33, HPV 45, HPV 52, HPV 58, HPV 59, or HPV 68, characterized in that... This includes using the primer and probe set and amplification reagents as described in claim 1 or 2 to amplify the sample, obtain the melting curve and the temperature corresponding to the melting peak, and obtain the typing result by comparison when negative and positive controls are established; Wherein, the fluorescence channel of probe 1 is channel 1, the fluorescence channel of probe 2 is channel 2, the fluorescence channel of probe 3 is channel 3, and the fluorescence channel of probe 4 is channel 4; The comparison includes: (i) If the temperature corresponding to the melting peak of channel 1 falls within 70±1.5℃, and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV16 positive; and / or (ii) If the temperature corresponding to the melting peak of channel 1 falls within 60±1.5℃, and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV33 positive; and / or (iii) If the temperature corresponding to the melting peak of channel 1 falls within 50±1.5℃, and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV58 positive; and / or (iv) If the temperature corresponding to the melting peak of channel 2 falls within 69±1.5℃, and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV18 positive; and / or (v) If the temperature corresponding to the melting peak of channel 2 falls within 61±1.5℃, and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV45 positive; and / or (vi) If the temperature corresponding to the melting peak of channel 2 falls within 50±1.5℃, and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV59 positive; and / or (vii) If the temperature corresponding to the melting peak of channel 3 falls within 67±1.5℃, and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV31 positive; and / or (viii) If the temperature corresponding to the melting peak of channel 3 falls within 63±1.5℃, and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV52 positive; and / or (ix) If the temperature corresponding to the melting peak of channel 3 falls within 49±1.5℃ and the temperature corresponding to the melting peak of channel 4 falls within 61±1.5℃, then the sample is HPV68 positive.

Images