A sulfonylurea herbicide hydrolytic enzyme tsmE mutant, its coding gene and use

Abstract

The application discloses a sulfonylurea herbicide hydrolytic enzyme TsmE mutant, a coding gene thereof and a use thereof. The amino acid sequence of the mutant is shown in SEQ ID NO. 4. The mutant M6 provided by the application has deesterification activity to macromolecular sulfonylurea herbicides methyldisulfuron and sodium salt of methyl iodosulfuron, and therefore has a good application prospect in sulfonylurea herbicide residual pollution bioremediation and anti-herbicide transgenic engineering.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of protein engineering of enzymes, and relates to a sulfonylurea herbicide hydrolyzing enzyme TsmE mutant, a coding gene thereof and a use thereof. BACKGROUND

[0002] The use of herbicides has reduced the intensity of agricultural labor and ensured normal agricultural production, but the residues thereof have also caused serious crop phytotoxicity problems. According to statistics, the area of farmland affected by herbicide phytotoxicity in China reaches 30 million mu each year, of which the area affected by serious phytotoxicity reaches 5 million mu, and the annual loss caused thereby reaches several billion yuan. Herbicide-resistant transgenic crops are the best way to solve the problem of herbicide phytotoxicity. Sulfonylurea herbicides are used in large quantities in China, and research and application development thereof is rapid. Sulfonylurea herbicides have become the third largest herbicide after organophosphorus and acetamide herbicides, with a global annual sales of more than 2 billion US dollars, accounting for about 10% of the entire herbicide market. The application area of sulfonylurea herbicides in China has exceeded 2 million mu each year and is still expanding.

[0003] Some important sulfonylurea herbicides such as mesosulfuron-methyl (also known as metsulfuron-methyl) and methyl iodosulfuron sodium salt have other substituent groups on the aromatic ring in addition to the ester structure, so the molecular weight thereof is much larger than that of other varieties. In recent years, macromolecular sulfonylurea herbicides have developed rapidly and have become an important variety of sulfonylurea herbicides. At present, the global annual sales thereof reaches about 500 million US dollars, accounting for about 20% of the total sales of sulfonylurea herbicides. Among them, mesosulfuron-methyl, as a special herbicide for wheat fields, has good control effect on most gramineous weeds, especially the malignant weed Aegilops tauschii, which has a very close genetic relationship with wheat, and other herbicides on the market have poor control effect. Therefore, mesosulfuron-methyl occupies an important position in the wheat herbicide market and has a broad development prospect in the future.

[0004] Although sulfonylurea herbicides are lowly toxic to mammals, some sulfonylurea herbicides have a long soil residual period, and the residual period is prolonged with the increase of soil pH, and in alkaline soil, the residual period can even last for 2-3 years, which causes serious phytotoxicity to the succeeding crops. In recent years, crop phytotoxicity caused by improper use of sulfonylurea herbicides has occurred from time to time in China, which has caused serious losses to agriculture. Therefore, sulfonylurea herbicide degradation detoxification enzymes and genes thereof have important application value in the research and development of sulfonylurea herbicide residue bioremediation technology. In addition, sulfonylurea herbicide degradation detoxification genes can also be applied to the construction of sulfonylurea herbicide-resistant transgenic crops.

[0005] TsmE is an esterase identified from bacteria Hansschlegelia zhihuaiae S113, which catalyzes the ester bond cleavage of sulfonamide herbicide ester structure COOR to generate the corresponding sulfonamide acid without herbicidal activity. TsmE can catalyze the de-esterification detoxification of a plurality of small molecular weight sulfonamide herbicides such as thifensulfuron, metsulfuron, bensulfuron, mesosulfuron and tribenuron. However, TsmE cannot catalyze the de-esterification of large molecular sulfonamide herbicides such as mesosulfuron-methyl and iodosulfuron-methyl-sodium, so it cannot detoxify these large molecular sulfonamide herbicides, and its application value is greatly limited. SUMMARY

[0006] Therefore, the technical problem to be solved by the present application is to provide a TsmE mutant protein and a gene thereof, a recombinant expression vector containing the gene and a recombinant genetically engineered bacterium for solving the problem that the current sulfonamide herbicide hydrolytic enzyme TsmE cannot catalyze the hydrolysis and de-esterification detoxification of large molecular sulfonamide herbicides such as mesosulfuron-methyl and iodosulfuron-methyl-sodium. Compared with the wild-type sulfonamide herbicide hydrolytic enzyme TsmE, the TsmE mutant protein provided by the present application can degrade large molecular sulfonamide herbicides such as mesosulfuron-methyl and iodosulfuron-methyl-sodium.

[0007] To solve the above technical problems, one of the technical solutions adopted by the present application is that the present application provides a sulfonamide herbicide hydrolytic enzyme TsmE mutant, the amino acid sequence of which is shown in SEQ ID NO. 4; specifically, the 80th position of SEQ ID NO. 2 is replaced by arginine, the 81st position is replaced by alanine, the 176th position is replaced by alanine, the 178th position is replaced by valine, the 182nd position is replaced by arginine, and the 329th position is replaced by alanine.

[0008] The present application also provides a gene encoding the sulfonamide herbicide hydrolytic enzyme mutant, the nucleotide sequence of which is shown in SEQ ID NO. 3.

[0009] The present application provides a recombinant expression vector encoding the mutant gene.

[0010] The recombinant expression vector is preferably a prokaryotic expression vector pET-29a(+).

[0011] The present application also provides a genetically engineered bacterium carrying the mutant gene.

[0012] The genetically engineered bacterium is preferably Escherichia coli BL21 (DE3) as a starting strain.

[0013] The beneficial effects of the present application are as follows:

[0014] The application takes sulfonylurea herbicide hydrolytic enzyme TsmE as a starting template, and through a directional evolution technology, a mutant M6 (P80R / Y81A / G176A / S178V / G182R / F329A) having deesterification activity on macromolecular sulfonylurea herbicides such as mesosulfuron-methyl and methyl iodosulfuron sodium salt is obtained. The specific enzyme activity of the mutant M6 on macromolecular sulfonylurea herbicides mesosulfuron-methyl and methyl iodosulfuron sodium salt is 0.10 and 0.15 U / mg, respectively. The mutant and the coding gene thereof can be used for constructing sulfonylurea herbicide-resistant transgenic crops, and can also be used for removing sulfonylurea herbicides in soil and water, and has very important theoretical and application value. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 Growth condition of recombinant strain E. coli DH10B (ilvG + M6) on a screening plate containing 5 μM mesosulfuron-methyl

[0016] Figure 2 Degradation of recombinant strain E. coli DH10B (ilvG + M6) on mesosulfuron-methyl

[0017] Figure 3 Construction map of mutant M6 recombinant expression vector

[0018] Figure 4 SDS-PAGE map of mutant M6. Wherein, lane 1 is protein Marker, and the other lanes are wild type TsmE and mutant M6 in turn DETAILED DESCRIPTION

[0019] Example 1. Directional evolution screening of TsmE mutant having deesterification activity on mesosulfuron-methyl

[0020] 1.1 Synthesis of wild type tsmE gene

[0021] The nucleotide sequence (1197 bp) of the synthesized tsmE gene is shown in the sequence listing as SEQ ID NO. 1, which encodes the TsmE protein (398 amino acids) shown in the sequence listing as SEQ ID NO. 2. The synthesized tsmE is cloned into the pUC57 vector, the recombinant vector is named as pUC-tsmE, and then transformed into E. coli DH5α.

[0022] 1.2 Construction of tsmE gene mutation library

[0023] Using plasmid pUC-tsmE as template, primer 1 and primer 2 were used to perform error-prone PCR, so that tsmE gene was mutated due to random base mismatch. The error-prone PCR product was cloned into pMD19-T vector, and the enzyme-ligation product was heat-shocked and transformed into E. coli DH10B (ilvG + ) which was sensitive to mesosulfuron-methyl. The random mutation library was plated on LB plates added with 100 mg L -1 Amp, 200 mg L -1 IPTG and 200 mg L -1 X-Gal, and incubated at 37°C overnight.

[0024] The primer and error-prone PCR reaction system were as follows:

[0025] Primer 1: ATGGAAACCGATAAAAAAACCG,

[0026] Primer 2: TCAGCTTTCGTTCTGATCTAAG,

[0027] The error-prone PCR amplification system was as follows:

[0028]

[0029] PCR amplification procedure:

[0030] a. 95°C pre-denaturation for 3 min;

[0031] b. 94°C denaturation for 0.5 min, 52°C annealing for 1.0 min, 72°C extension for 1.5 min, for 30 cycles;

[0032] c. 72°C extension for 10 min, and cooling to room temperature.

[0033] 1.3 Screening of tsmE gene mutation library

[0034] The transformed product in the above mutation library was inoculated into basic salt medium (added with 5 g L -1 of glucose, 200 mg L -1 of valine, 200 mg L -1 of leucine and 100 mg L -1 of ampicillin) containing mesosulfuron-methyl at a concentration of 5 μM, and incubated for 3 days. Since E. coli DH10B (ilvG + ) was very sensitive to high concentration of mesosulfuron-methyl, the resistance gene could convert mesosulfuron-methyl into an acid product which was non-toxic to bacteria, thereby relieving the sensitivity of E. coli DH10B (ilvG +) growth inhibition, thus the above mutant library was screened by high-throughput screening based on this principle. After several rounds of screening, a TsmE mutant M6 with de-esterification activity to mesosulfuron-methyl was obtained, and the recombinant strain E. coli DH10B (ilvG+, M6) carrying the mutant M6 gene could grow on a screening plate with 5 μM mesosulfuron-methyl added, while the growth of the recombinant strain E. coli DH10B (ilvG+, tsmE) carrying the wild-type tsmE gene was obviously inhibited, as shown in Figure 1 Figure 1. + The degradation of mesosulfuron-methyl by the recombinant strain E. coli DH10B (ilvG Figure 2 , M6) is shown in Figure 2.

[0035] The basic salt medium formula is as follows: 1.0 g of NH4Cl, 0.5 g of NaCl, 1.5 g of K2HPO4, 0.5 g of KH2PO4, 0.2 g of MgSO4·7H2O, and deionized water to 1 L. The solid medium is added with 2% agar powder.

[0036] 1.4 Obtaining the mutant resistant gene

[0037] Sequencing of the mutant M6 gene found that its nucleotide sequence was mutated from CAT to GAGC at positions 239-242, from G to C at position 527, from TC to GT at positions 532-533, from G to A at position 544, and from TT to GC at positions 985-986; which resulted in the mutation of its amino acid sequence from proline and tyrosine to arginine and alanine at positions 80-81, from glycine, serine and glycine to alanine, valine and arginine at positions 176, 178 and 182, and from phenylalanine to alanine at position 329.

[0038] Example 2 High-efficiency expression of the mutant M6 gene in BL21 (pET-29a(+))

[0039] 2.1 Construction of a bacterial expression vector and obtaining of a recombinant microorganism

[0040] The nucleotide sequence (1215 bp) of the M6 gene with Nde I / Hind III restriction sites was synthesized, as shown in SEQ ID NO. 5 in the sequence listing. The synthesized M6 gene was cloned into the pUC57 vector to obtain the recombinant vector pUC-M6. The recombinant vector pUC-M6 and the pET-29a(+) plasmid were subjected to enzyme digestion with restriction enzymes Nde I and Hind III, respectively, and the enzyme digestion system was as follows:

[0041] 10 x M Buffer 5 μL

[0042] Nde I (10 U μL -1 ) 2.0 μL

[0043] Hind III (10 U μL -1 ) 2.0 μL

[0044] DNA (pUC-M6 or pET-29a(+) plasmid) 30 μL

[0045] ddH2O 11 μL

[0046] 37°C for 12 h, then the cut M6 gene fragment was ligated with the cut bacterial expression vector pET-29a(+), and the constructed recombinant expression vector was named pET29a-M6, as shown in Figure 3 . The recombinant expression vector was transformed into the expression host BL21(DE3) to obtain the recombinant microorganism BL21(M6).

[0047] 2.3 Expression and purification of TsmE mutant

[0048] BL21(M6) was inoculated in LB medium and cultured at 37°C, 200 rpm on a shaker until OD 600nm was 0.6, IPTG was added to a concentration of 0.4 mM, and the culture was induced at 16°C for 12 hours. 100 ml of bacterial solution was centrifuged to collect the bacterial cells, which were washed twice with PBS (50 mM, pH 7.4), resuspended in 10 ml of PBS buffer, and broken by ultrasonic waves (Auto Science, UH-650B ultrasonic processor, 30% intensity) for 7 minutes. The supernatant was collected by centrifugation at 12000 rpm for 30 min, and the TsmE mutant was purified by nickel ion affinity chromatography column. The purified enzyme was subjected to protein electrophoresis, as shown in Figure 4 .

[0049] Example 3, determination of TsmE mutant enzyme activity

[0050] Enzyme activity reaction system (1 mL): in 50 mM PBS buffer (pH 7.4), add purified TsmE mutant enzyme and 100 μM sulfonylurea herbicide substrate. Each reaction was timed from the addition of the reaction enzyme, and after 10 min of reaction at 30°C, an equal volume of acetonitrile was added to terminate the reaction. Without adding enzyme as a control, the reduction of each sulfonylurea substrate was detected by high performance liquid chromatography (HPLC) to determine the activity of the mutant. The HPLC conditions are as follows: 3000 Titanium System high performance liquid chromatograph; Thermo Scientific Syncronis C18 Chromatographic column (5 μm, 250 mm x 4.6 mm); mobile phase: acetonitrile / water (60 / 40, v / v) with 0.5% acetic acid in water; flow rate 1 mL / min; injection volume 20 μL; detection wavelength 230 nm and 255 nm; column temperature 40 °C. One enzyme activity unit is defined as the amount of enzyme that catalyzes the hydrolysis of 1.0 μmol of substrate in 1 min at pH 7.4 and 30 °C.

[0051] The results of enzyme activity determination showed that mutant M6 had de-esterification activity on macromolecular sulfonylurea herbicides mesosulfuron-methyl and iodosulfuron-methyl-sodium, and the specific enzyme activities were 0.10 and 0.15 U / mg, respectively.

[0052] The microbial sources used in the above examples are as follows: Escherichia coli DH5α was purchased from Baobiotechnology (Dalian) Co., Ltd., Escherichia coli high expression vector pET-29a(+) was purchased from Novegen Co., and expression host bacteria Escherichia coli BL21(DE3) was purchased from Shanghai Yingjun Biotechnology Co., Ltd.

Claims

1. A sulfonylurea herbicide hydrolyzing enzyme TsmE mutant, characterized in that, The amino acid sequence of the mutant is shown as SEQ ID NO.

4.

2. A gene encoding the sulfonylurea herbicide hydrolyzing enzyme TsmE mutant of claim 1.

3. The gene according to claim 2, characterized in that The sequence is shown as SEQ ID NO.

3.

4. A recombinant expression vector containing the gene of the sulfonylurea herbicide hydrolyzing enzyme TsmE mutant of claim 2 or 3.

5. The recombinant expression vector according to claim 4, which is obtained by inserting the sulfonylurea herbicide hydrolyzing enzyme mutant gene according to claim 2 or 3 into the site between I and Nde I and Hind III of pET-29a (+).

6. A genetically engineered bacterium containing the gene of claim 2 or 3.

7. Use of the sulfonylurea herbicide hydrolyzing enzyme TsmE mutant of claim 1 in degrading sulfonylurea herbicides.

8. Use according to claim 7, characterized in that, Use of the sulfonylurea herbicide hydrolyzing enzyme TsmE mutant of claim 1 in removing sulfonylurea herbicide residues in soil and water.

9. Use of the gene of claim 2 or 3 in constructing transgenic crops resistant to sulfonylurea herbicides.

10. Use of the gene of claim 2 or 3 in preparing reagents for degrading sulfonylurea herbicides.

11. Use according to claim 10, characterized in that, 11. Use of the gene of claim 2 or 3 in preparing reagents for degrading macromolecular sulfonylurea herbicides; the macromolecular sulfonylurea herbicides are selected from the group consisting of mesosulfuron-methyl and iodosulfuron-methyl-sodium.

12. Use of the recombinant expression vector of claim 4 or the genetically engineered bacterium of claim 6 in preparing reagents for degrading sulfonylurea herbicides.

13. Use according to claim 12, characterized in that, 13. Use of the recombinant expression vector of claim 4 or the genetically engineered bacterium of claim 6 in preparing reagents for degrading macromolecular sulfonylurea herbicides; the macromolecular sulfonylurea herbicides are selected from the group consisting of mesosulfuron-methyl and iodosulfuron-methyl-sodium.

Images