Intestinal microorganism related kit and method for colorectal cancer screening and application of enteric microorganism related kit and method

Abstract

The invention relates to an enteric microorganism related kit and method for colorectal cancer screening and application of the enteric microorganism related kit, and the enteric microorganism related kit comprises a reagent for detecting an Fp strain, or a reagent for detecting an Fn strain and a Poras strain, or a reagent for detecting the Fn strain, the Poras strain and a LacY strain. The invention designs a reagent for specific gene detection of multiple microbial strains in intestinal tracts, and through accurate primer and probe design and construction of a multiple real-time fluorescent quantitative PCR method, identification and relative abundance analysis of multiple strains including Fn, Poras, LacY, Fp and the like in excrement can be realized in a reaction hole. The reagent is based on a universal fluorescent PCR technology and an easily obtained excrement sample, can realize household sampling and rapid high-throughput detection, is suitable for early diagnosis and early screening of colorectal cancer, and can realize higher economic and social values.

Description

Technical Field

[0001] This invention relates to the field of molecular biology detection technology, and in particular to gut microbiota-related reagent kits, methods, and uses for colorectal cancer screening. Background Technology

[0002] Colorectal cancer is one of the most common and deadliest cancers. Global cancer statistics show[1] that in 2022, there were more than 1.88 million new cases of colorectal cancer and nearly 920,000 deaths worldwide. Among all cancers, its incidence rate ranks third and its mortality rate ranks second, and it continues to increase compared with previous years. According to the cancer statistics released by the National Cancer Center of my country in 2022[2], in 2016, the incidence rate and mortality rate of colorectal cancer in my country ranked third and fifth among all cancers, respectively, with 408,000 new cases and 196,000 deaths.

[0003] Colonoscopy is currently the main means of diagnosing and screening colorectal cancer. However, the colonoscopy procedure is complicated, the examination compliance is low and the accuracy of the preceding auxiliary means is low, which limits its advantages. At the same time, due to insufficient bowel preparation or unclear lesions, colonoscopy is prone to missing positive cases (especially early lesions). In addition to colonoscopy screening, colonography CT and fecal occult blood test are also common colorectal cancer screening methods. However, imaging examinations such as colonography CT are difficult to diagnose early cases with hidden lesions and small size. Fecal occult blood test (FOBT, FIT) is a non-invasive colorectal cancer screening method. Although it has the advantage of being widely available, it is mainly for gastrointestinal bleeding and has little correlation with colorectal cancer. Therefore, the detection specificity is not high. Other blood biomarkers such as CEA and CA19-9 have important value for clinical diagnosis, adjuvant treatment and prognosis of colorectal cancer[3], but they do not have the advantage of early detection or obvious colorectal cancer specificity. In vitro molecular diagnostics has undeniable advantages, such as non-invasiveness, relatively simple operation, and high diagnostic performance, making it easier to promote and use in a large population. With the increasing aging of my country's population, the number of cases and incidence of colorectal cancer are showing an increasing trend year by year; the five-year survival rate of patients with stage I colorectal cancer can reach 90%, while the five-year survival rate of patients with stage IV colorectal cancer is only 10% [4]. Therefore, developing an in vitro molecular diagnostic tool with early detection, high sensitivity and high specificity is of great significance for realizing the strategy of early diagnosis and treatment of colorectal cancer.

[0004] Numerous studies in recent years have shown that gut microbiota is a valuable in vitro diagnostic marker for colorectal cancer screening. It can reflect the risk of disease in subjects by assessing changes in certain species or communities of gut microbiota in fecal samples. Fusobacterium nucleatum (F. nucleatum, Fn, Fusobacterium nucleatum) can express proteins such as FadA and Fap2 that promote cancer development and is a pathogenic bacterium of colorectal cancer [5][6]. The research of Professor Yu Jun's team at the Chinese University of Hong Kong [7] showed that the method of detecting the content of fecal Fn by real-time fluorescence quantitative PCR can achieve a sensitivity of 77.7% and a specificity of 79.5% for the diagnosis of colorectal cancer, demonstrating the value of Fn as a diagnostic marker for colorectal cancer. Zeller et al. found that a species of Porphyromonas genus, Porphyromonas asaccharolytica (Por. asaccharolytica, Poras, Porphyromonas non-glycolytica or Bacteroides melanogenin) has certain colorectal cancer specificity. Using 16S sequencing, they found that the abundance of Poras in the feces of patients with stage I-IV colorectal cancer was significantly increased compared with that of healthy individuals (p = 0.00961); at the same time, it also showed an upregulation trend in patients with adenomas (p = 0.0646) [8]. Similarly, Professor Yu Jun's team at the Chinese University of Hong Kong published an article in 2019, which described that the abundance of a gene fragment encoding RNA reverse transcriptase in the feces of healthy individuals, patients with adenomas and patients with colorectal cancer showed a stepwise linear increase trend, and the diagnostic sensitivity for colorectal cancer and adenomas reached 62.1% and 48.3%, respectively, while the specificity was 78.5% for both. Furthermore, through gene sequence comparison, it was found that the gene fragment and the bacterial species Lachnoclostridium sp.YL32 (Lac.sp.YL32, LacY) had 97% homology [9]. Multiple studies

[10]

[11]

[12] have shown that Faecalibacterium prausnitzii (F. prausnitzii, Fp, Clostridium prausnitzii), a probiotic abundant in the human gut, is associated with intestinal inflammation and colorectal cancer. Downregulation of this species in the gut microbiota suggests an increased risk of related diseases or inflammation-related colorectal cancer.

[0005] Short-chain fatty acids (SCFAs) are byproducts of fermentation by human gut microbes and play an important role in gut health. Butyrate is a major type of SCFA, and the gut microbes that metabolize butyrate mainly come from the Clostridium genus XIVa and IV. There are two main metabolic pathways for the production of butyrate: one is through the butyryl-CoA:acetate CoA-transferase (BCoA) gene, and the other is through butyrate kinase, with the first pathway being the most common. Therefore, the BCoA gene can, to some extent, assess the abundance of butyrate (salt) fermenting microbes

[13]

[14] . The most common butyrate-producing microorganisms in the human gut via the BCoA gene include *Eubacterium rectale* A1-86 (GeneBank ID: GQ231300.1), *Eubacterium rectale* M104 / 1 (GeneBank ID: GQ231301.1), *Roseburia faecis* M72 / 1 (GeneBank ID: GQ231302.1), *Eubacterium hallii* SM6 / 1 (GeneBank ID: GQ231307.1), *Eubacterium hallii* SM6 L2-7 (GeneBank ID: DQ072258.2), *Roseburia hominis* A2-183 (GeneBank ID: AY796317.2), *Faecalibacterium prausnitzii* A2-165 (GeneBank ID: DQ072259.2), and *Anaerostipes caccae* L1-92 (GeneBank ID: GQ231300.1). ID: DQ151450.2) etc.

[15]

[16] .

[0006] The most common methods for detecting gut microbial DNA include 16S rRNA gene sequencing, whole-genome sequencing, and real-time quantitative PCR. 16S rRNA gene sequencing, based on the 16S rRNA gene sequence information of microorganisms, can achieve species-level analysis through bioinformatics methods and is the most common method for microbial detection. However, this method often requires PCR amplification before sequencing, and deviations in PCR amplification can easily lead to inaccuracies in abundance analysis. Whole-genome sequencing, on the other hand, breaks down microbial genomic DNA and sequences these short fragments, then combines them to obtain the complete genome sequence. It can achieve strain-level analysis. Because it does not require PCR amplification, its abundance analysis is more accurate and suitable for analyzing microbial abundance and discovering new microbial groups. However, like 16S rRNA gene sequencing, whole-genome sequencing requires sequencing platforms and specialized bioinformatics analysis methods, resulting in large data volumes, making it difficult to widely adopt in existing clinical testing institutions. Real-time quantitative PCR (qPCR) can analyze certain specific gene fragments, such as the 16S rRNA gene, at the bacterial species level. While it yields relatively less information, it is simpler to operate than sequencing methods and can detect specific gene sequences. Currently, most gut microbiome identification and detection at the bacterial species level are based on PCR amplification of the 16S rRNA gene. However, the 16S rRNA gene is highly homologous in prokaryotes, and different species may differ by only a few bases or even just one nucleotide, making accurate detection in multiplex PCR systems difficult and limiting the throughput of microbial detection on qPCR platforms.

[0007] When the 16S rRNA gene is used as an internal control in PCR-based detection methods, non-specific amplification of the negative control is common. In fluorescent PCR detection methods, the presence of a peak in the negative control raises questions about the experimental results. Even with methods such as UV sterilization and chemical inactivation, this non-specific amplification is difficult to avoid. This is mainly due to the presence of numerous microorganisms in the PCR raw materials and environment, particularly the presence of a certain amount of 16S rRNA gene in the Taq enzyme required for PCR amplification. Summary of the Invention

[0008] This invention targets the expression of the following gene: Transcription termination / antitermination protein NusG in *Fusobacterium nucleatum* (species number: ATCC25586); outer membrane protein HMP in *Porphyromonas asaccharolytica* (species number: ATCC 25260); group II intron reverse transcriptase / maturase in *Lachnoclostridium* (species family: LacY); Cytidinedeaminase in *Faecalibacterium prausnitzii* (species number: ATCC 27768); and the BCoA gene (butyryl-CoA:acetate CoA transferase gene expressed by butyryl-CoA in butyrate-producing bacteria). Based on conserved region sequences of genes, a series of species- or community-specific primers and probes were designed. Based on single or multiplex real-time quantitative PCR (qPCR) technology, these primers and probes were used for the specific detection and relative abundance assessment of the aforementioned species or communities. A colorectal cancer risk assessment mechanism based on logistic regression analysis was constructed using the sample detection results.

[0009] The first aspect of the present invention provides a kit comprising reagents for detecting Fp strains;

[0010] Preferably, the reagent is used to detect the Cytidine deaminase gene in Fp bacteria;

[0011] More preferably, the nucleotide sequence of the detected Cytidine deaminase gene is as shown in SEQ ID NO. 19, 20, 21, 22, 23, and 24; more preferably, the nucleotide sequence of the detected Cytidine deaminase gene is as shown in SEQ ID NO. 19.

[0012] In a preferred embodiment of the present invention, the above-mentioned kit further includes reagents for detecting the internal reference gene BCoA;

[0013] Preferably, the nucleotide sequence of the internal reference gene BCoA is shown in SEQ ID NO.25.

[0014] In a preferred embodiment of the present invention, the reagent for detecting the Cytidine deaminase gene of Fp bacteria and the reagent for detecting the internal reference gene BCoA respectively include an upstream primer, a downstream primer, and a probe.

[0015] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe of the nucleotide sequence of the Cytidine deaminase gene for detecting Fp bacteria SEQ ID NO.19 are as shown in SEQ ID NO.53-55, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of the nucleotide sequence of the Cytidine deaminase gene for detecting Fp bacteria SEQ ID NO.21 are as shown in SEQ ID NO.56-58, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of the Cytidine deaminase gene for detecting Fp bacteria SEQ ID NO.23 are as shown in SEQ ID NO.59-61.

[0016] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe used to detect the internal reference gene BCoA are shown in SEQ ID NO. 62-64, respectively.

[0017] A second aspect of the invention provides the use of the kit described in the first aspect in the preparation of reagents for the diagnosis and screening of colorectal cancer and precancerous high-risk lesions.

[0018] A third aspect of the present invention provides a kit comprising reagents for detecting Fn and Poras strains;

[0019] Preferably, the reagent is used to detect the Transcription termination / antitermination protein NusG gene of Fn bacteria and the outer membrane protein HMP gene of Poras bacteria;

[0020] More preferably, the nucleotide sequence of the detected Transcription termination / antitermination protein NusG gene is as shown in SEQ ID NO. 1, 2, 3, 4, 5, 6; more preferably, the nucleotide sequence of the detected Transcription termination / antitermination protein NusG gene is as shown in SEQ ID NO. 1;

[0021] More preferably, the nucleotide sequence of the detected outer membrane protein HMP gene is shown in SEQ ID NO.7, 8, 9, 10, 11, and 12; more preferably, the nucleotide sequence of the detected outer membrane protein HMP gene is shown in SEQ ID NO.7.

[0022] In a preferred embodiment of the present invention, the above-mentioned kit further includes reagents for detecting the internal reference gene BCoA;

[0023] Preferably, the nucleotide sequence of the internal reference gene BCoA is shown in SEQ ID NO.25.

[0024] In a preferred embodiment of the present invention, the reagents for detecting the Transcriptiontermination / antitermination protein NusG gene of Fn bacteria and the outer membrane protein HMP gene of Poras bacteria, and the reagents for detecting the internal reference gene BCoA, respectively include an upstream primer, a downstream primer, and a probe.

[0025] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.1 for detecting the nucleotide sequence of the Transcription termination / antitermination protein NusG gene of Fn bacteria are as shown in SEQ ID NO.26-28, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.3 for detecting the nucleotide sequence of the Transcription termination / antitermination protein NusG gene of Fn bacteria are as shown in SEQ ID NO.29-31, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.5 for detecting the nucleotide sequence of the Transcription termination / antitermination protein NusG gene of Fn bacteria are as shown in SEQ ID NO.32-34.

[0026] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.7 for detecting the outer membrane protein HMP gene of Poras bacteria are as shown in SEQ ID NO.35-37, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.9 for detecting the outer membrane protein HMP gene of Poras bacteria are as shown in SEQ ID NO.38-40, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.11 for detecting the outer membrane protein HMP gene of Poras bacteria are as shown in SEQ ID NO.41-43.

[0027] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe used to detect the internal reference gene BCoA are shown in SEQ ID NO. 62-64, respectively.

[0028] A fourth aspect of the invention provides the use of the reagents described in the third aspect in the preparation of kits for the diagnosis and screening of colorectal cancer and precancerous high-risk lesions.

[0029] A fifth aspect of the present invention provides a kit comprising reagents for detecting Fn, Poras, and LacY strains;

[0030] Preferably, the reagent is used to detect the Transcription termination / antitermination protein NusG gene of Fn bacteria, the outer membrane protein HMP gene of Poras bacteria, and the group II intron reverse transcriptase / maturase gene of LacY bacteria.

[0031] More preferably, the nucleotide sequence of the detected Transcription termination / antitermination protein NusG gene is as shown in SEQ ID NO. 1, 2, 3, 4, 5, 6; more preferably, the nucleotide sequence of the detected Transcription termination / antitermination protein NusG gene is as shown in SEQ ID NO. 1;

[0032] More preferably, the nucleotide sequence of the detected outer membrane protein HMP gene is shown in SEQ ID NO.7, 8, 9, 10, 11, and 12; more preferably, the nucleotide sequence of the detected outer membrane protein HMP gene is shown in SEQ ID NO.7.

[0033] More preferably, the nucleotide sequence of the detected group II intron reverse transcriptase / maturase gene is shown in SEQ ID NO. 13, 14, 15, 16, 17, and 18; more preferably, the nucleotide sequence of the detected group II intron reverse transcriptase / maturase gene is shown in SEQ ID NO. 13.

[0034] In a preferred embodiment of the present invention, the above-mentioned kit further includes reagents for detecting the internal reference gene BCoA;

[0035] Preferably, the nucleotide sequence of the internal reference gene BCoA is shown in SEQ ID NO.25.

[0036] In a preferred embodiment of the present invention, the reagents for detecting the Transcriptiontermination / antitermination protein NusG gene of Fn bacteria, the outer membrane protein HMP gene of Poras bacteria, and the group II intron reverse transcriptase / maturase gene of LacY bacteria, and the reagents for detecting the internal reference gene BCoA, respectively include an upstream primer, a downstream primer, and a probe.

[0037] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.1 for detecting the nucleotide sequence of the Transcription termination / antitermination protein NusG gene of Fn bacteria are as shown in SEQ ID NO.26-28, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.3 for detecting the nucleotide sequence of the Transcription termination / antitermination protein NusG gene of Fn bacteria are as shown in SEQ ID NO.29-31, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.5 for detecting the nucleotide sequence of the Transcription termination / antitermination protein NusG gene of Fn bacteria are as shown in SEQ ID NO.32-34.

[0038] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.7 for detecting the outer membrane protein HMP gene of Poras bacteria are as shown in SEQ ID NO.35-37, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.9 for detecting the outer membrane protein HMP gene of Poras bacteria are as shown in SEQ ID NO.38-40, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.11 for detecting the outer membrane protein HMP gene of Poras bacteria are as shown in SEQ ID NO.41-43.

[0039] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.13 for detecting the group II intron reverse transcriptase / maturase gene of LacY strain are as shown in SEQ ID NO.44-46, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.15 for detecting the group II intron reverse transcriptase / maturase gene of LacY strain are as shown in SEQ ID NO.47-49, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.17 for detecting the group II intron reverse transcriptase / maturase gene of LacY strain are as shown in SEQ ID NO.50-52.

[0040] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe used to detect the internal reference gene BCoA are shown in SEQ ID NO. 62-64, respectively.

[0041] A sixth aspect of the invention provides the use of the reagents described in the fifth aspect in the preparation of kits for the diagnosis and screening of colorectal cancer and precancerous high-risk lesions.

[0042] A seventh aspect of the present invention provides a method for detecting Fp strains, comprising the following steps:

[0043] Extract DNA from the sample, use it as a template, and perform real-time quantitative PCR amplification using the kit described in the first aspect above. Detect the fluorescence signal and determine the result.

[0044] An eighth aspect of the present invention provides a method for detecting Fn and Poras strains, comprising the following steps:

[0045] (1) Extract DNA from the sample and use it as a template to perform real-time quantitative PCR amplification using the kit described in the third aspect above;

[0046] (2) The results of PCR were analyzed using two-way binary logistic regression analysis of continuous variables.

[0047] A ninth aspect of the present invention provides a method for detecting Fn, Poras, and LacY strains, comprising the following steps:

[0048] (1) Extract DNA from the sample and use it as a template to perform real-time quantitative PCR amplification using the kit described in section 5 above;

[0049] (2) The results of PCR were analyzed using a three-factor binary logistic regression analysis of non-continuous variables.

[0050] In an embodiment of the present invention, the probe is fluorescently labeled, preferably.

[0051] The beneficial effects of this invention are as follows:

[0052] This invention designs a reagent for the detection of specific genes of multiple gut microbiota species. Through precise primer and probe design and the construction of a multiplex real-time quantitative PCR method, it is possible to identify and analyze the relative abundance of multiple species in feces, including Fn, Poras, LacY, Fp, etc., in a single reaction well. This is a gut microbiota detection method that is easier to implement in clinical testing institutions.

[0053] Results from a fecal sample cohort comprising healthy individuals and colorectal cancer patients showed that a continuous variable logistic regression analysis based on the Fn and Poras genes achieved a sensitivity of 71.43%, a specificity of 100.00%, an accuracy of 85.71%, and an area under the receiver operating curve (AUC) of 0.7347 for colorectal cancer detection. Results from another fecal sample cohort comprising colorectal cancer patients and controls (intestinal inflammation, gastric cancer, and healthy individuals) showed that a non-continuous variable logistic regression analysis based on the Fn, LacY, and Poras genes achieved a sensitivity of 80.00%, a specificity of 59.09%, an accuracy of 65.63%, and an AUC of 0.7727. This invention suggests the application value of multi-gene detection methods for gut microbiota in the early diagnosis and screening of colorectal cancer.

[0054] This study utilizes multiple fluorescent PCR detection methods to detect various gut microbial species-specific genes associated with the development and progression of colorectal cancer and its precancerous lesions. A homologous gene from multiple gut microbes is used as an internal control to evaluate the relative abundance of each microorganism and the quality of nucleic acid extraction. A logistic regression-based scoring mechanism is then constructed to obtain a logistic regression score for assessing the risk of colorectal cancer. Based on universal fluorescent PCR technology and readily available fecal samples, this reagent enables home sampling, rapid, and high-throughput detection, making it suitable for early diagnosis and screening of colorectal cancer and possessing significant economic and social value. Attached Figure Description

[0055] Figure 1 The graph shows the amplification curves and amplification efficiency results of the Fn / LacY / BCoA triple fluorescent PCR. The fluorescent PCR platform used was ABI7500.

[0056] Figure 2 2% agarose gel electrophoresis image of the third-round PCR product in the BCoA sequence detected by gene fusion-sequencing method.

[0057] Figure 3 This figure represents the composition and sequence quantity percentage of BCoA gene in fecal DNA from healthy individuals, colorectal cancer patients, and post-colorectal cancer surgery patients.

[0058] Figure 4 This diagram illustrates the representative bacterial species composition for BCoA gene detection in fecal DNA from different individuals.

[0059] Figure 5 ROC curves for Fn single gene, Poras single gene, non-continuous variable bigenic logistic regression, and continuous variable bigenic logistic regression analysis modes in the Fn / Poras / BCoA triple PCR reaction system (analysis software: GraphPadPrism, IBM SPSS Statistics).

[0060] Figure 6 The levels of Fn, Lacy, and Poras in the healthy control group and the colorectal cancer group were 2 -ΔCt Value comparison chart (analysis software: GraphPad Prism, IBM SPSS Statistics).

[0061] Figure 7 The ROC curves for multiplex PCR reactions under logistic regression analysis modes for Fn single gene, LacY single gene, Poras single gene, and non-continuous variable bigene (analysis software: GraphPad Prism, IBM SPSS Statistics) are shown. Detailed Implementation

[0062] It should be noted that, unless otherwise defined, the technical or scientific terms used in this application shall have the ordinary meaning as understood by one of ordinary skill in the art.

[0063] A first aspect of the present invention provides a kit comprising reagents for detecting Fp strains;

[0064] Preferably, the reagent is used to detect the Cytidine deaminase gene in Fp bacteria;

[0065] More preferably, the nucleotide sequence of the Cytidine deaminase gene is shown in SEQ ID NO. 19, 20, 21, 22, 23, 24; more preferably, the nucleotide sequence of the Cytidine deaminase gene is shown in SEQ ID NO. 19.

[0066] In a preferred embodiment of the present invention, the above-mentioned kit further includes reagents for detecting the internal reference gene BCoA;

[0067] Preferably, the nucleotide sequence of the internal reference gene BCoA is shown in SEQ ID NO.25.

[0068] When using qPCR to determine gene expression levels, the absolute expression level of the target gene is often not measured directly. Instead, the expression levels of the target gene and an internal reference gene are measured separately, and the expression level of the internal reference gene is used as a standard to determine the relative expression level of the target gene. Finally, the relative expression levels between samples are compared. An internal reference gene is a known reference gene whose expression level is unaffected by research conditions and can be consistently expressed across multiple samples. The expression level of this gene can be used to accurately quantify the loading of the initial material.

[0069] In a preferred embodiment of the present invention, the reagent for detecting the Cytidine deaminase gene of Fp bacteria and the reagent for detecting the internal reference gene BCoA respectively include an upstream primer, a downstream primer, and a probe.

[0070] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe of the nucleotide sequence of the Cytidine deaminase gene for detecting Fp bacteria SEQ ID NO.19 are as shown in SEQ ID NO.53-55, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of the nucleotide sequence of the Cytidine deaminase gene for detecting Fp bacteria SEQ ID NO.21 are as shown in SEQ ID NO.56-58, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of the Cytidine deaminase gene for detecting Fp bacteria SEQ ID NO.23 are as shown in SEQ ID NO.59-61.

[0071] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe used to detect the internal reference gene BCoA are shown in SEQ ID NO. 62-64, respectively.

[0072] A second aspect of the invention provides the use of the kit described in the first aspect in the preparation of reagents for the diagnosis and screening of colorectal cancer and precancerous high-risk lesions.

[0073] A third aspect of the present invention provides a kit comprising reagents for detecting Fn and Poras strains;

[0074] Preferably, the reagent is used to detect the Transcription termination / antitermination protein NusG gene of Fn bacteria and the outer membrane protein HMP gene of Poras bacteria;

[0075] More preferably, the nucleotide sequence of the Transcription termination / antitermination protein NusG gene is as shown in SEQ ID NO. 1, 2, 3, 4, 5, 6; more preferably, the nucleotide sequence of the Transcription termination / antitermination protein NusG gene is as shown in SEQ ID NO. 1;

[0076] More preferably, the nucleotide sequence of the outer membrane protein HMP gene is shown in SEQ ID NO.7, 8, 9, 10, 11, and 12; more preferably, the nucleotide sequence of the outer membrane protein HMP gene is shown in SEQ ID NO.7.

[0077] In a preferred embodiment of the present invention, the above-mentioned kit further includes reagents for detecting the internal reference gene BCoA;

[0078] Preferably, the nucleotide sequence of the internal reference gene BCoA is shown in SEQ ID NO.25.

[0079] In a preferred embodiment of the present invention, the reagents for detecting the Transcriptiontermination / antitermination protein NusG gene of Fn bacteria and the outer membrane protein HMP gene of Poras bacteria, and the reagents for detecting the internal reference gene BCoA, respectively include an upstream primer, a downstream primer, and a probe.

[0080] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.1 for detecting the nucleotide sequence of the Transcription termination / antitermination protein NusG gene of Fn bacteria are as shown in SEQ ID NO.26-28, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.3 for detecting the nucleotide sequence of the Transcription termination / antitermination protein NusG gene of Fn bacteria are as shown in SEQ ID NO.29-31, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.5 for detecting the nucleotide sequence of the Transcription termination / antitermination protein NusG gene of Fn bacteria are as shown in SEQ ID NO.32-34.

[0081] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.7 for detecting the outer membrane protein HMP gene of Poras bacteria are as shown in SEQ ID NO.35-37, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.9 for detecting the outer membrane protein HMP gene of Poras bacteria are as shown in SEQ ID NO.38-40, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.11 for detecting the outer membrane protein HMP gene of Poras bacteria are as shown in SEQ ID NO.41-43.

[0082] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe used to detect the internal reference gene BCoA are shown in SEQ ID NO. 62-64, respectively.

[0083] A fourth aspect of the invention provides the use of the reagents described in the third aspect in the preparation of kits for the diagnosis and screening of colorectal cancer and precancerous high-risk lesions.

[0084] A fifth aspect of the present invention provides a kit comprising reagents for detecting Fn, Poras, and LacY strains;

[0085] Preferably, the reagent is used to detect the Transcription termination / antitermination protein NusG gene of Fn bacteria, the outer membrane protein HMP gene of Poras bacteria, and the group II intron reverse transcriptase / maturase gene of LacY bacteria.

[0086] More preferably, the nucleotide sequence of the detected Transcription termination / antitermination protein NusG gene is as shown in SEQ ID NO. 1, 2, 3, 4, 5, 6; more preferably, the nucleotide sequence of the Transcription termination / antitermination protein NusG gene is as shown in SEQ ID NO. 1;

[0087] More preferably, the nucleotide sequence of the detected outer membrane protein HMP gene is shown in SEQ ID NO.7, 8, 9, 10, 11, and 12; more preferably, the nucleotide sequence of the detected outer membrane protein HMP gene is shown in SEQ ID NO.7.

[0088] More preferably, the nucleotide sequence of the detected group II intron reverse transcriptase / maturase gene is shown in SEQ ID NO. 13, 14, 15, 16, 17, and 18; more preferably, the nucleotide sequence of the detected group II intron reverse transcriptase / maturase gene is shown in SEQ ID NO. 13.

[0089] In a preferred embodiment of the present invention, the above-mentioned kit further includes reagents for detecting the internal reference gene BCoA;

[0090] Preferably, the nucleotide sequence of the internal reference gene BCoA is shown in SEQ ID NO.25.

[0091] In a preferred embodiment of the present invention, the reagents for detecting the Transcriptiontermination / antitermination protein NusG gene of Fn bacteria, the outer membrane protein HMP gene of Poras bacteria, and the group II intron reverse transcriptase / maturase gene of LacY bacteria, and the reagents for detecting the internal reference gene BCoA, respectively include an upstream primer, a downstream primer, and a probe.

[0092] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.1 for detecting the nucleotide sequence of the Transcription termination / antitermination protein NusG gene of Fn bacteria are as shown in SEQ ID NO.26-28, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.3 for detecting the nucleotide sequence of the Transcription termination / antitermination protein NusG gene of Fn bacteria are as shown in SEQ ID NO.29-31, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.5 for detecting the nucleotide sequence of the Transcription termination / antitermination protein NusG gene of Fn bacteria are as shown in SEQ ID NO.32-34.

[0093] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.7 for detecting the outer membrane protein HMP gene of Poras bacteria are as shown in SEQ ID NO.35-37, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.9 for detecting the outer membrane protein HMP gene of Poras bacteria are as shown in SEQ ID NO.38-40, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.11 for detecting the outer membrane protein HMP gene of Poras bacteria are as shown in SEQ ID NO.41-43.

[0094] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.13 for detecting the group II intron reverse transcriptase / maturase gene of LacY strain are as shown in SEQ ID NO.44-46, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.15 for detecting the group II intron reverse transcriptase / maturase gene of LacY strain are as shown in SEQ ID NO.47-49, and / or the nucleotide sequences of the upstream primer, downstream primer, and probe of SEQ ID NO.17 for detecting the group II intron reverse transcriptase / maturase gene of LacY strain are as shown in SEQ ID NO.50-52.

[0095] Preferably, the nucleotide sequences of the upstream primer, downstream primer, and probe used to detect the internal reference gene BCoA are shown in SEQ ID NO. 62-64, respectively.

[0096] A sixth aspect of the invention provides the use of the reagents described in the fifth aspect in the preparation of kits for the diagnosis and screening of colorectal cancer and precancerous high-risk lesions.

[0097] The sequences SEQ ID NO.1 to 24 were searched on NCBI (Database: Nucleotide collection (nr / nt); Organism:bacteria (taxid:2); only the search results with the highest "Max Score / Total Score" are listed). The results show that all 24 sequences have species specificity, as detailed in Table 1 below.

[0098] Table 1

[0099]

[0100]

[0101]

[0102]

[0103]

[0104] The sequences SEQ ID NO.1 to 67 of the present invention are shown in Table 2 below.

[0105] Table 2

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113] In a preferred embodiment of the present invention, the detection of strain / community-specific gene fragments such as SEQ ID NO.1 to 25 can be applied to, but is not limited to, nucleic acid detection platforms such as conventional PCR, multiplex fluorescent PCR, digital PCR, capillary electrophoresis, isothermal amplification, and high-throughput sequencing.

[0114] In a preferred embodiment of the present invention, the 5' end fluorescent group of the probe is FAM, VIC or CY5, and the 3' end quenching group is TAMRA, BHQ1, BHQ2 or BHQ.

[0115] The preferred probes used to implement this invention are probes labeled according to the TaqMan system. According to the TaqMan system, oligonucleotide probes, specially designed to hybridize with the target DNA to be amplified, have a 5' end covalently linked to a fluorophore and a 3' end covalently linked to a quencher group. The principle of the TaqMan system is that the quencher group inhibits the fluorescence of the fluorophore as long as the quencher group and the fluorophore are very close to each other on the probe. Once the oligonucleotide probe hybridizes with the target DNA during qPCR amplification, it is degraded by Taq polymerase, which causes the oligonucleotide primer to extend along the DNA corresponding to the target DNA. This degradation releases the fluorophore and the quencher group, and the quencher group becomes less close to the fluorophore, thus allowing the fluorophore to emit its fluorescence.

[0116] In a preferred embodiment of the present invention, the above kit further includes PCR reaction solution, DNA polymerase, positive control, negative control and DNA-free water;

[0117] Preferably, the PCR reaction solution comprises dNTPs and MgCl2, and optionally includes ROX and SYBR-Green; more preferably, the concentration of dNTPs is 150–250 μM, the concentration of MgCl2 is 3–5 mM, the concentration of ROX is 0–1×, and the concentration of SYBR-Green is 0–0.3×; more preferably, the concentration of dNTPs is 200 μM, and the concentration of MgCl2 is 4 mM.

[0118] Preferably, the concentration of the DNA polymerase is 0.025–0.1 U / μL, more preferably 0.025–0.075 U / μL, and even more preferably 0.05 U / μL;

[0119] Preferably, the concentrations of the upstream primers used for detecting Fn, Poras, LacY, and Fp strains are 200–1000 nM, the concentrations of the downstream primers are 200–1000 nM, and the concentrations of the probes are 200–500 nM. More preferably, the concentrations of the upstream primers used for detecting Fn, Poras, LacY, and Fp strains are 300–800 nM, the concentrations of the downstream primers are 300–800 nM, and the concentrations of the probes are 200–300 nM. More preferably, the concentrations of the upstream primers used for detecting Fn, Poras, LacY, and Fp strains are 300 nM, the concentrations of the downstream primers are 300 nM, and the concentrations of the probes are 200 nM.

[0120] Preferably, the concentrations of the upstream primers and downstream primers used for detecting the internal reference gene BCoA are 200–1000 nM, 200–1000 nM, and 200–500 nM, respectively; more preferably, the concentrations of the upstream primers and downstream primers used for detecting the internal reference gene BCoA are 300–800 nM, 300–800 nM, and 200–300 nM, respectively; even more preferably, the concentrations of the upstream primers and downstream primers used for detecting the internal reference gene BCoA are 800 nM, 800 nM, and 300 nM, respectively.

[0121] The kit may also include all the additional elements necessary for performing qPCR, such as buffers, extraction reagents, enzymes, pipettes, plates, nucleic acids, filter paper, gel materials, transfer materials, autoradiography equipment, and instructions (describe the relevant operating methods).

[0122] A seventh aspect of the present invention provides a method for detecting Fp strains, comprising the following steps:

[0123] Extract DNA from the sample, use it as a template, and perform real-time quantitative PCR amplification using the kit described in the first aspect above. Detect the fluorescence signal and determine the result.

[0124] An eighth aspect of the present invention provides a method for detecting Fn and Poras strains, comprising the following steps:

[0125] (1) Extract DNA from the sample and use it as a template to perform real-time quantitative PCR amplification using the kit described in the third aspect above;

[0126] (2) The results of PCR were analyzed using two-way binary logistic regression analysis of continuous variables.

[0127] A ninth aspect of the present invention provides a method for detecting Fn, Poras, and LacY strains, comprising the following steps:

[0128] (1) Extract DNA from the sample and use it as a template to perform real-time quantitative PCR amplification using the kit described in section 5 above;

[0129] (2) The results of PCR were analyzed using a three-factor binary logistic regression analysis of non-continuous variables.

[0130] In a preferred embodiment of the present invention, the source of the sample DNA includes tissue, feces, urine, saliva, and blood, preferably feces.

[0131] In a preferred embodiment of the present invention, the concentration of the sample DNA is 1.25–20 ng / μL, preferably 5–20 ng / μL, and more preferably 10 ng / μL.

[0132] In a preferred embodiment of the present invention, logistic regression analysis is used to analyze the data of the results of multiplex fluorescent PCR for the detection of the above-mentioned biomarkers to obtain a logistic regression score p. The risk of colorectal cancer and high-risk precancerous lesions is distinguished according to the level of the logistic regression score. The logistic regression equation is constructed using continuous or non-continuous variables.

[0133] In a preferred embodiment of the present invention, the logistic regression scoring equation used in the logistic regression analysis is p=α+β1*[Fn]+β2*[Poras]+β3*[LacY]+β4*[Fp], where α and β1~4 are constants. When β1 / β2 / β3 / β4=0, the corresponding biomarker is not included in the formula by default. When any indicator uses a continuous variable, [] represents the corresponding biomarker relative to the internal reference gene. -ΔCtThe value (△Ct=Fn / Poras / LacY / Fp Ct value-internal reference Ct value) or the Ct value of the marker; when any indicator uses a non-continuous variable, [] represents the 0 or 1 value of the corresponding marker under a certain positive threshold condition;

[0134] Or p = α + β1 * [Fn] + β2 * [Poras] + β3 * [LacY], where α and β1 to β3 are constants. When β1 / β2 / β3 = 0, the corresponding marker is not included in the formula by default. When any indicator uses a continuous variable, [] indicates that the corresponding marker is 2 relative to marker Fp. -ΔCt Value (△Ct=Fn / Poras / LacY Ct value-Fp Ct value); when any indicator uses a non-continuous variable, [] represents the 0 or 1 value of the corresponding marker under a certain positive threshold condition;

[0135] Or p = α + β1 * [Fn] + β2 * [Poras] + β3 * [LacY], where α and β1 to β3 are constants. When β1 / β2 / β3 = 0, the corresponding marker is not included in the formula by default. When any indicator uses a continuous variable, [] indicates that the corresponding marker is relative to the marker Fp and the internal parameter 2. -ΔCt Value (△Ct=2*Fn / Poras / LacY Ct value-Fp Ct value-internal parameter Ct value); when any indicator uses a non-continuous variable, [] represents the 0 or 1 value of the corresponding marker under a certain positive threshold condition.

[0136] Example

[0137] To further illustrate the technical content and specific experimental operations of this invention, some embodiments are listed below. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of this invention. Experimental parameters such as primer / probe combinations, nucleic acid extraction methods, sample DNA concentrations, and reagent concentrations, which can be varied, and actual operations may be modified according to actual circumstances. Unless otherwise specified, conventional experimental operations involved in the following embodiments are performed according to conventional methods. Unless otherwise specified, the medicinal materials and reagents used in the following embodiments are commercially available products.

[0138] Example 1: Extraction of microbial DNA genome from fecal samples and detection of singleton / multiplex PCR

[0139] 1. Main reagents and materials

[0140] 1) A commercial DNA extraction kit (Tiangen, lot #: DP712) is used for fecal microbial genomic DNA extraction. Isopropanol and anhydrous ethanol are provided in-house.

[0141] 2) PCR reaction solution (containing dNTPs, MgCl2, etc.), DNA polymerase, positive control, negative control, DNA enzyme-free water, and related primers and probes used within the scope of this invention.

[0142] 3) High-speed centrifuges, water baths, OneDrop micro-volume nucleic acid concentration measuring instruments, ABI 7500 PCR instruments, etc.

[0143] 2. Operating Procedures

[0144] 1) Take about 0.3g of fecal sample into a 1.5mL centrifuge tube and add 500μL buffer SA, 100μL buffer SC and 0.25g grinding beads. Vortex to mix well and then incubate in a 95℃ water bath for 15 minutes.

[0145] 2) Centrifuge at 12,000 rpm (~13,400×g) for 1 minute, take about 500 μL of supernatant into a new tube, add 200 μL of buffer SA, vortex mix for 5 seconds, and let stand at 4℃ for 10 minutes.

[0146] 3) Then centrifuge at 12,000 rpm (~13,400×g) for 3 minutes, take the supernatant and add 500 μL Buffer GFA (add isopropanol before use), mix by inverting and then centrifuge briefly, add 10 μL of magnetic beads, and shake to mix for 5 minutes. Place on a magnetic rack to remove the supernatant.

[0147] 4) Finally, wash once with 700 μL RD buffer (add anhydrous ethanol before use) (shake well for 5 minutes) and twice with 700 μL buffer PWD (add anhydrous ethanol before use) (shake well for 3 minutes).

[0148] 5) Finally, use 200 μL of buffer TB to wash the sample in a 56°C water bath and measure the DNA concentration. The DNA sample can be used for subsequent detection or stored at -80°C.

[0149] 6) Preparation of positive plasmid DNA fragments from different bacterial species

[0150] a) For positive reference plasmids of different bacterial species or internal controls, double digestion with restriction endonucleases is performed, i.e., take 1 μg according to the instructions and react at 37℃ for 1 hour.

[0151] b) The products after double enzyme digestion were separated by 2% agarose gel electrophoresis and the target fragment was recovered in 20 μL of elution buffer.

[0152] c) Calculate the concentration of the target gene of the positive plasmid fragment in the elution buffer, and then dilute the above positive target fragment with DNase-free water or TE buffer in a 10-fold concentration gradient. The diluted DNA fragment can be used as an amplification template to verify the amplification efficiency.

[0153] 7) Use a micro-volume nucleic acid concentration meter to measure the concentration of the above DNA samples. Dilute the samples to 20 ng / μL with DNase-free water. For positive plasmid DNA fragments, they can be diluted sequentially in a 10-fold concentration gradient, such as to 10E+5, 10E+4, 10E+3, 10E+3, 10E+2, and 10E+1 copies / μL.

[0154] 8) Prepare a 20 μL PCR reaction system. In singleton or multiplex fluorescent PCR (TaqMan method), the concentration of dNTPs is 200 μM, the concentration of ROX is 0–0.1 × 10⁻⁶, and the concentration of Mg is [missing information]. 2+ The concentration of the primers was 4 mM. The upstream and downstream primer concentrations for Fn, Poras, LacY, and Fp were 300 nM and 300 nM respectively, and the probe concentration was 200 nM. The upstream and downstream primer concentrations for the internal control gene BCoA were 800 nM and 300 nM respectively, and the probe concentration was 300 nM. The DNA polymerase (TaKaRa ExTaq) concentration was 0.05 U / μL, the fecal DNA concentration was 10 ng / μL, and the probe was labeled with VIC fluorescent dye at the 5' end and BHQ1 at the 3' end. Taking Fn / LacY / BCoA triple PCR as an example, the triple PCR amplification curve and amplification efficiency results are detailed in [link to documentation]. Figure 1 .

[0155] 9) The PCR experimental procedure is as follows: pre-denaturation, 95℃, 2 min; amplification, 95℃, 8 s, then 60℃, 30 s (*), for a total of 45 cycles; end. (Note*: Select the fluorescence acquisition channel corresponding to the probe or the SYBR Green channel.)

[0156] 10) Results analysis: After the PCR reaction program is completed, the threshold line is adjusted to the exponential growth region of the amplification signal that is slightly higher than the background noise.

[0157] Example 2: Quantitative reference for the BCoA internal reference gene

[0158] 1. The internal reference gene-specific primers SEQ ID NO. 62 and 63, and the gene fusion-sequencing primers SEQ ID NO. 65, SEQ ID NO. 66, and SEQ ID NO. 67, along with the following specific steps, are used to illustrate the relevant operations of the gene fusion-sequencing method:

[0159] 1) The product was obtained by first-round PCR amplification using the internal reference BCoA gene-specific primers SEQ ID NO.62 and 63 and fecal sample DNA. The PCR program was 95℃ pre-denaturation for 2 minutes, 95℃ denaturation for 8 seconds, and 60℃ annealing extension for 30 seconds, for a total of 35 cycles.

[0160] 2) The above PCR product was purified by precipitation with 80% cold ethanol, and the PCR product diluted 100 times was used as a template for a second round of PCR amplification with primers SEQ ID NO.65 and 66 with complementary tailing sequences at the 5' end and TaKaRa PrimeSTAR GXL DNA polymerase to obtain the 5' tailed BCoA gene product. The PCR program was 95℃ pre-denaturation for 2 minutes, 95℃ denaturation for 8 seconds, and 60℃ annealing extension for 1 minute and 20 seconds, for a total of 40 cycles.

[0161] 3) Due to the complementarity of the 5' ends of the primers, the 5' tailed BCoA gene PCR product described above can be amplified into different lengths of BCoA gene fusion fragments by adding 2 μg of the second-round PCR product and an appropriate amount of primer SEQ ID NO.67 (concentration of 200 nM) to a 50 μL PCR reaction system and performing a third round of PCR under the action of ExTaq DNA polymerase. Figure 2 The cloning vector was constructed for further sequencing. The PCR program was 95℃ pre-denaturation for 2 minutes, 95℃ denaturation for 8 seconds, 60℃ annealing extension for 30 seconds, for a total of 40 cycles, and finally incubation at 72℃ for 2 minutes.

[0162] 2. Experimental Results and Analysis

[0163] Based on the above experimental methods, BCoA sequencing results of fecal samples from 3 patients with colorectal cancer, 2 patients with colorectal cancer undergoing chemotherapy / post-operative treatment, and 9 healthy volunteers were obtained. Subject sample information is shown in Table 3.

[0164] Table 3 Sample information used for BCoA sequencing

[0165] serial number gender Sample type Number of sequencing sequences P1 male rectal cancer 5 P2 female colon cancer 8 P3 male After chemotherapy for rectal cancer 4 P4 female Post-rectal cancer surgery 4 P5 female colon cancer 3 N1 female healthy 9 N2 female healthy 8 N3 female healthy 4 N4 male healthy 4 N5 male healthy 4 N6 male healthy 4 N7 male healthy 3 N8 female healthy 3 N9 male healthy 3

[0166] A BLAST search was performed on the NCBI website on the above 66 sequencing sequences, and the following results were found to have the highest scores:

[0167] 1) Eubacterium rectale or Lachnospiraceae bacterium, accounting for 33.3%;

[0168] 2) Eubacterium rectale, accounting for 1.5%;

[0169] 3) Faecalibacterium prausnitzii, accounting for 25.8%;

[0170] 4) Uncultured bacterium, accounting for 27.3%;

[0171] 5) Roseburia hominis / sp., accounting for 7.6%;

[0172] 6) Roseburia inulinivorans, accounting for 1.5%;

[0173] 7) Anaerostipes caccae, accounting for 1.5%;

[0174] 8) No relevant sequences were found, accounting for 1.5%.

[0175] All sequences showed 82.64% to 98.96% homology with the aforementioned bacterial species, with most showing over 90% homology. All sequences encode genes encoding butyryl-CoA:acetate CoA transferase. Only one sequence yielded no search results. See Table 4 for details.

[0176] Table 4. BLAST search results for BCoA sequencing sequences

[0177]

[0178]

[0179]

[0180] Meanwhile, it was found that the most frequent search results across all samples were *Eubacterium rectale* or *Lachnospiraceae bacterium*, *Faecalibacterium prausnitzii*, and some uncultured bacterium species, accounting for 34.8%, 25.8%, and 27.3%, respectively. These species, such as *Eubacterium rectale* and *Faecalibacterium prausnitzii*, and their combinations, are abundant in human intestinal fecal samples and their composition is relatively stable in most healthy individuals (e.g., ...). Figure 3 , Figure 4 (As shown).

[0181] Example 3: Comparison between BCoA internal reference gene and traditional 16S rRNA internal reference gene

[0182] Following the fecal sample nucleic acid extraction method and fluorescent PCR detection (Taqman probe method) method described in Example 1, DNA from 13 fecal samples from 7 healthy volunteers and 6 colorectal cancer patients was tested. Based on a dual PCR system, the Ct values ​​of Fn, BCoA, and 16S rRNA were detected, respectively. The primer and probe sequences for Fn detection are SEQ ID NO. 26, 27, and 28 (probe labeled with FAM fluorescent group and BHQ-1 quencher group). The primer and probe sequences for BCoA detection are SEQ ID NO. 62, 63, and 64 (probe with VIC fluorescent group at 5' end and BHQ1 quencher group at 3' end). The upstream primer for the traditional 16S rRNA internal reference gene is SEQ ID NO. 68 (5'-CGTCAGCTCGTGTCGTGAG-3'), the downstream primer is SEQ ID NO. 69 (5'-CGTCATCCCCACCTTCC-3'), and the probe is SEQ ID NO. 70 (5'-TTAAGTCCCGCAACGAGCGCAACCC-3') (probe with VIC fluorescent group at 5' end and BHQ1 quencher group at 3' end). The detection results are shown in Tables 5 and 6.

[0183] Both 16S rRNA and BCoA can be stably detected as internal control genes. However, it is worth noting that during PCR amplification of the traditional 16S rRNA internal control gene, the Taq enzyme itself contains a small amount of 16S rRNA due to its preparation process, resulting in a detectable level of nearly 30 Ct in the blank control. In contrast, BCoA, as an internal control gene, shows no Ct value after 45 cycles of amplification, avoiding the problem of amplification products in the blank control. Furthermore, based on the detection results of a small number of samples, for the detection of Fn, the analysis results of 16S rRNA and BCoA genes as internal controls showed no difference in sensitivity, specificity, and accuracy. However, the results based on the BCoA internal control gene... -ΔCt The higher AUC value obtained indicates that BCoA as an internal reference can significantly improve analytical performance.

[0184] Table 5. Sample information, Ct value detection results, and result interpretation (△Ct=Fn Ct-16S / BCoA Ct)

[0185]

[0186] Table 6. Analytical performance and positive cut-off values ​​of Fn based on 16S rRNA or BCoA internal reference genes.

[0187]

[0188] Example 4, using Fp as an example, demonstrates that the Cytidine deaminas gene primer combination exhibits superior specificity for bacterial species detection compared to the traditional 16S rRNA gene primer combination.

[0189] Following the steps in Example 1, the Fp strain-specific Cytidine deaminas gene sequence SEQ ID NO. 19 was amplified using SEQ ID NO. 53 and 54. The 16S rRNA gene of the fecal DNA sample was amplified using the upstream primer SEQ ID NO. 71 (5'-TGTAAACTCCTGTTGTTGAGGAAGATAA-3') and the downstream primer SEQ ID NO. 72 (5'-GCGCTCCCTTTACACCCA-3') of the conventional Fp 16S rRNA gene. The Fp strain-specific Cytidine deaminas gene and 16S rRNA gene sequences are shown below:

[0190] >Fp_Cytidine_deaminas (ie SEQ ID NO.19)

[0191] GCAGCAGCTCGTCCATGCTGCGCTCGATGAAATCGTCCGGGCTTTTTGCCATGATGACATTCAGCTCCGGGCCGCCGAACTCGAACAGCGCCTGACGG

[0192] >Fp_16S(SEQ ID NO.73)

[0193] TGTAAACTCCTGTTGTTGAGGAAGATAATGACGGTACTCAACAAGGAAGTGACGGCTAACTACGTGCCAGCAGCCGCGGTAAAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGC

[0194] PCR products amplified with different primers were ligated into plasmid vectors and transformed into E. coli. The PCR products were then sequenced for verification. The sequencing sequences are as follows:

[0195] >Fp-CD-gene-3-1 (SEQ ID NO.74)

[0196] CCGTCAGGCGCTGTTCGAGTTCGGCGGCCCGGAGCTGAATGTCATTATGGCAAAAAGCCCGGACGATTTCATCGAGCGCAGCATGGACGAGCTGCTGC

[0197] >Fp-CD-gene-5-1 (SEQ ID NO.75)

[0198] CCGTCAGGCGCTGTTCGAATTCGGCGGCCCGGAGCTGAATGTCATCATGGCAAAAAGCCCGGACGATTTCATCGAGCGCAGCATGGACGAGCTGCTGC

[0199] >Fp-CD-gene-5-3 (SEQ ID NO.76)

[0200] CGTCAGCGCTGTTCGAATTCGGCGGCCCGGAGCTGAATGTCATCATGGCAAAAAGCCCGGACGATTTCATCGAGCGCAGCATGGACGAGCTGCTGC

[0201] >Fp-16S-1-2 (SEQ ID NO.77)

[0202] TGTAAACTCCTGTTGTTGAGGAAGATAATGACGGTACTCAACAAGGAAGTGACGGCTAACTACGTGCCAGCAGCCGCGGTAAAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGC

[0203] >Fp-16S-1-9 (SEQ ID NO.78)

[0204] TGTAAACTCCTGTTGTTGAGGAAGATAATGACGGTACTCAACAAGGAAGTGACGGCTAACTACGTGCCAGCAGCCGCGGTAAAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGC

[0205] The above sequences were subjected to a BLAST search in the NCBI database, and the search results are summarized in Table 7 below:

[0206] Table 7 Sequencing results of Fp species-specific Cytidine deaminas gene and 16S rRNA gene amplification products in fecal DNA samples.

[0207]

[0208] As can be seen from the table above, the Cytidine deaminas gene is more specific to Fp strains than the 16S rRNA gene.

[0209] Example 5: Analysis of Fecal Microbial Dual-Gene Detection Results

[0210] Based on the sample detection procedure described in Example 1, fecal DNA samples from 7 colorectal cancer patients and 7 healthy subjects were tested, totaling 14 samples. The detection results and interpretation are shown in Table 8. Fn bacteria were detected using the upstream primers, downstream primers, and probes shown in SEQ ID NO. 26–28, respectively; Poras bacteria were detected using the upstream primers, downstream primers, and probes shown in SEQ ID NO. 35–37, respectively; and the internal reference gene BCoA was detected using the upstream primers, downstream primers, and probes shown in SEQ ID NO. 62–64, respectively. The probe was labeled with the fluorescent group VIC at the 5' end and with the quencher group BHQ1 at the 3' end. The Ct value of the internal reference gene BCoA was used to obtain the 2-1 values ​​of Fn and Poras. -ΔCt The values ​​were analyzed using ROC to obtain the univariate AUC value, positive cut-off value, and interpretation results. Further, based on the univariate Fn and Poras interpretation results (i.e., a positive result is assigned a value of "1" and a negative result is assigned a value of "0"); simultaneously, the diagnosis result for colorectal cancer subjects is assigned a value of "1", and the diagnosis result for healthy subjects is assigned a value of "0"; based on the diagnosis results, the values ​​of Fn and Poras, a two-factor logistic regression scoring equation based on discontinuous variables was obtained through binary logistic regression analysis.

[0211] p=-0.775+1.226*[Fn]+0.162*[Poras]

[0212] Where [] represents Fn or Poras based on the positive cut-off value. -ΔCt The value interpretation result takes the form of "1" or "0"; p is the logistic regression score.

[0213] And a two-way logistic regression scoring equation based on continuous variables:

[0214] p=-1.291+1.607*[Fn]+1.261*[Poras]

[0215] Where [] represents Fn or Poras in 2 based on intrinsic parameter BCoA. -ΔCt The value is ΔCt = Fn / PorasCt - BCoACt; p is the logistic regression score.

[0216] Table 8. Results of triple fluorescent PCR detection of intestinal microorganisms such as Fn and Poras and interpretation of the results (results without Ct value are recorded as Ct = 45.00).

[0217]

[0218] Table 9. Interpretation patterns of single-gene or two-factor results for gut microbiota such as Fn and Poras, and their AUC values ​​(colorectal cancer vs. control group).

[0219]

[0220] Table 10 Single-gene or two-factor performance analysis of gut microbiota such as Fn and Poras

[0221]

[0222] The detection performance of single-gene and dual-gene samples in the Fn / Poras / BCoA triple fluorescent PCR reaction system is detailed in Tables 9 and 10. Figure 5 Therefore, compared with healthy control samples, Fn and Poras both showed an upregulation trend in fecal DNA samples from colorectal cancer patients, with detection sensitivities of 71.4% and 42.86%, respectively, specificities of 57.1%, and AUC values ​​of 0.6531 for both. Furthermore, two-way logistic regression analyses based on discontinuous and continuous variables showed detection sensitivities of 71.43% and 71.43%, specificities of 57.14% and 100%, and AUC values ​​of 0.6531 and 0.7347, respectively. The latter significantly improved detection performance, especially specificity.

[0223] Example 6: Analysis of Fecal Microbial Three-Gene Detection Results

[0224] Based on the sample detection procedure described in Example 1, fecal DNA samples from 10 colorectal cancer patients, 3 post-colorectal cancer patients, 2 patients with intestinal inflammation, 16 healthy subjects, and 4 gastric cancer patients, totaling 35 samples, were tested. The detection results and interpretation are shown in Table 11. Fn bacteria were detected using the upstream primers, downstream primers, and probes shown in SEQ ID NO. 26–28; Poras bacteria were detected using the upstream primers, downstream primers, and probes shown in SEQ ID NO. 35–37; LacY bacteria were detected using the upstream primers, downstream primers, and probes shown in SEQ ID NO. 44–46; and the internal reference gene BCoA was detected using the upstream primers, downstream primers, and probes shown in SEQ ID NO. 62–64. The probe was labeled with the fluorescent group VIC at the 5' end and the quencher group BHQ1 at the 3' end. The Ct values ​​of the internal reference BCoA gene were used to obtain the 2-1 values ​​for Fn, LacY, and Poras. -ΔCt The values ​​were analyzed using ROC to obtain the univariate AUC value, positive cut-off value, and interpretation results. Further, based on the univariate Fn, LacY, and Poras interpretation results (i.e., a positive result is assigned a value of "1" and a negative result is assigned a value of "0"); simultaneously, the diagnostic result for colorectal cancer subjects was assigned a value of "1", while the diagnostic results for subjects with intestinal inflammation, healthy individuals, and gastric cancer (excluding post-colorectal cancer surgery) were assigned a value of "0"; based on the diagnostic results and the values ​​of the three factors Fn, LacY, and Poras, a binary logistic regression analysis was performed to obtain the logistic regression scoring equation:

[0225] p=-2.803+1.247*[Fn]+1.694*[LacY]+0.702*[Poras]

[0226] In the formula, [] represents Fn, LacY, or Poras based on the positive cut-off value. -ΔCt The value interpretation result takes the form of "1" or "0"; p is the logistic regression score.

[0227] For detailed performance of single-gene and three-gene sample detection, please refer to Tables 12 and 13. Figure 6 , Figure 7Therefore, compared to control samples (intestinal inflammation, healthy individuals, and gastric cancer), Fn, LacY, and Poras all showed an upregulation trend in fecal DNA samples from colorectal cancer patients, with detection sensitivities of 70.00%, specificities of 59.09%, 63.64%, and 54.55%, and AUC values ​​of 0.6455, 0.7, and 0.5955, respectively. Furthermore, a three-way binary logistic regression analysis based on discontinuous variables showed that fecal microbial multigene detection significantly improved the detection performance of colorectal cancer, with a sensitivity of 80.00%, a specificity of 59.09%, and an AUC value of 0.7727.

[0228] It should be noted that the sample size shown in this embodiment is relatively small. To obtain more valuable positive cutoff values ​​and logistic regression scoring equations, a larger number of clinical samples are needed for further validation. Nevertheless, the Fn, LacY, and Poras multiplex PCR detection scheme shown in this embodiment has demonstrated its research and clinical application value in the diagnosis and screening of colorectal cancer.

[0229] Table 11 shows the results of multiplex fluorescent PCR detection of gut microbiota such as Fn, LacY, and Poras, and their interpretation (results without Ct values ​​are recorded as Ct = 45.00).

[0230]

[0231]

[0232] Table 12 Interpretation patterns of single-gene or three-factor results for gut microbiota such as Fn, LacY, and Poras, and their AUC values ​​(colorectal cancer vs. control group*).

[0233]

[0234] Table 13 Single-gene or three-factor performance analysis of gut microbiota such as Fn, LacY, and Poras

[0235]

[0236]

[0237] References:

[0238] [1]Sung, Hyuna, et al. "Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries." CA: a cancer journal for clinicians 71.3 (2021): 209 - 249.

[0239] [2]Chen, Wanqing, et al. "Cancer incidence and mortality in China, 2013." Cancer letters 401 (2017): 63 - 71.

[0240] [3]Yuelin, et al. Clinical study on the combined detection of serum CEA, CA19 - 9 and CA72 - 4 for the diagnosis of colorectal cancer. Diss. 2006.

[0241] [4]Hermann Brenner et al. "Colorectal cancer: The Lancet." lancet 2014; 383: 1490 - 502.

[0242] [5]Rubinstein, Mara Roxana, et al. "Fusobacterium nucleatum promotes colorectal carcinogenesis by modulating E - cadherin / β - catenin signaling via its FadA adhesin." Cell host & microbe 14.2 (2013): 195 - 206.

[0243] [6]Abed, Jawad, et al. "Fap2 mediates Fusobacterium nucleatum colorectal adenocarcinoma enrichment by binding to tumor - expressed Gal - GalNAc." Cell host & microbe 20.2 (2016): 215 - 225.

[0244] [7]Liang,Qiaoyi,et al."Fecal Bacteria Act as Novel Biomarkers forNoninvasive Diagnosis of Colorectal Cancer."Clinical Cancer Research23.8(2017):2061-2070.

[0245] [8]Zeller,Georg,et al."Potential of fecal microbiota for early-stagedetection of colorectal cancer."Molecular systems biology 10.11(2014):766.

[0246] [9]Liang,Jessie Qiaoyi,et al."A novel faecal Lachnoclostridiummarkerfor the non-invasive diagnosis of colorectal adenoma and cancer."Gut(2019).

[0247]

[10] Mireia,et al."Changes in the AbundanceofFaecalibacteriumprausnitzii Phylogroups I and II in the Intestinal Mucosaof InflammatoryBowel Disease and Patients with Colorectal Cancer."Inflammatory boweldiseases(2016).

[0248]

[11] "Metagenomic analysis of faecal microbiome as a tooltowardstargeted non-invasive biomarkers for colorectal cancer."Gut66.1(2017):70-78.

[0249]

[12] Guo,Songhe,et al."A simple and novel fecal biomarkerforcolorectal cancer:ratio of Fusobacterium nucleatum toprobioticspopulations,based on their antagonistic effect."Clinical chemistry64.9(2018):1327-1337.

[0250]

[13] Louis,Petra,and Harry J.Flint."Formation of propionateandbutyrate by the human colonic microbiota."Environmental microbiology19.1(2017):29-41.

[0251]

[14] Louis,Petra,and Harry J.Flint."Development of asemiquantitativedegenerate real-time pcr-based assay for estimation ofnumbers of butyryl-coenzyme A(CoA)CoA transferase genes in complexbacterial samples."Applied andenvironmental microbiology 73.6(2007):2009-2012.

[0252]

[15] Wang,Tingting,et al."Structural segregation of gutmicrobiotabetween colorectal cancer patients and healthy volunteers."TheISMEjournal 6.2(2012):320.

[0253]

[16] Louis,Petra,et al."Diversity of human colonicbutyrate-producingbacteria revealed by analysis of the butyryl-CoA:acetate CoA-transferasegene."Environmental microbiology 12.2(2010):304-314.

Claims

1. A kit comprising reagents for detecting Faecalibacterium prausnitzii (Fp) species; Preferably, the reagents are for detecting Cytidine deaminase gene of Fp species; Further preferably, detecting nucleotide sequence selected from the group consisting of SEQ ID NO. 19, 20, 21, 22, 23 and 24; more preferably, detecting nucleotide sequence of SEQ ID NO.

19.

2. The kit of claim 1, further comprising reagents for detecting reference gene, such as BCoA; Preferably, detecting nucleotide sequence of SEQ ID NO. 25 in reference gene BCoA.

3. The kit of claim 1 or 2, wherein, The reagents for detecting Cytidine deaminase gene of Fp species and the reagents for detecting reference gene BCoA comprise upstream primer, downstream primer and probe, respectively; Preferably, the nucleotide sequences of the upstream primer, the downstream primer and the probe for detecting Cytidine deaminase gene of Fp species of nucleotide sequence SEQ ID NO. 19 are respectively shown as SEQ ID NO. 53-55, and / or the nucleotide sequences of the upstream primer, the downstream primer and the probe for detecting Cytidine deaminase gene of Fp species of nucleotide sequence SEQ ID NO. 21 are respectively shown as SEQ ID NO. 56-58, and / or the nucleotide sequences of the upstream primer, the downstream primer and the probe for detecting Cytidine deaminase gene of Fp species of nucleotide sequence SEQ ID NO. 23 are respectively shown as SEQ ID NO. 59-61; Preferably, the nucleotide sequences of the upstream primer, the downstream primer and the probe for detecting reference gene BCoA are respectively shown as SEQ ID NO. 62-64.

4. Use of the reagents for detecting Fp species as described in any one of claims 1 to 3 in the manufacture of a kit for the diagnosis and screening of colorectal cancer and precancerous high-risk lesions.

5. A kit comprising reagents for detecting Fusobacterium Nucleatum (Fn) species and Porphyromonas asaccharolytica (Poras) species; Preferably, the reagents are for detecting Transcription termination / antitermination protein NusG gene of Fn species and / or outer membrane protein HMP gene of Poras species; Preferably, the reagents are for detecting Transcription termination / antitermination protein NusG gene of Fn species and / or outer membrane protein HMP gene of Poras species; Further preferably, the reagent for detecting the Transcription termination / antitermination protein NusG gene of the Fn species is selected from the nucleotide sequences shown as SEQ ID NO. 1, 2, 3, 4, 5 and 6; more preferably, the Transcription termination / antitermination protein NusG gene is detected by the nucleotide sequence shown as SEQ ID NO.

1. Further preferably, the reagent for detecting the outer membrane protein HMP gene of the Poras species is selected from the nucleotide sequences shown as SEQ ID NO. 7, 8, 9, 10, 11, 12; more preferably, the outer membrane protein HMP gene is detected by the nucleotide sequence shown as SEQ ID NO.

7.

6. The kit of claim 5, further comprising a reagent for detecting the reference gene BCoA. Preferably, the nucleotide sequence of the reference gene BCoA is shown as SEQ ID NO.

25.

7. The kit of claim 5 or 6, wherein, The reagents for detecting the Transcription termination / antitermination protein NusG gene of the Fn species and the outer membrane protein HMP gene of the Poras species and the reagent for detecting the reference gene BCoA each comprise an upstream primer, a downstream primer and a probe; Preferably, the nucleotide sequences of the upstream primer, the downstream primer and the probe for detecting the nucleotide sequence SEQ ID NO. 1 of the Transcription termination / antitermination protein NusG gene of the Fn species are shown as SEQ ID NO. 26-28, respectively, and / or the nucleotide sequences of the upstream primer, the downstream primer and the probe for detecting the nucleotide sequence SEQ ID NO. 3 of the Transcription termination / antitermination protein NusG gene of the Fn species are shown as SEQ ID NO. 29-31, respectively, and / or the nucleotide sequences of the upstream primer, the downstream primer and the probe for detecting the nucleotide sequence SEQ ID NO. 5 of the Transcription termination / antitermination protein NusG gene of the Fn species are shown as SEQ ID NO. 32-34, respectively. Preferably, the nucleotide sequences of the upstream primer, the downstream primer and the probe for detecting the nucleotide sequence SEQ ID NO. 7 of the outer membrane protein HMP gene of the Poras species are shown as SEQ ID NO. 35-37, respectively, and / or the nucleotide sequences of the upstream primer, the downstream primer and the probe for detecting the nucleotide sequence SEQ ID NO. 9 of the outer membrane protein HMP gene of the Poras species are shown as SEQ ID NO. 38-40, respectively, and / or the nucleotide sequences of the upstream primer, the downstream primer and the probe for detecting the nucleotide sequence SEQ ID NO. 11 of the outer membrane protein HMP gene of the Poras species are shown as SEQ ID NO. 41-43, respectively, and / or the nucleotide sequences of the upstream primer, the downstream primer and the probe for detecting the nucleotide sequence SEQ ID NO. 13 of the outer membrane protein HMP gene of the Poras species are shown as SEQ ID NO. 44-46, respectively. Preferably, the nucleotide sequences of the upstream primer, the downstream primer and the probe for detecting the nucleotide sequence of the outer membrane protein HMP gene of the Poras species are respectively as shown in SEQ ID NO. 35-37, and / or the nucleotide sequences of the upstream primer, the downstream primer and the probe for detecting the nucleotide sequence of the outer membrane protein HMP gene of the Poras species are respectively as shown in SEQ ID NO. 38-40, and / or the nucleotide sequences of the upstream primer, the downstream primer and the probe for detecting the nucleotide sequence of the outer membrane protein HMP gene of the Poras species are respectively as shown in SEQ ID NO. 41-43. Preferably, the nucleotide sequences of the upstream primer, the downstream primer and the probe for detecting the reference gene BCoA are respectively as shown in SEQ ID NO. 62-64.

8. Use of the reagent of any one of claims 5 to 7 in the manufacture of a kit for the diagnosis and screening of colorectal cancer and precancerous high-risk lesions.

9. A kit comprising reagents for detecting Fn species, Poras species and LacY species. Preferably, the reagents are used for detecting the Transcription termination / antitermination protein NusG gene of the Fn species, the outer membrane protein HMP gene of the Poras species and the group II intron reverse transcriptase / maturase gene of the LacY species. Further preferably, the detected nucleotide sequence of the Transcription termination / antitermination protein NusG gene is selected from the nucleotide sequences as shown in SEQ ID NO. 1, 2, 3, 4, 5 and 6; more preferably, the detected nucleotide sequence of the Transcription termination / antitermination protein NusG gene is as shown in SEQ ID NO.

1. Further preferably, the detected nucleotide sequence of the outer membrane protein HMP gene is selected from the nucleotide sequences as shown in SEQ ID NO. 7, 8, 9, 10, 11 and 12; more preferably, the detected nucleotide sequence of the outer membrane protein HMP gene is as shown in SEQ ID NO.

7. Further preferably, the detected nucleotide sequence of the group II intron reverse transcriptase / maturase gene is selected from the nucleotide sequences as shown in SEQ ID NO. 13, 14, 15, 16, 17 and 18; more preferably, the detected nucleotide sequence of the group II intron reverse transcriptase / maturase gene is as shown in SEQ ID NO.

13. Further preferably, the nucleotide sequence of the detected group II intron reverse transcriptase / maturase gene is selected from the group consisting of the nucleotide sequences as shown in SEQ ID NO. 13, 14, 15, 16, 17 and 18; more preferably, the nucleotide sequence of the detected group II intron reverse transcriptase / maturase gene is as shown in SEQ ID NO.

13.

10. The kit of claim 9, further comprising reagents for detecting the reference gene BCoA; Preferably, the nucleotide sequence of the reference gene BCoA is as shown in SEQ ID NO. 25.

Images