Application of miR-152 as a target in preparation of a drug for treating podocytopathy and the drug

Abstract

The application belongs to the field of biological medicine, and provides application of miR-152 as a target in preparation of a drug for treating podocytopathy and the drug. Specifically, the application relates to application of miR-152 as a therapeutic target and / or a drug screening target in preparation of a drug for treating podocytopathy and a drug for treating FSGS nephropathy. The miR-152 inhibitor can inhibit high expression of miR-152 in kidney tissues of podocytopathy or FSGS nephropathy, inhibit down-regulation of synaptopodin protein, RhoA protein and 14-3-3 beta protein expression, protect stability of a cytoskeleton of a podocyte in kidney tissues, and delay progressive development of FSGS disease. The application provides a new therapeutic target for treatment of FSGS disease, and has important social and economic significance.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of miR-152 as a target in the preparation of drugs for treating podocyte disease and the drugs. Background Art

[0002] Nephrotic syndrome (NS) is a clinical syndrome characterized by a series of pathological and physiological changes caused by dysfunction of the glomerular filtration barrier, leading to the excretion of protein in the blood through the urine. Focal segmental glomerulosclerosis (FSGS) is one of the most common types of NS. The incidence of FSGS is increasing globally compared to other types of glomerular diseases. Furthermore, the worsening of FSGS is a major cause of end-stage renal disease (ESRD).

[0003] Current research indicates that FSGS, also known as podocyte disease, is primarily caused by damage to podocytes, particularly the foot processes. Podocytes, or visceral epithelial cells, are tightly connected to the glomerular basement membrane (GBM). Together with the innermost layer of endothelial cells, these three layers form the glomerular filtration barrier. This barrier is closely linked to the development and progression of FSGS. Podocytes are terminally differentiated cells that line the outer surface of glomerular capillaries. Once damaged, they no longer possess the ability to heal and regenerate, ultimately leading to cell shedding. When podocytes are damaged, the foot processes undergo diffuse proliferation or fusion and further detachment, forming segmental sclerosis, which will eventually lead to the formation of FSGS. When the podocyte shedding rate does not exceed 20%, the remaining podocytes can compensate and hypertrophy; when the shedding rate is greater than 20% but not more than 40%, the basement membrane will be exposed due to the massive shedding of podocytes, and the podocytes will lose the tension on the capillary loops. Therefore, when there is high pressure in the capsule, the exposed basement membrane will be squeezed together with the Bowman's capsule wall due to pressure, resulting in glomerular adhesion; when the podocyte shedding rate exceeds 40%, the remaining podocytes will lose their compensatory ability, and the high pressure in the capsule will continue to exist, which will lead to the aggravation of adhesion. At this time, plasma proteins and matrix proteins will leak out, and the glomerulus will gradually harden until it loses function.

[0004] The incidence of FSGS has been increasing worldwide. The development and progression of FSGS has been a hot topic in basic research. Improving the prognosis of FSGS patients will not only benefit their families but also have important social and economic implications.

[0005] Because miRNAs are essential players in fundamental biological cellular and molecular processes, changes in miRNA expression in various tissues and organs are closely linked to the development of various diseases. Consequently, research on the role of miRNAs in the progression of kidney disease is rapidly increasing. Studies have shown that changes in miRNA expression are crucially associated with the normal development of renal tissue and the maintenance of normal renal function. For example, miR-200a, miR-200b, and miR-429, all belonging to the miR-200 family, promote differentiation during podocyte growth. Their primary mechanism of action is high miRNA expression, which inhibits the RSAD2 protein, which contains the S-adenosylmethionine domain. miRNAs are involved in the development and progression of various podocyte diseases, and their dysregulation can lead to podocyte damage and death.

[0006] In view of this, the present invention is proposed. Summary of the Invention

[0007] The technical problem to be solved by the present invention is to overcome the deficiencies of the existing technology and provide the application of miR-152 as a target in the preparation of drugs for treating podocytosis and drugs. It involves the application of miR-152 as a therapeutic target and / or drug screening target in the preparation of drugs for treating podocytosis and drugs for treating FSGS nephropathy, providing a new therapeutic target for the treatment of FSGS disease, which has important social and economic significance.

[0008] In order to solve the above technical problems, the basic concept of the technical solution adopted by the present invention is:

[0009] Through research on mice with doxorubicin-induced nephropathy, the inventors found that miR-152 was highly expressed in mice with doxorubicin-induced nephropathy, which in turn downregulated the expression of 14-3-3β protein. Synaptopodin was degraded due to the loss of 14-3-3β protein-dependent protection, resulting in the destruction of the podocyte actin skeleton, which in turn led to podocyte damage and the progression to FSGS.

[0010] The first object of the present invention is to provide the use of miR-152 as a target in the preparation of a drug for treating podocytosis, wherein miR-152 is used as a therapeutic target and / or a drug screening target.

[0011] The second object of the present invention is to provide the use of miR-152 as a target in the preparation of a drug for treating FSGS nephropathy, wherein miR-152 is used as a therapeutic target and / or a drug screening target.

[0012] The third object of the present invention is to provide a drug for treating podocytosis using miR-152 as a drug target, wherein miR-152 is used as a target for treating podocytosis, and the drug includes an inhibitor of miR-152.

[0013] The fourth object of the present invention is to provide a drug for treating FSGS nephropathy using miR-152 as a drug target, characterized in that miR-152 is used as a target for treating FSGS nephropathy, and the drug includes a miR-152 inhibitor.

[0014] In a further embodiment, the drug downregulates the expression of miR-152 in renal tissue of podocyte disease or FSGS nephropathy.

[0015] In a further embodiment, the drug inhibits the downregulation of 14-3-3β protein expression in renal tissue of podocyte disease or FSGS nephropathy.

[0016] In a further embodiment, the drug inhibits the downregulation of RhoA protein expression in renal tissue of podocyte disease or FSGS nephropathy.

[0017] In a further embodiment, the drug inhibits the downregulation of synaptopodin protein expression in renal tissue of podocyte disease or FSGS nephropathy.

[0018] In a further approach, the miR-152 inhibitor protects the stability of the podocyte cytoskeleton in renal tissue and delays the progressive development of FSGS disease by inhibiting the high expression of miR-152 in renal tissue of podocyte disease or FSGS nephropathy and inhibiting the downregulation of synaptopodin protein, RhoA protein and 14-3-3β protein expression.

[0019] In a further embodiment, the nucleic acid sequence of the miR-152 inhibitor is CCAAGUUCUGUCAUGCACUGA, which is referred to as antagomir-152 in the present invention.

[0020] MiRNA antagomirs are single-stranded small RNAs synthesized through chemical synthesis based on the mature sequence of miRNAs. They undergo a series of special labeling and chemical modifications, making them highly effective inhibitors specifically designed to inhibit microRNAs in the body. The antagomir's 3' end is modified with cholesterol, four thiolate backbones, and two thiolate backbones at the 5' end, while the entire 2' end is methylated. Due to their higher affinity for cell membranes, miRNA antagomirs exhibit greater stability and efficacy in inhibiting miRNA expression in vivo than commonly used miRNA inhibitors in animal studies. They also exhibit a longer-lasting inhibitory effect, with a minimum of seven days of efficacy.

[0021] After adopting the above technical solution, the present invention has the following beneficial effects compared with the prior art:

[0022] 1. The present invention relates to the use of miR-152 as a therapeutic target and / or drug screening target in the preparation of drugs for treating podocytosis and FSGS nephropathy, providing a new therapeutic target for the treatment of FSGS disease, which has important social and economic significance.

[0023] 2. The present invention provides drugs for treating podocyte diseases using miR-152 as a drug target, including miR-152 inhibitors. In a mouse FSGS model, the miRNA inhibitor antagomiR-152 successfully inhibited miR-152, which is highly expressed in diseased mice. In this mouse FSGS model, the miRNA inhibitor antagomiR-152 protected the stability of the podocyte cytoskeleton in renal tissue by inhibiting the downregulation of synaptopodin, RhoA, and 14-3-3β protein expression, thereby improving FSGS disease.

[0024] The specific embodiments of the present invention will be described in further detail below with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] The accompanying drawings are part of the present invention and are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention, but do not constitute an undue limitation of the present invention. Obviously, the drawings described below are only some embodiments. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without inventive effort. In the accompanying drawings:

[0026] Figure 1 It was demonstrated that Antagomir-152-CY3 can be absorbed by mouse kidneys;

[0027] Note: A white light, 200×; B fluorescence 200×; C fluorescence, 1000×; D fluorescence DAPI nuclear staining, 1000×; E Merge;

[0028] Figure 2 The changes of urine protein, serum creatinine and body weight of mice in the control group and the adriamycin group; Note: n = 6, *P < 0.05 compared with the control group;

[0029] Figure 3 The changes of urine protein and serum creatinine relative to body weight in each group of mice; Note: n = 6, * compared with the control group, P < 0.05; # compared with the adriamycin group, P < 0.05;

[0030] Figure 4Pathological sections of the kidney tissues of mice in each group. Note: A, B, C, and D are Masson staining (200×); E, F, G, and H are HE staining (200×). A and E are control groups; B and F are doxorubicin groups; C and G are doxorubicin plus inhibitor groups; D and H are doxorubicin plus inhibitor control groups;

[0031] Figure 5 is the expression level of miR-152 in the kidney tissue of mice in each group; Note: n = 6, * compared with the control group, P < 0.05; # compared with the doxorubicin group, P < 0.05;

[0032] Figure 6 Western Blot was used to detect the expression levels of synaptopodin, RhoA, and 14-3-3β proteins in the kidney tissues of mice in each group;

[0033] Figure 7 is the gray value analysis of synaptopodin, RhoA, and 14-3-3β protein expression in the kidney tissues of mice in each group;

[0034] Note: n=3, *compared with the control group, P<0.05; #compared with the adriamycin group, P<0.05.

[0035] It should be noted that these drawings and textual descriptions are not intended to limit the conceptual scope of the present invention in any way, but rather to illustrate the concept of the present invention for those skilled in the art by referring to specific embodiments. DETAILED DESCRIPTION

[0036] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. The following embodiments are used to illustrate the present invention but are not used to limit the scope of the present invention.

[0037] 1 Experimental Materials

[0038] 1.1 Experimental Animals

[0039] SPF-grade healthy male BALB / c mice, weighing (20 ± 2) g and 7 weeks old, were purchased from Sibeifu (Beijing) Biotechnology Co., Ltd., license number: SCXK (Beijing) 2019-0019.

[0040] 1.2 Main experimental instruments are shown in Table 1

[0041] Table 1

[0042]

[0043]

[0044] 1.3 Main experimental reagents

[0045] Doxorubicin was purchased from Selleck Chemicals, USA; physiological saline was purchased from Shandong Qidu Pharmaceutical Co., Ltd.; isoflurane was purchased from Shenzhen Ruiwode Technology Co., Ltd.; mouse urine protein (UP) ELISA kit and mouse serum creatinine (S-Cr) ELISA kit were purchased from Wuhan Merck Biotechnology Co., Ltd.; Masson staining kit was produced by Nanjing Jiancheng Technology Co., Ltd.; miRcute miRNA extraction and separation kit, miRNA The first-strand cDNA synthesis kit and miRNA fluorescence quantitative detection kit were purchased from Tiangen Biochemical Technology Co., Ltd.; glycine, tris(hydroxymethyl)aminomethane (Tris), sodium dodecylsulfate (SDS), ammonium persulfate (APS), acrylamide (ACR), and N,N'-methylenebisacrylamide (BIS) were purchased from Sigma, USA; NaH2PO4·2H2O, Na2HPO4, and sodium chloride (NaCl) were purchased from Wako Pure Chemical Industries, Ltd., Japan; anhydrous ethanol and methanol were produced by Tianjin Fuyu Fine Chemical Co., Ltd.; xylene was purchased from Tianjin Kaitong Chemical Reagent Co., Ltd.; paraformaldehyde was produced by Tianjin Beilian Fine Chemical Development Co., Ltd.; formaldehyde was produced by Tianjin Damao Chemical Reagent Factory; sucrose was purchased from Xilong Science Co., Ltd.; cryoembedding medium (OCT) was purchased from Sakura, USA; 0.45 μm PVDF membrane was purchased from the United States Company; RIPA lysis buffer (strong), PMSF (100 mM), BCA protein concentration determination kit, ultra-sensitive ECL chemiluminescence kit, SDS-PAGE protein loading buffer (5×), color pre-stained marker, and TEMED were all purchased from the official website of Shanghai Beyotime Biotechnology Co., Ltd.; Tween-20 was purchased from Amresco, USA; Synaptopodin mouse monoclonal antibody was purchased from Santa Cruz (USA) Biotechnology Company; RhoA rabbit monoclonal antibody, 14-3-3β rabbit polyclonal antibody, HRP-labeled goat anti-rabbit IgG, and HRP-labeled Tubulin mouse monoclonal antibody were all purchased from abcam (UK) Biotechnology Company; the RNA inhibitors used in the experiment (including antagomir-152 and antagomir nc) were synthesized by Shanghai Sangon Biotechnology (Shanghai) Co., Ltd.

[0046] The nucleic acid sequence of antagomir-152 is: CCAAGUUCUGUCAUGCACUGA

[0047] Antagomir nc is the negative control of antagomir-152, and its nucleic acid sequence is: CAGUACUUUUGUGUAGUACAA.

[0048] 1.4 Solution preparation

[0049] (1) Preparation of ADR

[0050] Preparation of concentrated stock solution: After high-speed centrifugation of 25 mg of Doxorubicin (Adriamycin) HCl in a clean bench, add 2.0 mL of autoclaved deionized water and mix manually with a pipette to fully dissolve it to a final concentration of 12.5 mg / mL. Store in a refrigerator at -80°C until used.

[0051] Preparation of working solution: Work in a clean bench. Add 1050 μL of autoclaved deionized water to 200 μL of concentrated stock solution, dilute to 2 mg / mL, and dispense into multiple 1.5 mL EP tubes and store in a -80°C refrigerator until use.

[0052] (2) 1× phosphate buffered saline (PBS)

[0053] Weigh 0.5825 g of Na2HPO4, 0.14 g of NaH2PO4·2H2O, and 4.5 g of NaCl into a 1 L beaker, dissolve in 400 mL of deionized water, adjust the pH to 7.4 with 1 N HCl and NaOH, make up to 500 mL, sterilize by autoclave, and store at 4°C until use.

[0054] (3) 30% sucrose

[0055] Weigh 30 g of sucrose and dissolve it in 80 mL of 1× PBS in a beaker. Stir with a glass rod until the solution becomes clear. Then dilute to 100 mL with 1× PBS. Prepare the solution one day in advance and do not store it for a long time.

[0056] (4) 4% paraformaldehyde

[0057] Weigh 4 g of paraformaldehyde into a small beaker, add 60 mL of 1× PBS, heat with a magnetic stirrer (measured with a thermometer, not exceeding 60°C) and stir until fully dissolved and cooled. Adjust the pH to 7.4 with HCl and NaOH, and make up to 100 mL with 1× PBS. Seal with parafilm and store at 4°C or aliquot and freeze at -20°C.

[0058] (5) 10% formalin

[0059] To prepare 100 mL, measure 10 mL of 37%-40% formaldehyde solution, dilute to volume with distilled water, and store at room temperature until use. Prepare one day in advance.

[0060] (6)10×TE

[0061] Measure 5 mL of 1 M Tris hydrochloric acid (pH 8.0) and 1 mL of 0.5 M EDTA, mix well, and dilute to 50 mL with deionized water. Autoclave and store at room temperature.

[0062] (7) Preparation of primers

[0063] (I) U6 F (nmoles per OD: 5.8) powder was added to 58 μL 10× TE (buffer) to prepare a 100 μM concentrated stock solution;

[0064] Add 90 μL RNase-Free ddH2O to 10 μL of concentrated stock solution to prepare a 10 μM working solution.

[0065] U6 R (nmoles per OD: 4.6) powder was added to 46 μl of 10× TE (buffer) to prepare a 100 μM concentrated stock solution;

[0066] Add 90 μL RNase-Free ddH2O to 10 μL of concentrated stock solution to prepare a 10 μM working solution.

[0067] (II) mir-152F (nmoles per OD: 4.8) powder was added to 48 μL 10×TE (buffer) to prepare a 100 μM concentrated stock solution;

[0068] Add 90 μL RNase-Free ddH2O to 10 μL of concentrated stock solution to prepare a 10 μM working solution.

[0069] (8) Preparation of antagomir-152-CY3

[0070] Since CY3 fluorescence is easily degraded by light, the entire operation process was protected from light. Antagomir-152-CY3 (2OD / tube, 8nmol, 66μg) was centrifuged at 4°C and transferred to ice for enzyme-free operation. 132μL of DEPC water was added and vortexed to fully dissolve it. Finally, a working solution with a concentration of 0.5μg / μL was prepared.

[0071] (9) Preparation of antagomir-152 and antagomir nc (control inhibitor)

[0072] Antagomir-152 (2OD / tube, 8.7nmol, 66μg) and antagomir nc (2OD / tube, 8.6nmol, 66μg) were centrifuged at 4°C and transferred to ice for enzyme-free operation. 132μL of DEPC water was added and vortexed to fully dissolve them. The final working solution was prepared at a concentration of 0.5μg / μL.

[0073] (10) 10×SDS electrophoresis buffer

[0074] Weigh 3.03 g of Tris and 18.77 g of Glycine, pour into a 200 mL beaker, add 80 mL of deionized water, stir with a magnetic stirrer to dissolve, measure 10 mL of 10% SDS solution, dilute to 100 mL, and store at room temperature for later use.

[0075] (11) 1×SDS electrophoresis buffer

[0076] Measure 100 mL of 10× SDS electrophoresis buffer into a measuring cylinder, then dilute to 1000 mL with deionized water and store at room temperature until use.

[0077] (12) 10×TBS buffer

[0078] Add 12.1 g of Tris and 44 g of NaCl to a 1 L beaker, add 400 mL of deionized water, and stir with a glass rod to dissolve. Adjust the pH to 7.5 with 1 N HCl and NaOH, make up to 500 mL, and store at room temperature until ready to use.

[0079] (13) 1×TBST buffer

[0080] To prepare 1L of 1×TBST, add 100mL of 10×TBS and 250μL of Tween-20. Add deionized water to the volume and store at room temperature until use.

[0081] (14) 10× Transfer Buffer (TB)

[0082] Weigh 29 g of Tris and 14.5 g of Glycine into a 1 L beaker, add about 400 mL of deionized water, stir with a magnetic stirrer, and after dissolution, dilute to 500 mL in a graduated cylinder. Store at 4°C until ready for use.

[0083] (15) 1× Transfer Buffer

[0084] To prepare 1L of 1×TB, take 100mL of 10×TB solution and 200mL of methanol solution, then add deionized water to the volume and store at 4℃ until use.

[0085] (16) 1.0M Tris-HCl stacking gel buffer

[0086] Weigh 12.115 g of Tris into a 200 mL beaker, add 80 mL of deionized water, stir with a magnetic stirrer until dissolved, adjust the pH to 6.8 with 1 N HCl and NaOH, make up to volume, autoclave, and store at 4°C until ready for use.

[0087] (17) 1.5M Tris-HCl separation gel buffer

[0088] Weigh 18.17 g of Tris in a small beaker, add 80 mL of deionized water, stir with a magnetic stirrer, adjust the pH to 8.8 after dissolution, make up to volume with deionized water, sterilize under high pressure, and store at 4°C until use.

[0089] (18) 10% ammonium persulfate APS

[0090] Weigh 0.1 g of APS and add 1 mL of deionized water. Mix well with a micropipette and aliquot into 40 μL / tube and 100 μL / tube respectively. Store at -20°C. It is best to use within one week and avoid repeated freezing and thawing.

[0091] (19) 30% Acrylamide Acr / Bis

[0092] Weigh 14.5 g ACR and 0.5 g BIS into a 100 mL beaker, add 30 mL deionized water, stir with a glass rod until the solution becomes clear, adjust to volume, and store in a brown bottle at 4°C until use.

[0093] (20) 10% SDS

[0094] Weigh 10 g of SDS into a 200 mL beaker, add 80 mL of deionized water, heat with a magnetic stirrer (not exceeding 68°C), adjust the pH to 7.2 with 1N HCl and NaOH, then make up the volume and store at room temperature until use.

[0095] (21) 5% skim milk blocking solution

[0096] Weigh 0.5 g of skim milk into a 50 mL centrifuge tube, add 10 mL of 1× TBST, and vortex until there are no small particles in the solution. Prepare the solution before use.

[0097] (22) Preparation of polyacrylamide gel

[0098] (I) Preparation of 10% polyacrylamide separation gel (10 mL)

[0099] Table 2

[0100]

[0101]

[0102] Add the above volume to a 15 mL centrifuge tube. After adding each formula, mix thoroughly to avoid bubbles.

[0103] (II) Preparation of 5% polyacrylamide stacking gel (4 mL)

[0104] Table 3

[0105]

[0106] Add the above volume to a 15 mL centrifuge tube. After adding each formula, mix thoroughly to avoid bubbles.

[0107] 2 Experimental methods

[0108] 2.1 Animal grouping and husbandry

[0109] SPF male BALB / c mice, weighing (20 ± 2) g and 7 weeks old, were housed six per cage. They were maintained in a barrier environment that complies with the requirements of GB14925-2010, "Experimental Animal Environment and Practice." During the experiment, the room temperature was maintained at 24–25°C, with 12-hour alternating light and dark lighting. They had free access to food and water. After one week of acclimatization, mice were observed to be generally active and showed no adverse reactions. All animal experiments were approved by the Experimental Animal Ethics Committee of Baotou Medical College.

[0110] Three eight-week-old mice were randomly assigned and injected with a fluorescent (CY3)-labeled miR-152 inhibitor (antagomir-152-CY3) via the tail vein in a dimly lit environment. Six hours later, the mice were anesthetized with isoflurane and sacrificed, and renal tissue was collected and fixed in 4% paraformaldehyde for at least 6 hours. The tissue was then transferred to a 30% sucrose solution and refrigerated at 4°C for 12 hours. After OCT embedding, the tissue was stored at -80°C. Frozen sections were prepared, nuclear staining with DAPI, and fluorescence microscopy was used to examine the fluorescence intensity of glomeruli and renal tubules in the renal tissue.

[0111] Thirty-six eight-week-old mice were randomly divided into four groups: one control group (NS, n=6) and three experimental groups: an adriamycin group (ADR, n=18), an adriamycin plus inhibitor group (ADR + antagomir-152, n=6), and an adriamycin plus inhibitor control group (ADR + antagomir nc, n=6). All experimental groups received a single tail vein injection of 10.5 mg / kg ADR using a tail-injection device, followed by alcohol wiping of the tail. The adriamycin plus inhibitor and adriamycin plus inhibitor control groups received tail vein injections of 2 mg / kg RNA inhibitor every week, starting on the day of ADR injection. The control group received an equal volume of saline. The growth and health of the mice were observed daily after ADR injection.

[0112] 2.2 Sample collection and processing

[0113] Six mice from the doxorubicin group were taken on the 7th and 14th days after the injection of ADR, respectively. They were anesthetized with isoflurane and the anesthesia took effect in about 2 minutes. The mice were unconscious and had no resistance. The mice were placed in a supine position with their abdomens and limbs exposed and fixed on a foam operating table. Operations were performed using small scissors and tweezers that had been sterilized in advance. Urine was collected from the bladder, and after standing for a while at room temperature, it was centrifuged at 500×g for 5 minutes. The sediment was removed and the supernatant was taken. The tubes were divided into 20μL each and stored in a -80℃ refrigerator for testing. Blood was collected from the heart with a thick needle syringe, and after standing at room temperature until the supernatant was seen to precipitate, it was centrifuged at 500×g for 5 minutes. The upper serum was taken and divided into 20μL aliquots and stored at -80℃ for testing. Both kidneys were removed by laparotomy, and the vascular-like connective tissue around the renal hilum was removed. The upper and lower poles of both kidneys were taken and placed in a sterile, enzyme-free 1.5mL EP tubes were immediately stored in liquid nitrogen. After all mice were processed, the kidney tissues were quickly transferred to a -80°C freezer for subsequent Western blotting and RT-PCR experiments. The midsections of both kidneys were cut along the sagittal plane and fixed in 4% paraformaldehyde solution for no more than 24 hours. One portion was then transferred to 10% formalin solution, fixed for 12 hours, dehydrated for 12 hours, and embedded in paraffin for histopathological sectioning. Another portion was transferred to 30% sucrose solution, incubated at 4°C for 12 hours, and embedded in OCT for immunofluorescence analysis. At the end of the experiment on day 28, all mice in the control group and each experimental group were processed as above and collected.

[0114] 2.3 Determination of blood and urine biochemical indicators

[0115] 2.3.1 Urine protein determination

[0116] (1) Take the kit out of the refrigerator and equilibrate to room temperature before the experiment;

[0117] (2) Six different concentrations of the standard sample were set: 0, 5, 10, 20, 40, and 80 μg / L. One parallel well was set for each concentration. 50 μL of sterilized deionized water was added to each well, and 50 μL of diluted urine sample was added to each well (be careful to add to the bottom of the well and avoid touching the wall of the well).

[0118] (3) Seal the plate with sealing film and incubate at 37°C for 30 minutes.

[0119] (4) Dilute the solution with sterile deionized water according to the dilution multiple.

[0120] (5) Washing: Peel off the membrane, spin dry, add detergent, wash for 30 seconds, discard the detergent, repeat 5 times, and pat dry.

[0121] (6) Add 50 μL of enzyme-labeled reagent (note that no blank wells are added).

[0122] (7) Incubation operation is the same as (3)

[0123] (8) Washing operation is the same as (5)

[0124] (9) Take 50 μL of each color development solution A and solution B and add them to each well, shake gently to mix, and incubate at 37°C in the dark for 15 min.

[0125] (10) Stop the reaction by adding 50 μL of stop solution (the color changes from blue to yellow).

[0126] (11) Measure the absorbance (OD) at a wavelength of 450 nm using a microplate reader. The measurement process is controlled within 15 minutes after the completion of step (10).

[0127] 2.3.2 Serum creatinine measurement

[0128] The standard wells have 6 different concentrations of 0, 0.5, 1, 2, 4, and 8 μmol / L. The rest of the operation steps are the same as those for urine protein determination.

[0129] 2.4 Renal tissue pathological observation

[0130] 2.4.1 HE staining of renal tissue

[0131] (1) Paraffin blocks were sliced ​​into 3-4 μm sections, oven-baked at 65°C for 30 min, and dewaxed in fresh xylene for 5 min each time × 3 times;

[0132] (2) Anhydrous ethanol 5 min / time × 2, 95% ethanol 5 min, 75% ethanol 5 min;

[0133] (3) Use a histochemical pen to draw the outline of the tissue to avoid reagent waste;

[0134] (4) Hematoxylin for 5 min, then wash with water for 1 min;

[0135] (5) hydrochloric acid alcohol 15s, ammonia water 15s, water washing 30s;

[0136] (6) Eosin for 2 minutes, then wash with water for 1 minute;

[0137] (7) 75% ethanol, 95% ethanol, 30 seconds each, anhydrous ethanol, 30 seconds / time × 2, xylene, 2 minutes / time × 2;

[0138] (8) After drying, seal the slide and observe.

[0139] 2.4.2 Masson staining of renal tissue

[0140] (1) Process the sections in the same manner as HE staining (1);

[0141] (2) Alcohol gradient into water: 95%, 70%, and 30% ethanol for 2 minutes each, and finally placed in distilled water for 2 minutes;

[0142] (3) Use a histochemical pen to draw the outline of the tissue to avoid reagent waste;

[0143] (4) Rinse twice with warm water at (30-40)℃, each time within (30-60)s, until there are no small water droplets on the glass slide, except for the sample;

[0144] (5) R1 nuclear staining for 60 seconds, discard, add rinse solution dropwise with a pipette and shake well manually for about 30 seconds;

[0145] (6) R2 was stained for 50 seconds, discarded, and rinsed for 30 seconds as above (this step should be time-controlled accurately. If it is too long, the cytoplasm will be too dark and will not fade easily in the next step);

[0146] (7) R3 color separation for 10 min (during this step, the color of the collagen fibers in the sample can be observed to gradually fade from red under a microscope), and the color separation solution is discarded. Note that no rinse solution is required in this step;

[0147] (8) Restain R4 for 3 minutes, discard, and rinse directly in anhydrous ethanol without adding rinse solution;

[0148] (9) After drying, seal the slide and observe.

[0149] 2.5 RT-PCR detection of miR-152 expression

[0150] 2.5.1 Total RNA extraction from kidney tissue

[0151] (1) Since RNA is easily degraded, total RNA extraction was performed in a ventilated space throughout the experiment;

[0152] (2) Sample processing: Use sterilized scissors to cut approximately 10 mg of kidney tissue and place it in a pre-chilled 1.5 mL RNase-free EP tube. Add 500 μL of lysis buffer MZ and four sterilized steel balls. Homogenize using a homogenizer that has been frozen for 20 minutes. Set the frequency to level 4 and the time to 1 minute 30 seconds (the time can be extended appropriately by observing the tissue state). The sample volume should not be too large, preferably less than one-tenth of the volume of lysis buffer MZ.

[0153] (3) The homogenized sample was allowed to stand at room temperature for 5 min;

[0154] (4) Centrifuge at 12,000 rpm for 5 min at 4°C, collect the supernatant, and transfer it to a new pre-chilled sterile RNase-free centrifuge tube;

[0155] (5) Add 200 μL of chloroform, shake vigorously up and down for 15 seconds (close the tube tightly to prevent leakage during the process), and let it stand at room temperature for 5 minutes;

[0156] (6) Centrifuge at 12,000 rpm for 15 min at 4°C. The sample will separate into three layers, with RNA in the top aqueous phase. Use a micropipette to transfer the aqueous phase to a new tube several times (be careful not to aspirate the middle layer), and then proceed to the next step.

[0157] (7) Slowly add 1.5 times the volume of fresh anhydrous ethanol obtained in the previous step, shake gently up and down, then transfer to the miRspin adsorption column, centrifuge at 12000 rpm at room temperature for 30 seconds, discard the waste liquid, and retain the miRspin adsorption column;

[0158] (8) Add 500 μL of MRD pre-added with ethanol, let stand at room temperature for 2 min, centrifuge at 12,000 rpm for 30 s, and discard the waste liquid;

[0159] (9) Add 500 μL RW to which ethanol has been added in advance, let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 30 s, and discard the waste liquid;

[0160] (10) Repeat step (9);

[0161] (11) Place the miRspin adsorption column in a new 1.5 mL sterile RNase-free EP tube and centrifuge at 12,000 rpm for 1 min to fully remove the added liquid. Open the tube cap and place it in a ventilated place at room temperature to fully dry (failure to dry will affect subsequent RT-PCR and other operations);

[0162] (12) Transfer the adsorption column miRspin into a new sterile RNase-free 1.5 mL centrifuge tube, add 30 μL RNase-Free ddH2O, place at room temperature for 2 min, centrifuge at 12000 rpm for 2 min, discard the adsorption column and keep the EP tube;

[0163] (13) Measure RNA concentration using Nano Drop instrument, calculate and synthesize cDNA chain or store immediately in -80℃ freezer.

[0164] 2.5.2 mRNA cDNA First-Strand Synthesis

[0165] (1) Preparation of reverse transcription system

[0166] Thaw 2× miRNA RT Reaction Buffer at room temperature. Slowly invert the tube several times before gently centrifuging in a handheld centrifuge. Thaw the miRNA RT Enzyme Mix and place it on ice. Add the reagents listed in Table 4 to the pre-chilled RNase-free reaction tube to bring the total volume to 20 μL.

[0167] Table 4 Reverse transcription system and reaction conditions

[0168]

[0169]

[0170] Note: When the volume is greater than 8 μL when the concentration reaches 2 μg, the minimum final concentration should be used for quantification. The operation should be performed on ice during sample addition.

[0171] (2) The prepared reaction solution was centrifuged slightly at low speed, and the miRNA reverse transcription reaction was performed according to the reaction conditions in the above table. The synthesized cDNA reaction solution was stored at -20°C for subsequent RT-PCR operation.

[0172] 2.5.3 RT-PCR detection of gene expression

[0173] Real-time quantitative PCR analysis of miR-152 and U6 was performed using SYBR-Green PCR. U6 was used as a control for miR-152, and the PCR primer sequences were (see Table 5).

[0174] Table 5 PCR primer sequences

[0175]

[0176] (1) Take out the kit from the refrigerator in advance and allow the 2×miRcute Plus miRNA Premix, forward primer, and rear primer to completely melt before proceeding.

[0177] (2) Invert the 2×miRcute Plus miRNA Premix upside down to avoid bubbles and centrifuge gently before use;

[0178] Table 6 RT-PCR reaction system and reaction conditions

[0179]

[0180] Note: The sample addition operation should be performed on ice.

[0181] (3) Detection was performed using the ABI Step One Plus RT-PCR instrument, with two replicate wells set up for each sample;

[0182] (4) The fluorescence signal Ct value at the last moment of the cyclic extension reaction was collected, and the relative expression level of mRNA was calculated using ΔΔCt (ΔΔCt = 2 -ΔCt , ΔCt=Ct miR-152 -Ct U6 ) analysis and statistics.

[0183] 2.6 Western blot detection of protein expression levels

[0184] 2.6.1 Extraction of protein samples

[0185] (1) Sample processing: Use autoclaved small scissors to cut approximately 10 mg of kidney tissue and place it in a pre-chilled 1.5 mL EP tube. Add 200 μL of RIPA lysis buffer, containing 1 μL of PMSF per 100 μL of RIPA.

[0186] (2) Place the sample on ice and sonicate in an ultrasonic instrument with a time of 3 seconds and an interval of 9 seconds for a total of 48 seconds (the fragmentation time can be extended appropriately by observing the tissue fragmentation);

[0187] (3) Centrifugation at 12,000 rpm for 20 min at 4°C;

[0188] (4) Take the supernatant and transfer it to a new sterile tube;

[0189] (5) Store in a -80℃ refrigerator.

[0190] 2.6.2 BCA method for protein concentration and quantification

[0191] (1) All operations must be performed on ice;

[0192] (2) Prepare a 0.5 mg / mL BSA working solution (20 μL BSA standard + 180 μL lysis solution) using the lysis solution. Add 0, 2, 4, 8, 16, and 20 μL of the working solution to wells A1-A8, respectively. Then, add the lysis solution to wells A1-A8 so that the final volume in each well is 20 μL. Repeat for wells B1-B8 and C1-C8.

[0193] (3) Dilute the protein sample to be tested 10-fold (2 μL of the sample to be tested + 18 μL of lysis buffer), and make a duplicate well for each sample;

[0194] (4) Based on the ratio of solution A: solution B = 50:1, calculate the required amount of working solution, 200 μL per well;

[0195] (5) Incubate in a 37°C incubator for 20-30 minutes;

[0196] (6) Measure the OD value at 562nm with an enzyme-labeled instrument and draw a standard curve (R 2 >0.99), and calculate the protein concentration of each sample;

[0197] (7) Calculate and unify the final concentration based on the concentration of each protein, i.e., protein quantification. Mix the SDS-PAGE protein loading buffer (5×) with the obtained protein sample at a ratio of 1:4. Dilute the high-concentration protein sample with RIPA, boil at 100°C for 5 min, cool to room temperature, and perform electrophoresis immediately or store at -20°C for later use.

[0198] 2.6.3 Western blot detection of protein expression

[0199] (1) Assemble the glue dispenser: Spray the large and small glass plates with 75% alcohol and let them dry. Install them on the rack with the large glass plate facing inward and the small glass plate facing outward. Place them on the foam strips to prevent glue leakage.

[0200] (2) Glue preparation: Prepare 10% separation gel (10 mL, two-plate gel) according to the formula. Gently mix each ingredient manually after adding it. After fully mixing, add it slowly and carefully along the gap between the two plates. Add the two-plate gel alternately. The gel filling height is usually 1 cm from the bottom of the comb. Then add deionized water immediately until it overflows slightly. After about 30 minutes of gel polymerization, discard the sealing glue. Prepare 5% concentrated gel (4 mL, two-plate gel) according to the solution preparation plan. Fill the gel until it overflows to ensure that there are no small bubbles when inserting the comb. After filling the concentrated gel, insert the comb vertically immediately and let it stand at room temperature to observe and wait for the gel to polymerize.

[0201] (3) Sample loading and electrophoresis: After confirming gel polymerization, install the gel plate into the electrophoresis tank. At this time, the orientation of the large and small glass plates is reversed. Remove the comb and add the sample and marker. Note that after adding each sample, the tip of the gun should be rinsed with buffer or replaced. Constant current electrophoresis: 19mA for the stacking gel and 29mA for the separation gel. Turn off the electrophoresis instrument after the gel reaches the bottom.

[0202] (4) Transfer: Prepare pre-cooled 1×TB at least 30 minutes in advance, soak the filter paper and sponge pad with pre-cooled 1×TB for at least 30 minutes, and soak the PVDF membrane in methanol for 15 seconds to activate it to make it positively charged. Soak in 1×TB for 10 minutes, and install the transfer clip starting from the black negative electrode in the order of sponge pad, filter paper, gel, PVDF membrane, filter paper, and sponge pad. Press out the bubbles each time you add a layer. (Once the glue and membrane are in contact, try not to move them to avoid affecting the experimental results.) Finally, confirm the direction, connect the PVDF membrane to the positive electrode, and the glue to the negative electrode. Fill the transfer tank with pre-cooled 1×TB, and wet transfer at a constant current of 200mA at 4°C for 2.5 hours.

[0203] (5) Blocking: To prevent the high background caused by nonspecific binding of the primary antibody to the membrane, the membrane needs to be blocked. Place the membrane in 5% skim milk and incubate it for 60 minutes at room temperature on a decolorizing shaker at 40 rpm.

[0204] (6) Membrane washing: 1×TBST 10 min / time × 3, speed 90 r / min;

[0205] (7) Primary Antibody Incubation: Adjust the concentration of the diluted primary antibody according to the antibody instructions and operational experience. The final concentrations are as follows: 14-3-3β (1:500), Synaptopodin with HRP (1:100), RhoA (1:500), Tubulin with HRP (1:2000), all diluted with primary antibody diluent. Incubate at 4°C overnight for (12-18) hours, at 40 rpm.

[0206] (8) Membrane washing: 1×TBST 10 min / time × 3, speed 90 r / min;

[0207] (9) Secondary antibody incubation: dilute HRP-labeled goat anti-rabbit secondary antibody (1:2000) with secondary antibody diluent and incubate at room temperature in the dark for 120 min;

[0208] (10) Membrane washing: 1×TBST 10 min / time × 3, speed 90 r / min;

[0209] (11) Detection of protein by development: Prepare ECL developer (1:1 ratio of A solution to B solution) according to the area occupied by the target protein. Select the chemiluminescence imaging acquisition mode in the Azure instrument to take photos and observe. Use Image J software for grayscale analysis. Analyze and count the target protein relative to the target protein (relative protein expression = grayscale value of target protein / grayscale value of internal reference).

[0210] 2.7 Statistical methods

[0211] SPSS 26.0 and Graphpad Prism 5 software were used for data processing, analysis, and plotting. The t-test was used to compare the means between any two groups, and one-way ANOVA was used to compare the means of multiple groups. The homogeneity of variance test was tested, and if the variances were homogeneous, the LSD test was used for post hoc analysis; if the variances were unequal, the Dunnett's T3 test was used for post hoc analysis. P < 0.05 was considered statistically significant.

[0212] 3 Experimental results and analysis

[0213] 3.1 General Condition of Mice

[0214] Three days after ADR injection, mice in all experimental groups showed significant lethargy, with matted fur and decreased activity compared to the control group. This improved after one week. No mice in any group died during the experimental period.

[0215] 3.2Antagomir-152 can be absorbed by the kidneys of ADR mice

[0216] First, to confirm whether the exogenous inhibitor can be absorbed by the mouse kidney, CY3 fluorescently labeled antagomir-152 was injected into the tail vein of the mouse, and the expression of fluorescence in the kidney tissue was observed by immunofluorescence microscopy (see Figure 1 CY3 red fluorescence is expressed in both the glomeruli and renal tubules. Figure A shows the structure of the glomerulus and renal tubules under white light. Figure B shows the expression of red fluorescence in renal tissue under the same field of view. Fluorescence is expressed within the Bowman's capsule, and the glomerular structure indicates that the RNA inhibitor has entered the glomerular podocytes, demonstrating that the inhibitor can be absorbed by the kidney. Figures C, D, and E show the distribution of red CY3 fluorescence and blue cell nuclei in the glomerulus after entering renal tissue under a fluorescence microscope.

[0217] 3.3 Results of blood and urine biochemical indicators

[0218] The serum and urine of mice in the adriamycin group were tested for protein and creatinine on days 7, 14, and 28. Figure 2 As shown in the data, the urine protein and serum creatinine of mice were corrected for body weight. It was found that compared with the control group, urine protein excretion increased on the 7th day, and blood creatinine values ​​also began to increase and continued until the end of the experiment on the 28th day. The differences were statistically significant (P<0.05). The increase in blood creatinine in mice indicated a decrease in glomerular filtration function and the appearance of nephrotic syndrome with increased urine protein excretion.

[0219] The urine of each group of mice was tested for protein, and the serum creatinine was tested, and the creatinine value was corrected for body weight. Figure 3 As shown, compared with the control group, the doxorubicin group had increased urine protein (P=0.000) and increased blood creatinine to body weight (P=0.000), both of which were statistically significant, indicating that mice not treated with the inhibitor progressed to FSGS; after 28 days of treatment, compared with the doxorubicin group, the doxorubicin plus inhibitor group had decreased urine protein (P=0.020) and decreased blood creatinine to body weight (P=0.090), and the decreased urine protein excretion was statistically significant. Although the blood creatinine to body weight decreased, it was not statistically significant. Compared with the doxorubicin group, the doxorubicin plus inhibitor control group had no changes in urine protein and blood creatinine to body weight, indicating that the antagomiR-152 inhibitor had a certain delaying effect on the progression of FSGS mice; compared with the control group, the doxorubicin plus inhibitor group had increased urine protein (P=0.009) and increased blood creatinine to body weight (P=0.001).

[0220] Based on the above experimental results, the antagomir-152 inhibitor has a delayed effect on the progressive development of nephrotic syndrome symptoms in ADR-induced FSGS mice.

[0221] 3.4 Renal histopathological observation results

[0222] like Figure 4 As shown, under light microscopy, HE staining, and Masson staining, the structure and morphology of the glomeruli and renal tubules in the control group were basically normal. In the renal tissue sections of mice in the doxorubicin group, the number of glomeruli decreased after 28 days, and segmental sclerosis was observed in the glomeruli. In particular, the renal tubules showed significant dilation, with a large number of protein casts and localized interstitial fibrosis. After 28 days of inhibitor treatment, the morphology of the glomeruli in the doxorubicin plus inhibitor group was improved compared to the segmental sclerosis in the doxorubicin group, and the number of renal tubular casts decreased, indicating improved FSGS pathology. Pathological observation of the renal tissue sections of mice in the doxorubicin plus inhibitor control group still showed changes in glomerular sclerosis and increased renal tubular casts. These results indicate that miR-152 inhibitors have an ameliorative effect on the pathological changes in the kidney tissue of mice with FSGS caused by ADR.

[0223] 3.5 Expression changes of miR-152 in mouse kidney tissue

[0224] The experimental results are shown in Figure 5 Compared with the control group, the expression of miR-152 in the doxorubicin group and the doxorubicin plus inhibitor control group was significantly increased, both with statistical significance (P<0.05); compared with the doxorubicin group, the expression of miR-152 in the doxorubicin plus inhibitor group was significantly decreased, and with statistical significance (P<0.05); while compared with the doxorubicin group, the expression of miR-152 in the doxorubicin plus inhibitor control group did not decrease significantly, and was not statistically significant (P>0.05).

[0225] The above experimental results showed that miR-152 inhibitors could inhibit the high expression of miR-152 in the kidney tissue of ADR-induced FSGS mice.

[0226] 3.6 Changes in protein expression in mouse renal podocytes

[0227] The experimental results show that (see Figure 6 and Figure 7 ), after 28 days of treatment, the expressions of Synaptopodin, RhoA and 14-3-3β proteins in the kidney tissues of the mice in the doxorubicin group and the doxorubicin plus inhibitor control group were downregulated compared with those in the control group, while the expressions of Synaptopodin, RhoA and 14-3-3β proteins in the doxorubicin plus inhibitor group were upregulated compared with those in the doxorubicin group, and the differences were statistically significant (P<0.05).

[0228] The above experimental results show that in the ADR-induced FSGS mouse model, miR-152 expression is upregulated, which can destroy the stability of the podocyte cytoskeleton by downregulating the expression of synaptopodin, RhoA, and 14-3-3β, causing podocyte damage and apoptosis. MiR-152 inhibitors may protect podocytes from damage by inhibiting the downregulation of 14-3-3β expression, thereby inhibiting the downregulation of synaptopodin and RhoA expression.

[0229] 4 Summary

[0230] The test results of the present invention prove that:

[0231] 1. ADR induced proteinuria and focal segmental glomerulosclerosis in male Balb / c mice, indicating a successful FSGS model. Furthermore, miR-152 expression was upregulated in the kidneys of this mouse FSGS model.

[0232] 2. In the mouse FSGS model, the miRNA inhibitor antagomir-152 can successfully inhibit the highly expressed miR-152 in diseased mice.

[0233] 3. In the mouse FSGS model, the miRNA inhibitor antagomir-152 can protect the stability of the podocyte cytoskeleton in renal tissue by inhibiting the downregulation of synaptopodin, RhoA and 14-3-3β protein expression, thereby improving FSGS disease.

[0234] In summary, the present invention links miR-152 to FSGS. The above research results demonstrate that: 1. miR-152 expression is upregulated in FSGS mice, and a miR-152 inhibitor can reduce miR-152 expression in mouse kidney tissue. 2. It can upregulate the expression of RhoA, a protein that induces actin monomer polymerization to form contractile stress fibers. 3. It can upregulate the expression of synaptopodin, a protein that inhibits RhoA degradation. 4. It also reduces the downregulation of 14-3-3β, a protein that binds to phosphorylated synaptopodin.

[0235] The above description is merely a preferred embodiment of the present invention and does not constitute any form of limitation to the present invention. Although the present invention has been disclosed as above in terms of a preferred embodiment, it is not intended to limit the present invention. Any technician familiar with this patent can make slight changes or modifications to equivalent embodiments using the above technical content without departing from the scope of the technical solution of the present invention. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are still within the scope of the solution of the present invention.

Claims

1. Use of a miR-152 inhibitor in the preparation of a drug for treating podocytosis, characterized in that: MiR-152 is used as a therapeutic target and / or drug screening target, and the nucleic acid sequence of the miR-152 inhibitor is CCAAGUUCUGUCAUGCACUGA.

2. Use of a miR-152 inhibitor in the preparation of a drug for treating FSGS nephropathy, characterized in that: MiR-152 is used as a therapeutic target and / or drug screening target, and the nucleic acid sequence of the miR-152 inhibitor is CCAAGUUCUGUCAUGCACUGA.

3. The use according to claim 1 or 2, characterized in that The drug downregulates the expression of miR-152 in renal tissues of podocyte disease or FSGS nephropathy.

4. The use according to claim 1 or 2, characterized in that The drug inhibits the downregulation of 14-3-3β protein expression in renal tissues of podocyte disease or FSGS nephropathy.

5. Use of a miR-152 inhibitor in the preparation of a drug for inhibiting the downregulation of RhoA protein expression in renal tissue of podocyte disease or FSGS nephropathy; the nucleic acid sequence of the miR-152 inhibitor is CCAAGUUCUGUCAUGCACUGA.

6. Use of a miR-152 inhibitor in the preparation of a drug for inhibiting the downregulation of synaptopodin protein expression in renal tissue of podocytosis or FSGS nephropathy; the nucleic acid sequence of the miR-152 inhibitor is CCAAGUUCUGUCAUGCACUGA.

Images