A method for detecting mutant genes based on circulating tumor DNA and application thereof
By designing specific primers and using UMI multiplex PCR amplification for circulating tumor DNA detection, the problem of insufficient sensitivity and specificity in ctDNA detection has been solved, achieving highly sensitive and specific MRD monitoring and reducing the risk of recurrence in patients with solid tumors.
Patent Information
- Application Number
- CN202211388280.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-08
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2042-11-08
AI Technical Summary
Current technologies lack sufficient sensitivity and specificity in detecting circulating tumor DNA (ctDNA), making it difficult to effectively monitor minimal residual disease in patients with solid tumors, leading to a high risk of recurrence.
A mutation gene detection method based on circulating tumor DNA was adopted. Through specific primer design and UMI multiplex PCR amplification, combined with next-generation sequencing technology, target enrichment and high-sensitivity detection of free DNA were achieved.
It improves the sensitivity and specificity of detection, achieving a sensitivity of over 70% and a specificity of over 90% in MRD monitoring, effectively identifying patients at high risk of recurrence.
Smart Images

Figure CN115961002B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection technology, specifically to a method for detecting mutated genes based on circulating tumor DNA and its application. Background Technology
[0002] The concept of MRD (Minimal Residual Disease) originates from the state where trace amounts of leukemia cells remain in the patient's body after leukemia has achieved complete remission through induction chemotherapy (or bone marrow transplantation). In the context of solid tumors, it generally refers to a situation where, after radical treatment (such as surgical resection), traditional imaging or laboratory methods cannot detect lesions, but molecular markers originating from cancer cells can be detected through liquid biopsy. The detection of MRD in a solid tumor patient indicates the persistent presence of cancer cells in the body, and a higher risk of cancer recurrence.
[0003] Detection of circulating tumor DNA (ctDNA) shows great promise for the direct and real-time detection of recurrence-related lesions (MRDs). When tumor cells die and break down, their DNA is released into the bloodstream, forming ctDNA. Therefore, theoretically, detecting ctDNA in the blood can capture traces of minute residual lesions that are not visible on imaging, thereby identifying patients at high risk of recurrence. This has significant clinical implications for assessing disease status, evaluating treatment efficacy, predicting recurrence, and guiding treatment. The timing and detection sensitivity of MRD monitoring are particularly important for recurrence prediction.
[0004] In recent years, clinical data and evidence for ctDNA-MRD based on NGS technology have been increasing. The technical approaches to ctDNA-MRD detection in solid tumors are mainly divided into two categories: Tumor-informed assays and Tumor-uninformed assays. Tumor-informed assays sequence the primary tumor tissue to identify the patient's specific genomic variant profile, and then design primers to customize panels for personalized ctDNA detection and analysis. Tumor-uninformed assays do not require primary tumor tissue; they rely solely on a pre-selected set of primers / probes designed with a fixed panel associated with the cancer type for ctDNA detection and analysis.
[0005] Immobilized panels do not require customization for each patient, have low development costs, and only require a mature liquid capture platform, but require more data and may produce false negatives; customized panels have high development costs and long development cycles, and there are technical barriers to primer design, but sequencing costs are low, effective sites are easy to find, and detection sensitivity and accuracy are higher. Summary of the Invention
[0006] In view of this, the purpose of this invention is to provide a method for detecting mutated genes based on circulating tumor DNA, which can effectively improve the sensitivity and specificity of tumor gene mutation sites.
[0007] To solve the above-mentioned technical problems, the present invention provides the following technical solutions:
[0008] This invention provides a method for detecting mutated genes based on circulating tumor DNA, the method comprising the following steps:
[0009] After constructing a single-stranded library from cell-free DNA, the library is amplified by PCR using specific primers. The resulting amplification products can be sequenced and analyzed to detect gene mutations. The specific primers are designed based on the preliminary mutation sites obtained from whole-exome sequencing information of genomic DNA from patient tissues and blood.
[0010] Preferably, the cell-free DNA is extracted from the blood of a cancer patient after surgery.
[0011] Preferably, the tumor includes lung cancer, colorectal cancer, breast cancer, bladder cancer, and esophageal cancer.
[0012] Preferably, the PCR amplification is a UMI-based multiplex PCR amplification.
[0013] Preferably, the multiplex PCR includes two rounds of amplification, wherein the primer structure for the first round of amplification is overhang-UMI(NNWNNW)-GSP1 / GSP2.
[0014] Preferably, the sequencing is second-generation sequencing, and the data analysis includes data quality control and analysis.
[0015] This invention provides a molecular residual lesion detection kit based on circulating tumor DNA, the kit comprising the primers used in the first round of amplification described above.
[0016] Preferably, the primer design principles include: primer length between 15 and 25 bp; primer GC content between 50% and 75%; amplicon length between 80 and 120 bp; and strict pairing of the bases at the 3' end of the primer.
[0017] The present invention also provides the application of the above-described detection method in the detection of MRD.
[0018] This invention provides a method for detecting mutated genes based on circulating tumor DNA (MRD). It employs a customized panel technology approach, using single-stranded library construction to initially amplify cell-free DNA, followed by target enrichment via UMI-based multiplex PCR, effectively improving detection sensitivity and specificity. Experimental results demonstrate that the method described in this invention can simultaneously analyze multiple gene mutations in the same patient, exhibiting a sensitivity of over 70% and a specificity of over 90% in terms of mutated allele ratio (AF), showing promising application prospects in MRD monitoring. Attached Figure Description
[0019] Figure 1 Comparison of fragment distribution between two ctDNA standards of Jingliang Gene and cell-free DNA in real plasma.
[0020] Figure 2 This is a peak diagram of 2100 after two rounds of multiplex PCR.
[0021] Figure 3 This is a flowchart of the experimental process of the present invention. Detailed Implementation
[0022] This invention provides a method for detecting mutated genes based on circulating tumor DNA, the method comprising the following steps:
[0023] After constructing a single-stranded library from cell-free DNA, the library is amplified by PCR using specific primers. The resulting amplification products can be sequenced and analyzed to detect gene mutations. The specific primers are designed based on the preliminary mutation sites obtained from whole-exome sequencing information of genomic DNA from patient tissues and blood.
[0024] In this invention, the cell-free DNA is preferably extracted from the blood of tumor patients after surgery; the tumor preferably includes lung cancer, colorectal cancer, breast cancer, bladder cancer, and esophageal cancer. This invention does not specifically limit the extraction method of the cell-free DNA. In a specific embodiment of this invention, the cell-free DNA is preferably extracted using the QIAamp Circulating Nucleic Acid Kit. In this invention, the whole-exome sequencing is preferably performed using the AIExome V2 Plus kit; the average sequencing depth of the tissue genomic DNA is preferably 500X, and the average sequencing depth of the blood sample is preferably 200X.
[0025] In this invention, the PCR amplification is preferably based on UMI multiplex PCR amplification; the multiplex PCR includes two rounds of amplification, and the primer structure for the first round of amplification is preferably overhang-UMI(NNWNNW)-GSP1 / GSP2. In this invention, the primer design contains a special UMI structure, unlike the single-tube multi-target region (high + low cycling system) of conventional multiplex PCR, where primers interfere with each other and produce non-specific amplification. This invention adopts a strategy of combining single primers (low + high cycling system) after amplification, which avoids the risk of false positive amplification while ensuring the true original molecular state. The preferred primer design principles in this invention include: primer length between 15 and 25 bp; primer GC content between 50% and 75%; amplicon length between 80 and 120 bp; strict base pairing at the 3' end of the primer; and annealing temperature between 60°C and 66°C.
[0026] In this invention, the sequencing is preferably next-generation sequencing, the next-generation sequencing platform is preferably Ilumina Novaseq 6000, and the data analysis preferably includes data quality control and analysis.
[0027] In this invention, the single-stranded library preparation is preferably performed according to the ABclonal Scale ssDNA-seq Lib Prep Kit. In this invention, the PCR amplification enzyme after single-stranded library preparation is preferably 2×KAPAHiFi HotStart ReadyMix, and the amplification primers after single-stranded library preparation are preferably universal primers that match subsequent multiplex PCR.
[0028] This invention provides a molecular residual lesion detection kit based on circulating tumor DNA, the kit comprising the primers used in the first round of amplification described above.
[0029] The present invention also provides the application of the above-described detection method in the detection of MRD.
[0030] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be described in detail below with reference to the embodiments, but these should not be construed as limiting the scope of protection of this invention.
[0031] Unless otherwise specified, the following embodiments are all conventional methods.
[0032] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0033] Example 1
[0034] To verify the detection method of the present invention, the following experiments were conducted using lung cancer standard as a sample.
[0035] 1. Cell-free DNA standard (Jingliang Lung Cancer ctDNA Standard Kit, catalog number GW-OCTM009), with VAF values of wild type, 1%, 0.1%, and 0.05% respectively; specific mutation site frequency information is shown in Table 1 below:
[0036] Table 1. Known Information about Free DNA Standards
[0037]
[0038]
[0039] 2. Primer design
[0040] Based on the locations of the six mutation sites in Table 1, primers were designed within the conserved regions of the template DNA; primer length was between 15 and 25 bp; primer GC content was between 50% and 75%; and the Tm value was closest to 72℃; amplicon length was between 80 and 120 bp; secondary structures within the primers were avoided, as was complementarity between the two primers, especially at the 3' end; the bases at the 3' end of the primers were strictly paired; and the annealing temperature was between 60℃ and 66℃.
[0041] 2.1 Single-stranded library construction and amplification primers
[0042] The primer sequences are as follows:
[0043] ShortprimerF:GTTCAGACGTGTGCTCTTCCGATCT(SEQ ID
[0044] NO.1)
[0045] Short primer R: CCTACACGACCGCTTCCGATCT(SEQ ID
[0046] NO.2).
[0047] 2.2 Specific primers for the first round of multiplex PCR, with a special overhang designed at the 5' end. Each primer pair has the structure overhang-UMI(NNWNNW)-GSP1 / GSP2, where N is any one of A, G, C, and T, and W is A or T.
[0048] Primer sequences are shown in Table 2 below:
[0049] Table 2 Primer sequences
[0050]
[0051] 2.3 Primers for second-round multiplex PCR amplification
[0052] The primer sequences are as follows:
[0053] Primer P5:
[0054] AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC(SEQ IDNO.15);
[0055] Primer P7:
[0056] CAAGCAGAAGACGGCATACGAGATTCTCCAGCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA(SEQID NO.16);
[0057] 3. The library construction kit was the ABclonal Scale ssDNA-seq Lib Prep Kit, the PCR amplification enzyme was 2×KAPAHiFi HotStart ReadyMix, and the amplification primers were universal primers that matched the subsequent multiplex PCR. The specific reagent components are shown in Table 3 below:
[0058] Table 3 Reagents for Library Construction
[0059] Reagent Name Specification Low-EDTA TE 5mL T7 buffer 96μL T7 Adapter (UMI) 60μL T7 Enzyme Mix II 72μL 2X Synthesis Mix 1.032mL Synthesis Reagent 72μL T5 Buffer II 192μL T5 AdapterⅡ 120μL Ligase Mix 72μL 2×KAPA HiFi HotStart ReadyMix 6.25mL Short primer F (10μm) 100μL Short primer R (10μm) 100μL
[0060] 3.1 Thermal denaturation pretreatment
[0061] 3.1.1 Take 30 ng of 0.1% cfDNA lung cancer standard into a PCR tube and dilute it with Low-EDTATE to a total volume of 15 μL.
[0062] 3.1.2 After the PCR instrument stabilizes at 95°C, place the PCR tube into the PCR instrument and incubate at 95°C for 2 minutes. Immediately place the PCR tube on ice to cool and let it stand for 2 minutes.
[0063] 3.2T7 Tailing & Ligation
[0064] 3.2.1 Prepare the T7 Tailing & Ligation premix according to Table 4 below. It needs to be prepared before pretreatment and placed on ice for no more than 20 minutes.
[0065] Table 4 T7 Tailing & Ligation Premix
[0066]
[0067]
[0068] 3.2.2 Take 25 μL of LT7 Tailing & Ligation premix and add it to the PCR tube of the pretreated DNA sample placed on ice (step 3.1.2). Mix well by pipetting and then centrifuge briefly to bring the reaction solution to the bottom of the tube.
[0069] 3.2.3 Follow the procedure in Table 5 below, place the PCR tubes in the PCR instrument (heated lid 105℃), and perform T7 Tailing & Ligation.
[0070] Table 5 Reaction Procedure
[0071] temperature time 37℃ 15min 95℃ 2min 4℃ Hold
[0072] 3.3Second Strand Synthesis Reaction
[0073] 3.3.1 Prepare the Second Strand Synthesis Reaction premix according to the system in Table 6 below;
[0074] Table 6. S econd Strand Synthesis Reaction Premix
[0075] reagents volume 2XSynthesisMix 43μL SynthesisReagent 3μL Total volume 46μL
[0076] 3.3.2 Take 46 μL of Second Strand Synthesis Reaction premix and add it to T7 Tailing & Ligated mix (step 3.2.3). Use a pipette to mix it thoroughly by blowing and then centrifuging briefly to bring the reaction solution to the bottom of the tube.
[0077] 3.3.3 Follow the program settings in Table 7 below, place the PCR tubes in the PCR instrument (heated lid 105℃), and perform the two-strand synthesis reaction:
[0078] Table 7. Procedure for the second chain synthesis reaction
[0079]
[0080]
[0081] 3.3.4 Remove the DNA clean beads from 2-8℃ in advance, allow them to equilibrate to room temperature, and vortex or shake to mix before use;
[0082] 3.3.5 After the Second Strand Synthesis Reaction is complete, add 105 μL of DNA cleanbeads (1.2X) to the product and mix thoroughly by pipetting.
[0083] 3.3.6 Let stand at room temperature for 5 minutes, then transfer to a magnetic rack for 5 minutes until the solution becomes clear. Carefully discard the supernatant.
[0084] 3.3.7 Hold the centrifuge tube on the magnetic rack, add 200 μL of 80% ethanol, let stand for 30 seconds, and discard all supernatant;
[0085] 3.3.8 Repeat 3.3.7, wash the magnetic beads again with 80% ethanol, and use a 10μL pipette tip to completely absorb the residual liquid;
[0086] 3.3.9 Dry the magnetic beads for 2-3 minutes. After the alcohol has completely evaporated, remove the PCR tube from the magnetic rack, add 21 μL of Low-EDTATE, mix by pipetting, and then let it stand at room temperature for 2 minutes.
[0087] 3.3.10 Place the PCR tube on a magnetic rack and let it stand at room temperature until the solution becomes clear. Carefully aspirate 20 μL of the supernatant into another new PCR tube for later use.
[0088] 3.4T5 Adapter Ligation
[0089] 3.4.1 Prepare the T5 Adapter Ligation reaction system according to Table 8 below. Add the following components in sequence, mix them by pipetting, and then centrifuge briefly to bring the reaction solution to the bottom of the tube.
[0090] Table 8 T5 Adapter Ligation Reaction System
[0091]
[0092]
[0093] Note: T5 Buffer II and T5 Adapter II premixed solutions can be prepared in advance. However, T5 Buffer II, T5 Adapter II and Ligase Mix should not be premixed to avoid self-linking reaction of the connector.
[0094] 3.4.2 Set the procedure according to Table 9 below, place the PCR tube in the PCR instrument (with the heating function of the hot cap off, or do not close the hot cap), and perform the connection reaction.
[0095] Table 9 Connection Reaction Procedure
[0096] temperature time 25℃ 15min 4℃ Hold
[0097] 3.4.3 Remove the DNA clean beads from 2-8℃ in advance, let them stand to equilibrate to room temperature, and vortex or shake to mix before use.
[0098] 3.4.4 After the ligation reaction is complete, add 40 μL of DNA cleanbeads (1.0X) to the ligation product and mix by pipetting.
[0099] 3.4.5 Let stand at room temperature for 5 minutes, then transfer to a magnetic rack for 5 minutes until the solution becomes clear. Carefully discard the supernatant.
[0100] 3.4.6 Hold the centrifuge tube on the magnetic rack, add 200 μL of 80% ethanol, let stand for 30 seconds, and discard all supernatant.
[0101] 3.4.7 Repeat 3.4.6, wash the magnetic beads again with 80% ethanol, and use a 10μL pipette tip to completely aspirate any remaining liquid.
[0102] 3.4.8 After drying the magnetic beads for 2-3 minutes, remove the PCR tube from the magnetic rack, add 21 μL of Low-EDTATE, mix by pipetting, and then let it stand at room temperature for 2 minutes.
[0103] 3.4.9 Place the PCR tube on a magnetic rack and let it stand at room temperature until the solution becomes clear. Carefully aspirate 20 μL of the supernatant into another new PCR tube for later use.
[0104] 3.5 PCR amplification
[0105] 3.5.1 Prepare the PCR reaction system according to Table 10 below:
[0106] Table 10 PCR Reaction System
[0107]
[0108]
[0109] 3.5.2 Use a pipette to mix the mixture by blowing, then briefly centrifuge to bring the reaction solution to the bottom of the tube and place it in the PCR instrument.
[0110] 3.5.3 Perform the PCR reaction according to the procedure in Table 11 below.
[0111] Table 11 PCR reaction procedure
[0112]
[0113] 3.5.4 Remove the DNA cleanbeads from 2-8℃ in advance, allow them to stand and equilibrate to room temperature, and vortex or shake to mix before use.
[0114] 3.5.5 After the reaction is complete, add 50 μL of DNA clean beads (1.0X) to the PCR reaction product and mix by pipetting.
[0115] 3.5.6 Let stand at room temperature for 5 minutes, then transfer to a magnetic rack for 5 minutes until the solution becomes clear. Carefully discard the supernatant.
[0116] 3.5.7 Hold the centrifuge tube on the magnetic rack, add 200 μL of 80% ethanol, let stand for 30 seconds, and discard all supernatant.
[0117] 3.5.8 Repeat 3.5.7, wash the magnetic beads again with 80% ethanol, and use a 10μL pipette tip to completely absorb the residual liquid.
[0118] 3.5.9 Dry the magnetic beads for 2-3 minutes. After the alcohol has completely evaporated, add 21 μL of Low-EDTA TE and mix by blowing.
[0119] 3.5.10 Let stand at room temperature for 2 min, then on a magnetic rack for 1 min, until the solution becomes clear. Carefully pipette 20 μL of the library into another centrifuge tube.
[0120] 3.6 Document QC
[0121] 3.6.1 Take 1 μL of Qubit dsDNAHS Assay Kit for quantification.
[0122] 3.6.2 Take 1 μL and dilute it to 10 ng / μL, then use Agilent 2100 to detect fragment size distribution.
[0123] 3.6.3 Store the library (Lib DNA) at -20°C or use it for the next step of the experiment.
[0124] 4. Single-site specific amplification
[0125] 4.1 Use the 6 pairs of UMI-specific primers in Table 2 for single-tube amplification, and prepare the reaction solution according to the reaction system in Table 12 below:
[0126] Table 12 Reaction System
[0127] Components Final concentration Volume (μl) Q5 Hot Start High-Fidelity 2X Master Mix 1X 5 Lib DNA (30ng) - 1 Specific primers F+R (0.5μM-4μM) 0.05μM-0.4μM 1 <![CDATA[H2O]]> - 3 Final System - 10
[0128] 4.2 Perform PCR amplification according to the reaction procedure in Table 13 below:
[0129] Table 13 Reaction Procedure
[0130]
[0131] 4.3 Remove the DNA cleanbeads from 2-8℃ in advance, let them stand to equilibrate to room temperature, and vortex or shake to mix before use;
[0132] 4.4 After the reaction is complete, the reaction products from the 6 tubes are mixed into one tube and transferred to a new centrifuge tube;
[0133] 4.5 Add 90 μl of DNA cleanbeads (1.5×) to the 60 μl mixture and mix thoroughly by pipetting.
[0134] 4.6 Let stand at room temperature for 5 minutes, then transfer to a magnetic rack for 5 minutes until the solution becomes clear. Carefully discard the supernatant.
[0135] 4.7 Hold the centrifuge tube on the magnetic rack, add 200 μL of 80% ethanol, let stand for 30 seconds, and discard all supernatant;
[0136] 4.8 Repeat the previous step, wash the magnetic beads again with 80% ethanol, and use a 10μL pipette tip to completely absorb the residual liquid;
[0137] 4.9 Dry the magnetic beads for 2-3 minutes. After the alcohol has completely evaporated, add 19 μL Low-EDTA TE and mix thoroughly by blowing.
[0138] 4.10 Let stand at room temperature for 2 min, then on a magnetic rack for 1 min, until the solution becomes clear. Carefully aspirate 16.8 μL of the library into a new PCR tube.
[0139] 5. Multiple index expansion;
[0140] 5.1 Prepare the reaction solution according to the reaction system in Table 14 below:
[0141] Table 14 Reaction System
[0142]
[0143] 5.2 Perform PCR amplification according to the reaction procedure in Table 15 below:
[0144] Table 15 Reaction Procedure
[0145]
[0146]
[0147] 5.3 Remove the DNA cleanbeads from 2-8℃ in advance, let them stand to equilibrate to room temperature, and vortex or shake to mix before use;
[0148] 5.4 After the reaction is complete, add 40 μl of DNA cleanbeads (1×) to the reaction product and mix well by pipetting.
[0149] 5.5 Let stand at room temperature for 5 minutes, then transfer to a magnetic rack for 5 minutes until the solution becomes clear. Carefully discard the supernatant.
[0150] 5.6 Hold the centrifuge tube on the magnetic rack, add 200 μL of 80% ethanol, let stand for 30 seconds, and discard all supernatant;
[0151] 5.7 Repeat the previous step, wash the magnetic beads again with 80% ethanol, and use a 10μL pipette tip to completely absorb the residual liquid;
[0152] 5.8 Dry the magnetic beads for 2-3 minutes until the alcohol has completely evaporated, then add 20 μL of Low-EDTA TE and mix thoroughly by pipetting.
[0153] 5.9 Let stand at room temperature for 2 min, then on a magnetic rack for 1 min, until the solution becomes clear. Carefully aspirate 18 μL of the library into a new PCR tube.
[0154] 6-Document QC
[0155] 6.1 Take 1 μL of Qubit dsDNAHS AssayKit for quantification.
[0156] 6.2 Take 1 μL and use Agilent 2100 to detect fragment size distribution. The results are as follows: Figure 2 .
[0157] 6.3 The library was sequenced, and the raw data obtained from the sequencing were subjected to QC quality control and processing: Trim, Mapping, blast, and UMI clustering were used to remove duplicates, and the mutation frequency results are shown in Table 16.
[0158] Table 16 Sequencing Results
[0159]
[0160]
[0161]
[0162]
[0163]
[0164] *For sites where predict_vaf is 0, the mutation frequency ≥ 0.0002 is considered a false positive. False positive rate = false positive sites * / all sites = 6.94% = 5 / 72;
[0165] For sites where *predict_vaf is 0.001, the mutation frequency <0.0002 indicates a false negative. The false negative rate = false negative sites * / all sites = 15.3% = 11 / 72.
[0166] according to Figure 2As can be seen, the actual detected size of the standard using the method described in this invention is consistent with the theoretical amplicon size of the standard, and there are no other impurity peaks. This indicates that the method described in this invention has good specificity and methodological reliability and stability.
[0167] The VAFs detected by the detection method of the present invention in Table 16 were compared with the known VAFs of the standards (Table 1) to evaluate the detection capability of the method of the present invention for SNV mutation sites. Using the statistical data of 12 replicates at 6 sites of the standards in Table 16 of the present invention, the detection method of the present invention was calculated to have a sensitivity of 84.7% (61 / 72) on the mutant allele ratio (AF), and a specificity of 93.1% (1-5 / 72) on the sites with an expected mutation rate of 0.1% (positive results are filled in gray in Table 17).
[0168] In this invention, the positive criterion for mutation sites is: a mutation frequency of 0.02% is used as the threshold; a value greater than this is positive, otherwise it is negative.
[0169] The specific judgment results are shown in Table 17 below:
[0170] Table 17 Results of positive mutation site assessment
[0171]
[0172]
[0173] Example 2
[0174] After screening each patient using WES, 10-20 tumor mutation sites were identified. Multiplex PCR amplification of the present invention was performed on these sites. Clonal hematopoietic interference was removed by using the patient's blood leukocyte gDNA detection value as background. ctDNA in plasma samples of lung cancer patients before surgery was detected to test the performance of the present invention in detecting positive lung cancer by ctDNA.
[0175] I. Clinical Samples
[0176] Ten mL of peripheral blood was collected from 10 lung cancer patients before surgery, as well as tissue specimens obtained during surgery, for mutation detection. All patients were pathologically diagnosed.
[0177] II. Sample Processing
[0178] After centrifugation to separate plasma from peripheral blood samples, cell-free DNA samples were extracted and dissolved in 35 μL of nuclease-free water. The extracted samples were quantified using Qubit, with concentrations ranging from 0.5 to 5 ng. 30 ng was used for subsequent experiments.
[0179] III. Experimental Procedure
[0180] 1. Genomic DNA was extracted from patient tissue and blood samples (tissue extraction was performed using the QIAamp DNA FFPE Kit; blood extraction was performed using the QIAamp DNA Blood mini Kit).
[0181] 2. Extracting cell-free DNA from postoperative blood samples of patients (QIAamp Circulating Nucleic Acid Kit)
[0182] 3. Whole exome sequencing (AIExomeV2 Plus library preparation kit), with an average sequencing depth of 500X for tissue samples and 200X for blood samples, performed using an Illumina NovaSeq 6000 sequencer.
[0183] 4. Based on the sequencing data, perform site screening and primer design.
[0184] 5. Subsequent experimental procedures are detailed in sections 3.1 to 6.3 of Example 1.
[0185] 6. The patient's clinical information is shown in Table 18 below:
[0186] Table 18 Patient Clinical Information
[0187] Patient disease type Clinical pathological types Patient pathology information Patient 1 lung cancer adenocarcinoma T1b, N0, M0, IA2 period Patient 2 lung cancer adenocarcinoma T1b,N0,M0,IA2 Patient 3 lung cancer Adenosquamous carcinoma T2b, N2, M1c, IVB stage Patient 4 lung cancer squamous cell carcinoma T2a, N1, M0, Phase IIB Patient 5 lung cancer Minimally invasive adenocarcinoma T1a,N0,M0, stage IA1 Patient 6 lung cancer squamous cell carcinoma T3, N2, M0, Phase IIIB Patient 7 lung cancer adenocarcinoma T1b, N0, M0, IA2 period Patient 8 lung cancer brain metastases from lung adenocarcinoma T2b, N2, M1b, IVA period Patient 9 lung cancer adenocarcinoma T1b, N0, M0, IA2 period Patient 10 lung cancer adenocarcinoma T2a, N2, M0, Stage IIIA
[0188] The criteria for determining a positive ctDNA test are as follows: among all the mutation sites selected for each patient, a mutation frequency greater than 0.02% is considered a positive site; if each patient has at least 2 positive sites, then the test is positive at the sample level.
[0189] Sequencing data from 10 clinical samples are shown in Tables 19-28 (the site mutation frequency was calculated under the condition that the average effective sequencing depth was greater than 100,000X; sites marked with * are sites that were positive for leukocyte detection, and if ctDNA was positive at these sites, they were not included in the total number of positive sites):
[0190] Table 19 Sequencing data of clinical samples from Patient 1
[0191]
[0192]
[0193] Leukocyte-positive sites: 0
[0194] ctDNA positive sites: 0
[0195] Table 20 Sequencing data of clinical samples from Patient 2
[0196]
[0197]
[0198] Leukocyte-positive sites: 0
[0199] ctDNA positive sites: 0
[0200] Table 21 Sequencing data of clinical samples from Patient 3
[0201]
[0202] Leukocyte positive sites: 1
[0203] ctDNA positive sites: 13
[0204] Table 22 Sequencing data of clinical samples from Patient 4
[0205]
[0206] Leukocyte-positive sites: 0
[0207] ctDNA positive sites: 2
[0208] Table 23 Sequencing data of clinical samples from Patient 5
[0209]
[0210]
[0211] Leukocyte positive sites: 1
[0212] ctDNA positive sites: 2
[0213] Table 24 Sequencing data of clinical samples from patient 6
[0214]
[0215]
[0216] Leukocyte-positive sites: 0
[0217] ctDNA positive sites: 19
[0218] Table 25 Sequencing data of 7 clinical samples from patients
[0219]
[0220]
[0221] Leukocyte positive sites: 1
[0222] ctDNA positive sites: 2
[0223] Table 26 Sequencing data of 8 clinical samples from patients
[0224]
[0225]
[0226] Leukocyte positive sites: 1
[0227] ctDNA positive sites: 11
[0228] Table 27 Sequencing data of clinical samples from patient 9
[0229]
[0230] Leukocyte positive sites: 1
[0231] ctDNA positive sites: 1
[0232] Table 28 Sequencing data of clinical samples from Patient 10
[0233]
[0234] Leukocyte positive sites: 2
[0235] ctDNA positive sites: 5
[0236] Based on the above results, it can be seen that in the same patient, leukocyte and ctDNA tests were performed. One patient (patient 10) was positive for leukocytes, with a specificity of 90% (9 / 10). Excluding the leukocyte positive sites, among the 10 patients, 7 patients (excluding patients 1, 2, and 9) had positive ctDNA sites greater than 2, with a detection sensitivity of 70% (7 / 10).
[0237] The above description is merely an embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural or procedural transformations made based on the content of the present invention specification, or direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of the present invention.
Claims
1. A primer set for detecting molecular residual lesions based on circulating tumor DNA, characterized in that, The primer set includes primers for the first round of amplification and primers for the second round of amplification; The primers used in the first round of amplification were a combination of those targeting EGFR L858R, EGFR T790M, KRAS A146T, KRAS G12D, NRAS Q61K, and PIK3CA E545K. The primer sequences for EGFR L858R are shown in SEQ ID NO.3 to SEQ ID NO.4; the primer sequences for EGFR T790M are shown in SEQ ID NO.5 to SEQ ID NO.
6. The primer sequences for the KRAS A146T site are shown in SEQ ID NO.7~SEQ ID NO.8; the primer sequences for the KRAS G12D site are shown in SEQ ID NO.9~SEQ ID NO.10; the primer sequences for the NRAS Q61K site are shown in SEQ ID NO.11~SEQ ID NO.12; and the primer sequences for the PIK3CA E545K site are shown in SEQ ID NO.13~SEQ ID NO.
14. The sequences of the primers for the second round of amplification are shown in SEQ ID NO.15~SEQ ID NO.16.
Citation Information
Patent Citations
Detection primer for detecting lung cancer gene by using free DNA (Deoxyribose Nucleic Acid) and kit of detection primer
CN114058706A
Methods and primer sets for high throughput PCR sequencing
EP2746405A1