Establishment and Identification of Nucleic Acid Aptamers Specific for Capsaicin and Its Screening Method

Abstract

The present invention relates to a nucleic acid aptamer that specifically recognizes capsaicin and the establishment and identification of its screening method, belonging to the field of food safety biotechnology. The present invention for the first time discloses a nucleic acid aptamer that specifically binds to capsaicin based on Capture-SELEX. The specific screening method is to screen the capsaicin aptamer using the Capture-SELEX technology. After 15 rounds of screening, the screening process is monitored by high-throughput sequencing. Two aptamers, Cap-1 and Cap-2, are obtained through high-throughput sequencing analysis. Then, the isothermal titration calorimetry (ITC) and fluorescence quenching method are used to analyze the affinity, sensitivity, and specificity of the two obtained aptamers. Finally, a nucleic acid aptamer Cap-1 that can recognize capsaicin with high affinity and specificity is obtained. The aptamer prepared by the present invention has broad application prospects in detecting the capsaicin content in food.

Description

Technical Field

[0001] The present invention belongs to the field of food safety biotechnology, and particularly relates to the establishment and identification of a nucleic acid aptamer specifically recognizing capsaicin and a screening method thereof. Background Art

[0002] Edible vegetable oil is widely used in household cooking and the food industry and is one of the important foods in daily life. Edible vegetable oil provides humans with some important components with nutritional and health effects, but not limited to essential fatty acids (EFA), vitamins, minerals, etc.

[0003] Waste cooking oil will be contaminated by various chemical toxins and there is a certain carcinogenic risk. These chemical toxins include hydrocarbons, aflatoxin B1, heavy metal ions, etc. At present, the difficulty in detection lies in the fact that it is very difficult to establish a general system for identifying waste cooking oil.

[0004] According to relevant research, conventional detection needs to combine multiple indicators as the basis for judgment to determine whether an oil sample is waste cooking oil. Although the detection of these indicators can improve the identification efficiency, it requires professional equipment or complex sample pretreatment. Capsaicin is the main chemical component of chili peppers and has the characteristics of good fat solubility, high stability, and high boiling point. It is widely used and consumed as a food additive. Traditional vegetable oils do not contain capsaicin. Relevant research shows that during the refining process of high-boiling non-edible waste oils, due to the lipophilicity and non-removability of capsaicin, capsaicin can stably exist in inedible oils. Therefore, capsaicin can be used as a specific target for the identification of waste cooking oil and can also be used as a standard basis for measuring spiciness. Therefore, it is very necessary to establish a method for rapidly detecting capsaicin to solve the problem of adulteration of edible oils caused by waste cooking oil.

[0005] There are various analytical methods for capsaicin in chili peppers. For example, spectrophotometry, gas chromatography (GC), high-performance liquid chromatography (HPLC), gas chromatography-mass spectrometry (GC-MS), and liquid chromatography-mass spectrometry (LC-MS) are commonly used methods for determining capsaicin content. The spectrophotometry method has poor selectivity, and the ultraviolet high-performance liquid chromatography detection method has insufficient sensitivity. The gas chromatography (GC), high-performance liquid chromatography (HPLC), gas chromatography-mass spectrometry (GC-MS), and liquid chromatography-mass spectrometry (LC-MS) methods have relatively high sensitivity and high specificity. However, these methods require expensive instruments and high requirements for chromatographic column sample pretreatment processes, which limit the universality of these methods. Electrochemical methods have the characteristics of high sensitivity and strong specificity, and different electrodes are used to detect capsaicin. However, most sensors for capsaicin detection use nanomaterials or polymers to complexly modify the electrodes, resulting in cumbersome operations and time-consuming detections. In addition, most methods use traditional cylindrical electrodes, making it difficult for the food industry sector to achieve the effect of portable equipment.

[0006] Aptamers are oligonucleotide fragments screened from single-stranded nucleic acid libraries. Through the systematic evolution of ligands by exponential enrichment (SELEX) technology, aptamers can be screened from a large number of random sequence libraries in vitro. Aptamers can fold into a thermodynamically stable three-dimensional structure through hydrogen bonds, van der Waals forces, and electrostatic interactions, thus specifically binding to targets such as small molecules, metal ions, bacteria, proteins, and enzymes. Although aptamers are generally regarded as "chemical antibodies", they are completely different from immunoglobulins. First of all, aptamers can be obtained by in vitro screening technology and have a relatively short screening cycle. The screening does not rely on experimental animals, and the sequence can be directly chemically synthesized after being obtained. Compared with traditional antibodies, aptamers have high stability, reversible denaturation, can recognize broad-spectrum epitopes, and are not restricted by immunogenicity. Secondly, aptamers are easy to obtain and have low synthesis costs. Finally, aptamers are easy to chemically modify and reuse. Given the above advantages, aptamers have been widely used in many fields in recent years, such as medical diagnosis and treatment, drug research and development and application, detection of environmental pollutants, biochemical analysis and imaging, and food detection. Summary of the Invention

[0007] Aiming at the deficiencies of the prior art, the present invention provides a nucleic acid aptamer that specifically recognizes capsaicin and the establishment and identification of its screening method. The method of the present invention uses a library immobilization technique to immobilize the library on magnetic beads with streptavidin. Then, a series of steps such as incubation, separation, PCR amplification, purification, and enzymatic digestion are carried out using capsaicin as a target. After multiple rounds of screening, high-throughput sequencing is performed, and tools such as NUPACK and MEGA are used to perform homology analysis and secondary structure analysis on the candidate aptamers, so as to accurately select two aptamers, Cap-1 and Cap-2, for affinity analysis, and the fluorescence complementary strand quenching method is used to analyze the sensitivity and specificity of aptamer Cap-1. This aptamer can be used for the detection of illegally used kitchen waste oil on the market to achieve the purpose of rapid and accurate detection.

[0008] The present invention is achieved through the following technical solutions:

[0009] The first object of the present invention is to provide a nucleic acid aptamer that specifically recognizes capsaicin, and the nucleotide sequences of the nucleic acid aptamer are shown in SEQ ID No.1 and SEQ ID No.2.

[0010] The second object of the present invention is to provide a screening method for a nucleic acid aptamer that specifically recognizes capsaicin, including the following steps:

[0011] (1) Preparation of magnetic nanoparticles for immobilizing the screening library

[0012] After mixing and incubating the capture probe with the random single-stranded DNA library, streptavidinylated magnetic nanoparticles are added and further mixed and incubated to obtain magnetic nanoparticles for immobilizing the screening library through the connection between biotin and streptavidin;

[0013] (2) Incubation of magnetic nanoparticles for immobilizing the screening library with capsaicin

[0014] To the magnetic nanoparticles for immobilizing the screening library obtained in step (1), capsaicin is added and mixed and incubated to obtain ssDNA bound to capsaicin;

[0015] (3) PCR amplification

[0016] The ssDNA obtained in step (2) is used as a template for PCR amplification;

[0017] (4) Preparation of single strand

[0018] The amplification product of step (3) is prepared into single-stranded DNA to obtain the next-round screening library;

[0019] (5) Multiple rounds of screening

[0020] Replace the random single-stranded DNA library in step (1) with the library for the next round of screening described in step (4), and repeat the multi-round screening according to steps (1)-(4);

[0021] (6) High-throughput sequencing

[0022] After the screening is completed, perform high-throughput sequencing analysis on the screening library obtained in step (4) to detect the affinity of the obtained sequence for capsaicin, and obtain a nucleic acid aptamer for specifically recognizing capsaicin.

[0023] In one embodiment of the present invention, the structure of the random single-stranded DNA library is 5’-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3’; the N40 represents a sequence composed of 40 arbitrary nucleotide bases linked together.

[0024] In one embodiment of the present invention, in step (1), the avidinylated magnetic nanoparticles are prepared by the following method:

[0025] S1. Mix the aminated magnetic nanoparticles with a glutaraldehyde solution to convert the aminated magnetic beads into carboxylated magnetic beads. After reacting in the dark, perform solid-liquid separation to take the solid phase, and disperse it in a buffer solution to obtain a cross-linked magnetic bead solution;

[0026] S2. Incubate and react the cross-linked magnetic bead solution obtained in S1 with avidin, perform solid-liquid separation to take the solid phase, and obtain the avidinylated magnetic nanoparticles.

[0027] In one embodiment of the present invention, in step S1, the aminated magnetic nanoparticles are prepared by the following method:

[0028] Add anhydrous sodium acetate, ferric trichloride hexahydrate and 1,6-hexanediamine to an organic solvent, heat and mix to form a colloidal solution, then transfer it to a reaction kettle with a polytetrafluoroethylene lining and heat to react to obtain aminated magnetic nanoparticles.

[0029] In one embodiment of the present invention, in step (4), the multi-round screening increases the screening pressure by reducing the library concentration.

[0030] In one embodiment of the present invention, in step (6), after the screening is completed, perform high-throughput sequencing analysis on the third, sixth, ninth, twelfth and fifteenth round screening libraries obtained in step (4) to detect the affinity and specificity of the obtained sequence for capsaicin, and obtain a nucleic acid aptamer for specifically recognizing capsaicin.

[0031] The third object of the present invention is to provide a composition containing the nucleic acid aptamer described above.

[0032] The fourth object of the present invention is to provide a kit containing the nucleic acid aptamer and / or the composition described above.

[0033] The fifth object of the present invention is to provide the application of the composition, the kit or the nucleic acid aptamer described above in detecting capsaicin.

[0034] In one embodiment of the present invention, a functional group or molecule is connected to the 5'-end or 3'-end of the nucleic acid aptamer sequence.

[0035] In one embodiment of the present invention, the functional group or molecule is selected from fluorescein, phosphate group, biotin, amino group, mercapto group, digoxin, radioisotope, enzyme label or nano-luminescent material

[0036] The technical principle of the present invention:

[0037] Based on the Capture-SELEX technology, the present invention screens and enriches capsaicin aptamers (the flow chart is as Figure 1 shown), monitors the enrichment degree of aptamers through high-throughput sequencing and terminates the screening rounds, explores the secondary structure and homology relationship of the selected aptamers, and uses isothermal titration calorimetry (ITC) and fluorescence quenching method to identify the affinity and specificity of the aptamers. This invention provides a theoretical and application basis for the detection of capsaicin in food by this nucleic acid aptamer.

[0038] The technical solution of the present invention has the following advantages:

[0039] (1) Compared with antibodies, the aptamers of the present invention can be screened in vitro, with a short screening period, convenient synthesis, easy to label various functional groups and reporter molecules, stable properties, and can be stored for long-term use.

[0040] (2) The high-throughput sequencing method of the present invention can significantly improve the screening efficiency of aptamers. By observing the frequency change of candidate aptamers in high-throughput sequencing, the termination round of screening can be intuitively seen, saving the time and cost of verifying the affinity of aptamers.

[0041] (3) The present invention for the first time provides a nucleic acid aptamer Cap-1 that specifically binds to capsaicin screened based on the Capture-SELEX technology. This nucleic acid aptamer has the characteristics of high affinity, strong specificity, stable structure, convenient synthesis and low cost, thereby realizing the identification of kitchen waste oil, meeting the basic requirements of edible oil safety detection, improving the identification ability of food supervision departments and the catering industry for kitchen waste oil, improving the food safety of the people, and helping to restore the healthy competition in the edible oil market. Description of the Drawings

[0042] In order to make the content of the present invention easier to be clearly understood, the following further details the present invention according to specific embodiments of the present invention in combination with the accompanying drawings, where

[0043] Figure 1 is the flow chart of the directional screening of capsaicin nucleic acid aptamers based on the Capture-SELEX method of the present invention;

[0044] Figure 2 is the phylogenetic tree analysis of the top fifty candidate aptamer sequences after screening and high-throughput sequencing of the present invention;

[0045] Figure 3-A is the secondary structure diagram of the candidate aptamer Cap-1 of capsaicin of the present invention;

[0046] Figure 3-B is the secondary structure diagram of the candidate aptamer Cap-2 of capsaicin of the present invention;

[0047] Figure 4 is the affinity saturation binding curve of the candidate aptamers Cap-1 and Cap-2 of capsaicin of the present invention; where Figure 4 -A and Figure 4 -B, the abscissa is time, the ordinate is thermal power, and the peak area between the bottom and the top of the peak is the total heat released in each titration; Figure 4 -C and Figure 4 -D, the abscissa is the molar ratio of the titrant to the sample solution, and the ordinate is the total heat generated by the titration;

[0048] Figure 5 is the linear relationship diagram of the binding sensitivity between capsaicin at different concentrations and the nucleic acid aptamer Cap-1 of the present invention;

[0049] Figure 6 is the binding specificity analysis of capsaicin and the nucleic acid aptamer Cap-1 based on fluorescence quenching detection of the present invention;

[0050] Figure 7 is the circular dichroism spectrum diagram before and after the binding of the nucleic acid aptamer Cap-1 and capsaicin of the present invention. Detailed implementation manners

[0051] The following further illustrates the present invention in combination with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the embodiments cited do not limit the present invention.

[0052] Example 1

[0053] 1. Design of random library (ssDNA), primer and capture probe

[0054] SELEX initial library (ssDNA library): 5’-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3’, where N40 represents a sequence composed of 40 arbitrary nucleobases linked together.

[0055] The primers required for PCR amplification are obtained based on the ssDNA library sequence.

[0056] Forward primer: 5’-AGCAGCACAGAGGTCAGATG-3’;

[0057] Reverse primer: 3’-phosphate-TTCACGGTAGCACGCATAGG-5’, with the 3’ end labeled with a phosphate group.

[0058] Capture probe: 5’-bioton-CATCTGACCTCTGTG-3’, with the 5’ end labeled with biotin, which binds to streptavidin on magnetic beads.

[0059] 2. Preparation of avidinylated magnetic nanoparticles, immobilization of the library, and directed screening of capsaicin nucleic acid aptamers based on the Capture-SELEX method

[0060] (1) Preparation of avidinylated magnetic nanoparticles: Weigh 2.0 g of anhydrous sodium acetate, 1.0 g of ferric chloride hexahydrate, and 6.5 g of 1,6-hexanediamine (C 6 H 16 N 2 ) and add them to a round-bottom flask containing 30 mL of ethylene glycol. Continuously stir with a magnetic stirrer under the heating condition of a 50 °C oil bath. After the solution forms a relatively uniform colloidal solution, carefully transfer it to a 100 mL reaction kettle with a polytetrafluoroethylene liner, and place it under a high-temperature condition of 198 °C for 6 h. After the reaction is completed, turn off the power of the oven, open the oven door, let the reaction kettle cool naturally to room temperature, and then carefully transfer the liquid in the reaction kettle to a 100 mL beaker. Wash the reaction kettle with anhydrous ethanol multiple times and collect it in the above beaker. Use ultrasound to disperse the black particles collected in the beaker, then magnetically separate and collect, remove the supernatant, wash the black magnetic particles with deionized water again, ultrasonically disperse, and remove the supernatant. Repeat the washing with water and ethanol successively 4 times, and dry the obtained black solid at 50 °C for 10 h. Finally, grind the dried black solid particles into powder with an agate mortar to obtain amino-functionalized Fe 3 O 4Magnetic nanoparticles black powder. Exactly take 10 mg of the above black powder, dissolve it in 5 mL of 10 mmol / L PBS and disperse it by ultrasonic for 15 min. Then add 1.25 mL of 25% glutaraldehyde solution, mix evenly and slowly oscillate at 130 rpm in the dark at room temperature for 2 h. After the reaction, use magnetic separation to remove the supernatant, and wash the obtained magnetic beads with 10 mM PBS three times (3 mL each time). Resuspend the magnetic beads in 4.875 mL of 10 mM PBS, add 125 μL of 5.0 mg / mL avidin (the final concentration of avidin is 125 μg / mL) after ultrasonic for 15 min. This solution is slowly incubated at 130 rpm at room temperature for 12 h. After the reaction, remove the supernatant, and wash the cross-linked magnetic beads with PBS three times (the supernatant and washing solution are collected for standby to determine the ultraviolet to characterize the avidin connection situation). The washed cross-linked magnetic beads are dissolved in 5 mL of PBS solution to prepare an avidinylated magnetic nano-solution with a concentration of 2 mg / mL, and store it at 4 °C for standby.

[0061] (2) Fixation of the ssDNA library: First, mix the bridging sequence bBS and the oligonucleotide ssDNA library at a molar ratio of 2:1. After the system is heated at 95 °C for 10 min, incubate it at 37 °C and 130 rpm for 2 h. Then mix bBS-ssDNA and the magnetic nanoparticle at a mass ratio of 1:300, and incubate it at 37 °C and 130 rpm for 1 h to reach a dynamic equilibrium state. In this way, the oligonucleotide hybridization sequence with biotin label and the avidin-coated magnetic bead solution are connected through the biotin-avidin interaction to fix the screening library on the magnetic beads. Then, use magnetic separation and wash the magnetic beads with PBS buffer solution multiple times to remove the non-specifically adsorbed oligonucleotide sequences. The washed magnetic beads are dispersed with BB solution for convenient incubation with the target for screening.

[0062] (3) Directional screening of the aptamer for capsaicin based on Capture-SELEX: The total system for the first round of screening is 400 μL. Incubate 5 μg of capsaicin and 1 nmol of the fixed oligonucleotide ssDNA library at 37 °C and 130 rpm for 2 h, which is the experimental group. In this way, the free capsaicin competitively dissociates the specifically bound nucleic acid aptamer from the magnetic beads to form a capsaicin / ssDNA complex and remains in the supernatant. Then, use magnetic separation to remove the magnetic beads, and use the collected supernatant as a template for PCR amplification.

[0063] (4) PCR amplification: Use the supernatant obtained from the first round of screening as a template for PCR amplification. The PCR system is 1 μL of template, 1 μL of each of the upstream and downstream primers with a concentration of 5 μM, and Mg with a concentration of 5 mM 2+1 μL of dNTP, 5 μL of 10× PCR buffer, 0.5 μL of Taq enzyme, and sterile ultrapure water was added to make up to 50 μL. For PCR amplification, it was first denatured at 94°C for 5 min, then denatured at 94°C for 30 s, annealed at 61°C for 30 s, extended at 72°C for 30 s. After cycling for the optimal number of cycles optimized by PCR, it was extended at 72°C for 2 min, and finally cooled at 4°C.

[0064] (5) Verification by polyacrylamide gel electrophoresis: The PCR products were electrophoresed on an 8% non-denaturing polyacrylamide gel. The digested products were electrophoresed on an 8% denaturing polyacrylamide gel (containing 7 M urea). The gel imaging system was used for imaging to observe whether the electrophoretic bands were single and bright and whether the bands were at the position of 80 bp.

[0065] (6) Purification and digestion of PCR products: The obtained PCR products were purified using a purification kit to remove other substances in the PCR reaction system. The purified nucleic acid concentration was measured using a NanoDrop-2000 micro ultraviolet-visible spectrophotometer to determine the approximate digestion time required. The purified product was taken, 1 / 10 volume of digestion buffer and an appropriate amount of exonuclease were added and mixed evenly, and the reaction was carried out at 37°C until complete digestion. After digestion, the enzyme was inactivated at 75°C for 10 min to stop the digestion reaction.

[0066] (7) Purification of digested products: 1 / 10 volume of 3 mol / L NaAC was added to the digested products and mixed evenly, then 2 volumes of absolute ethanol were added and mixed evenly, and it was placed in a -20°C refrigerator for overnight precipitation. The precipitated solution was centrifuged at 14000 rpm for 15 min at 4°C. After discarding the supernatant, 200 μL of 70% ethanol was added to the system, mixed evenly and centrifuged at 14000 rpm for 15 min at 4°C, and the supernatant was discarded. It was placed in a 50°C oven for drying, and 50 μL of 1× TE buffer was added to dissolve it as the library for the next round of screening.

[0067] As the number of screening rounds increases, the screening pressure is gradually increased to obtain aptamer sequences with good affinity and specificity. Except for the library addition amount of 1 nmol in the first round of screening, starting from the second round of screening, as the number of screening rounds increases, the library addition amount is gradually reduced by 10 pmol.

[0068] 3. High-throughput sequencing and sequence analysis

[0069] The supernatant after incubation with the target in the third, sixth, ninth, twelfth, and fifteenth round of screening processes was used as a template for PCR amplification respectively. The amplified products were sent to Sangon Biotech (Shanghai) Co., Ltd. for high-throughput sequencing to obtain the enrichment rate of each aptamer. The termination round can be determined by the enrichment rate of each round. As shown in Table 1, the enrichment trends of Cap-1 and Cap-2 are obvious. Secondly, the sequences obtained from the 15th round of high-throughput sequencing were analyzed using the MegaX software, and the top fifty sequences with the highest enrichment rates were subjected to homology analysis. As Figure 2 shown, the nucleic acid aptamers of Cap-1 and Cap-2 have good homology. The results in Table 1 are consistent with the Figure 2 results. Therefore, these two aptamers, Cap-1 and Cap-2, were selected as candidate aptamers. Then, the Nupack online tool was used to analyze the secondary structures of the aptamers with better affinity (as shown in Figure 3). Both Cap-1 and Cap-2 have relatively stable stem-loop structures, so as to conduct affinity and specificity analyses on the candidate aptamers Cap-1 and Cap-2 subsequently.

[0070] Table 1 Partial candidate aptamer sequences obtained by high-throughput sequencing and their enrichment trends

[0071]

[0072]

[0073] 4. Analysis of the affinity of candidate aptamers by isothermal titration calorimetry (ITC)

[0074] The PEAQ-ITC (Malvern, UK) was used to analyze the affinity of the candidate aptamers Cap-1 and Cap-2 at 25°C. Capsaicin and its corresponding candidate aptamers were both dissolved in BB buffer (pH 7.4) containing 10% DMSO. The aptamer was heated and denatured at 95°C for 10 min and then cooled to room temperature for half an hour. The samples were degassed before the reaction. The concentration of the aptamer was 100 μM, and the concentration of the target was 10 μM. In the control group, the target solution was replaced with the same volume of buffer to measure the dilution heat. The binding experiment selected a model of 13 injections, including an initial delay of 60 s, a first injection of 0.4 μL, and a delay of 150 s. The subsequent 12 injections were 4 μL each, with an interval of 150 s. The obtained data was processed using the MicroCal PEAQ-ITC Analysis software.

[0075] The results showed that the aptamer (Cap-1) has the optimal binding ability to capsaicin. The sequence of aptamer Cap-1 is as follows:

[0076] AGCAGCACAGAGGTCAGATGTGACCGGCTTAGGCCTTTTCTTTGACTTGTCTTGAATTGGCCTATGCGTGCTACCGTGAA(SEQ ID No.1).

[0077] The ITC analysis results of the aptamer (Cap-1) are as Figure 4 -A and Figure 4 -C shown. It can be seen from Figure 4 -A and Figure 4 -C that the nucleic acid aptamer Cap-1 has good binding ability to capsaicin.

[0078] In addition, as Figure 4 -B and Figure 4 -D shown, the homologous sequence Cap-2 of the aptamer Cap-1 also has good binding performance with capsaicin.

[0079] The sequence of the aptamer Cap-2 is as follows: AGCAGCACAGAGGTCAGATGACCGTCATAGGTCGCCTATTGATTCTTCTCAATTGGTGTTCCTATGCGTGCTACCGTGAA(SEQ ID No.2).

[0080] Table 2 Kd values of aptamers Cap-1 and Cap-2 based on ITC analysis

[0081]

[0082] Example 2 Analysis of the affinity and specificity of the nucleic acid aptamer Cap-1 based on fluorescence complementary strand quenching competition method

[0083] Dilute the FAM-fluorescently labeled nucleic acid aptamer Cap-1 and the complementary strand modified with a quenching group (Dabcyl) in a ratio of 1:2.5 in terms of molar concentration with BB buffer containing 10% methanol. The concentration of the FAM-fluorescently labeled aptamer is 100 nM. After denaturing at 95 °C for 5 min in a ratio of 1:1 by volume, incubate at 37 °C for 30 min, then add the same volume of the target to make the final concentration 200 ng / mL (capsaicin, dihydrocapsaicin, zearalenone, ochratoxin A, vomitoxin, aflatoxin B1, mixed standard). After incubating at 37 °C for 30 min, measure the fluorescence intensity at an excitation wavelength of 490 nm and an emission wavelength of 518 nm before and after adding the target with a multifunctional microplate reader, and record them as F 1 and F 2 , and take △F = F 2 -F 1 as the ordinate to analyze the fluorescence recovery after adding the analyte under different ratio conditions. AsFigure 5 As shown, the detection range of the fluorescence complementary strand quenching competition method is 3.7 ng / mL to 1000 ng / mL, and there is a good linear relationship in the detection range of 3.7 ng / mL to 62.5 ng / mL (y = 2.1272x + 75.11305, R 2 = 0.98783). The detection limit calculated according to S / N is 1.62 ng / mL, and RSD = 3.44.

[0084] Using the same method to evaluate the specificity of the above-mentioned aptamer (Cap-1), 100 nM aptamer was immobilized on magnetic beads and incubated with 200 ng / mL co-existing substances (zearalenone, ochratoxin A, vomitoxin, aflatoxin B1, mixed standard) and structural analogs (dihydrocapsaicin) respectively. After magnetic separation, the fluorescence intensity in the supernatant was measured respectively, and then the specificity of the aptamer was evaluated. The results are as Figure 6 shown. The relative fluorescence intensity of the nucleic acid aptamer Cap-1 with several other co-existing substances remains almost unchanged, and it has a cross-reaction with capsaicinoids, indicating that the nucleic acid aptamer Cap-1 can be used as a universal aptamer for detecting capsaicinoids in kitchen waste oil.

[0085] FAM-modified nucleic acid aptamer Cap-1: 5’-FAM-AGCAGCACAGAGGTCAGATGTGACCGGCTTAGGCCTTTTCTTTG ACTTGTCTTGAATTGGCCTATGCGTGCTACCGTGAA-3’

[0086] Complementary strand modified with quenching group: 5’-CATCTGACCTCTGTG-Dabcyl-3’

[0087] Example 3 Circular Dichroism Characterization

[0088] Heat 10 μM nucleic acid aptamer Cap-1 to 95 °C for 10 min and then cool it to room temperature so that the aptamer can form a stable three-dimensional structure. Take 200 μL of the above aptamer solution and incubate it with 5 μM capsaicin solution in a 4 mL BB buffer system containing 10% DMSO (37 °C, 30 min) to form a stable complex. At the same time, two systems containing only aptamer and only target are used as blank control groups under the same conditions. Use a 1 cm quartz cuvette to measure the circular dichroism signal of the above solution. The scanning range is 230 nm to 320 nm, the scanning speed is 100 nm / min, the bandwidth is 1 nm, and the number of scans is 3 times. The results of circular dichroism are as Figure 7As shown, after the nucleic acid aptamer Cap-1 binds to capsaicin, a negative peak and a positive peak are formed at 251 nm and 278 nm respectively. Compared with before binding, both the positive peak and the negative peak show a slight blue shift, and the intensities of both the positive peak and the negative peak are significantly enhanced, further indicating that Cap-1 has a high affinity for capsaicin.

[0089] Obviously, the above embodiments are merely examples given for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to enumerate all the implementation manners here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention.

Claims

1. Nucleic acid aptamers that specifically recognize capsaicin, characterized in that, the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID No.1 or SEQ ID No.

2.

2. A composition, characterized in that, the composition contains the nucleic acid aptamer described in claim 1.

3. A kit, characterized in that, the kit contains the nucleic acid aptamer described in claim 1 and / or the composition described in claim 2.

4. Use of the composition according to claim 2, the kit according to claim 3 or the nucleic acid aptamer according to claim 1 in detecting capsaicin.

5. The use according to claim 4, characterized in that, a functional group or molecule is linked to the 5'-end or 3'-end of the nucleic acid aptamer sequence.

6. The use according to claim 5, characterized in that, the functional group or molecule is selected from fluorescein, phosphate group, biotin, amino group, mercapto group, digoxin, radioisotope, enzyme label or nano-luminescent material.

Images