Application of high-sensitivity multiplex methylation detection technology
The MMDEC method, employing two rounds of PCR amplification using Rooptag primers and universal tag primers, combined with probe detection, solves the problems of nonspecific hybridization and artifacts in multiplex PCR, achieving highly sensitive and accurate detection of multiplex methylated DNA, suitable for the auxiliary diagnosis and monitoring of tumors.
Patent Information
- Application Number
- CN202410055993.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-15
- Publication Date
- 2026-01-16
AI Technical Summary
Existing DNA methylation detection methods suffer from nonspecific hybridization and artifacts in multiplex PCR, making it difficult to amplify multiple targets simultaneously with high sensitivity and accuracy under the same conditions. Furthermore, they are costly and cannot meet the needs of large-scale clinical application.
The multiplex high-sensitivity MMDEC method was employed, using target-specific looptag primers and universal tag primers for two rounds of PCR amplification. Combined with probe detection, methylated and non-methylated DNA sites were distinguished through sample purification and rapid transformation, thereby improving amplification efficiency and specificity.
It achieves highly sensitive and accurate detection of multiple methylated DNA in samples such as blood, and is suitable for auxiliary diagnosis, efficacy assessment and prognostic monitoring of tumors, with high clinical application value.
Smart Images
Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
TECHNICAL FIELD
[0001] The present invention belongs to the field of disease diagnostic markers, and more particularly, to a method for high sensitivity detection of multiplex DNA methylation targets, comprising: constructing an oligonucleotide comprising target-specific multiplex Rooptag primers capable of complementary binding to a plurality of tumor-specific hypermethylated CG island target DNA and a universal tag primer binding to the specific multiplex Rooptag primers; performing exponential amplification on each target DNA by using the specific multiplex Rooptag primers as primary primers to obtain a multiplex amplification product; performing uniform amplification on the obtained multiplex amplification product by using the oligonucleotide (capable of complementary binding to the linearly amplified target DNA) of the universal tag primer as secondary primers; and detecting whether the amplification product exists by a probe. BACKGROUND
[0002] Cancer has become the number one killer threatening human life and health. Especially many cancer patients are diagnosed at an advanced stage, which brings great difficulty to treatment, and even many cancer patients have lost the ideal treatment opportunity. As we all know, early detection and early treatment are very important for the prognosis of cancer patients. This shows the importance of early tumor screening. If the early screening of cancer can be effectively improved, the five-year survival rate of cancer patients will be greatly improved.
[0003] In recent years, many new tumor markers have been discovered and used in clinical diagnosis. Traditional tumor markers are mainly some hormones, enzymes, proteins and other cell secretions, such as carcinoembryonic antigen (CEA), alpha-fetal protein (AFP) and the like, which can be used as markers for many tumors such as gastric cancer and liver cancer. Squamous cell carcinoma associated antigen (SCCA) can be used to detect cervical squamous cell carcinoma, carbohydrate antigen 125 (CA125) can be used as a marker for cervical cancer, prostate specific antigen (PSA) can be used as a marker for prostate cancer, NSE (neuron-specific enolase) can be used to detect small cell lung cancer and glioma, and HCG (human chorionic gonadotropin) can be used to detect male testicular tumors and female malignant trophoblastic tumors (gestational trophoblastic disease, invasive mole, choriocarcinoma). Although this type of tumor marker is still used in clinical practice, it is mainly used for tumor recurrence monitoring and efficacy evaluation, but its sensitivity and accuracy cannot meet the clinical needs of early tumor screening. The occurrence and development of cancer is a complex pathological process involving multiple genes, multiple stages, long formation and extreme complexity. In theory, molecular pathological changes occur throughout the entire process of carcinogenesis, so they should be used as indicators for monitoring the occurrence and development of cancer. The key to using molecular biology techniques for early diagnosis of cancer is to determine markers that are specific and sensitive for early diagnosis of cancer and high-sensitivity detection techniques in samples with low tumor molecular marker content such as blood.
[0004] The most promising technology for early cancer screening is liquid biopsy technology, including CTC detection, cfDNA / ctDNA detection, exosome detection, and circulating RNA detection.
[0005] Among them, cfDNA / ctDNA detection is divided into two routes: gene mutation detection and methylation detection. It is difficult to use gene mutation as a marker for early cancer screening, and there is a certain false positive rate.
[0006] In contrast, the occurrence and development of cancer are accompanied by changes in DNA methylation patterns, including DNA hypomethylation of retroelement, centromere, and proto-oncogene, as well as methylation of key gene regulatory elements related to gene suppression (such as distal enhancer and promoter transcription initiation overlap region).
[0007] Most importantly, there are wide differences in DNA methylation patterns between normal cells and cancer cells.
[0008] Most CpG sites in the normal genome carry 5mC, and distal enhancer elements and CpG island regions are resistant to the activity of methyltransferase DNMT.
[0009] The main feature of cancer cells is the loss of methylation genetic modification in the overall range, while abnormal methylation sites appear in the enhancer and promoter regions.
[0010] This change in methylation distribution leads to the inhibition of tumor suppressor gene expression and the increase in proto-oncogene expression, further promoting the occurrence and development of tumors, which is an important link between DNA methylation and cancer.
[0011] Research results also show that gene methylation detection is more suitable as a marker for early cancer screening.
[0012] DNA methylation is one of the earliest discovered and most in-depth studied epigenetic regulation mechanisms. Broadly speaking, DNA methylation refers to the chemical modification process in which a specific base on a DNA sequence acquires a methyl group through covalent bonding with S-adenosyl methionine (SAM) as the methyl donor under the catalytic action of DNA methyltransferase (DNMT). This DNA methylation modification can occur at sites such as C-5 of cytosine, N-6 of adenine, and G-7 of guanine. The DNA methylation involved in general research mainly refers to the methylation process occurring at the 5th carbon atom of cytosine in CpG dinucleotide, and its product is called 5-methylcytosine (5-mC), which is the main form of DNA methylation in eukaryotes such as plants and animals, and is the only form of DNA methylation found in mammals. As a relatively stable modification state, DNA methylation can be inherited to the newly born offspring DNA along with the replication process of DNA under the action of DNA methyltransferase, and is an important epigenetic mechanism. Liquid biopsy technology is a technology for diagnosing and predicting tumors by detecting circulating tumor cells or circulating tumor DNA in blood as the detection target.
[0013] The region of abnormal integration of CpG is called CpG island. The term "CpG island" refers to a site with a length of 0.2-3 kb and a C+G content of more than 50% and a CpG ratio of more than 5%. There are about 45,000 CpG islands in the human genome, and they are mainly found in the promoter regions that regulate gene expression. In fact, CpG islands occur in the promoters of about 50% of the housekeeping genes in humans. Tumor-related abnormal DNA methylation mainly occurs in the 5' regulatory region of tumor suppressor genes to reduce the expression of tumor suppressor genes, and long-term inhibition of tumor suppressor gene expression can lead to the occurrence and development of tumors. DNA is released from abnormal cells in cancer tissue of cancer patients into blood through processes including apoptosis and necrosis, and thus exists in the form of cell-free tumor DNA in serum or plasma of blood, and methylated DNA fragments also exist in cell-free tumor DNA. Therefore, accurate detection of tumor suppressor gene methylation in blood can be used for tumor screening and early diagnosis.
[0014] Currently, the methods for detecting DNA methylation mainly include real-time fluorescent PCR, high-throughput sequencing, mass spectrometry and pyrosequencing. In practical application, the conventional pyrosequencing and real-time fluorescent PCR methods are more suitable for the detection of one or a few methylation targets, and high-throughput sequencing and mass spectrometry are suitable for the simultaneous detection of multiple methylation, but the cost is high, the operation is inconvenient, and it cannot be widely applied in clinical practice. While the existing real-time fluorescent PCR has a lower cost, but due to the limitation of the number of targets detected by the existing method, there is an urgent need for a method that can simultaneously consider the throughput and cost, which is more conducive to the promotion and application of clinical practice. The following methods can be considered: i) using target DNA methylation-independent primers as real-time PCR primers and using methylation-specific detection primers that can hybridize to methylated target DNA to detect PCR amplification products; ii) using target DNA methylation-specific primers as real-time PCR primers and using detection probes that can hybridize to the methylation-independent sequences contained in the PCR amplification products; and iii) using target DNA methylation-specific primers as real-time PCR primers and using methylation-specific detection probes that can hybridize to methylated target DNA to detect PCR amplification products.
[0015] However, these methods all directly use unenriched DNA as a template, and two primers (forward and reverse) must be used simultaneously to amplify the target DNA. Therefore, whenever the target to be amplified in one tube (single reactor) increases, there is a further need for two primers.
[0016] Primers for multiplex PCR are designed so that different primers in a single tube can have similar hybridization characteristics. To some extent, annealing temperature and primer concentration can be calculated or also used empirically. Since non-specific hybridization increases each time a primer pair is added, the reaction conditions should be modified each time a primer pair is added. In addition, artifacts can occur due to primer pair depletion, etc. The use of 5'-tagged oligonucleotides in PCR reactions has been reported. However, one key feature of this amplification method is that it includes steps for annealing and separating primer extension reactions for each primer, and thus is not suitable for the actual multiplex PCR concept. Therefore, creating perfect conditions for multiplex PCR is a very difficult and costly process. Therefore, it is necessary to develop a multiplex PCR method that can amplify several targets to the same extent under the same conditions, regardless of the characteristics of different primers.
[0017] In this technical background, the present inventors have made intensive efforts to solve the above problems and developed a method, MMDEC, for detecting multiple methylation target DNAs with high detection limit and accuracy, and thus found that, when oligonucleotides connected with a universal tag primer are enriched with multiple amplified target DNAs through uniform amplification and the enriched target DNAs are used as templates to detect target DNAs, and a universal primer is connected with a target-specific oligonucleotide, even though a universal tag primer is added only for the multiple detection of target methylated DNAs, unlike conventional techniques, methylated DNAs can be detected with desired high sensitivity and accuracy, thereby completing the present disclosure. SUMMARY
[0018] An object of the present disclosure is to provide a method that can detect multiple methylation DNA targets of tumor origin in a sample such as blood with high sensitivity.
[0019] Another object of the present disclosure is to provide a composition for the multiple detection of methylated DNAs in a blood sample, which comprises a multiple Rooptag primer and a universal tag primer.
[0020] Another object of the present disclosure is to provide a kit for the multiple detection of methylated DNAs, which comprises the composition.
[0021] Other aspects of the present application will be apparent to those skilled in the art from consideration of the disclosure herein. EMBODIMENTS
[0022] As used herein, "abnormal methylation" means that the degree of methylation of CpG in a gene sequence is significantly different between tumor tissue and normal tissue, for example, the degree of methylation of a tumor sample is significantly higher than that of a normal sample, or the degree of methylation of a tumor sample is significantly lower than that of a normal sample. In general, the promoter region of a tumor sample of a tumor suppressor gene is highly methylated, while the corresponding region of a normal sample is less methylated. For example, in the case of a specific real-time fluorescent PCR (QMSP) analysis method, a PCR reaction with a methylation-specific primer can be considered to be in a high methylation state if it obtains a positive PCR result or a small difference in the ct value from an internal control gene. In the case of real-time quantitative methylation-specific PCR, the determination of a high methylation state can be based on the statistical difference in the relative value of the methylation state of the control sample.
[0023] In the present application, in order to improve the sensitivity of methylation detection in a sample such as blood or urine, the present application uses a multiple methylation detection method, MMDEC, with high sensitivity.
[0024] The present disclosure provides a method for detecting methylated DNA, which comprises the following steps: a method for detecting multiple methylated DNA, which comprises: (a) sample purification and rapid transformation: a target DNA-containing sample of at least one CpG island abnormal region of a transformed non-methylated DNA site to distinguish it from a methylated DNA site; (b) primer design, which comprises a target-specific sequence Rooptag primer designed to be capable of complementary binding to the target DNA treated with the reagent and a universal tag primer that does not complementarily bind to the target DNA; (c) PCR amplification, using the target DNA treated with the reagent in step (a) as a template and using the primers constructed in step (b), performing 2 rounds of amplification to amplify the target DNA; (d) probe detection, detecting and amplifying the methylation of the target DNA by multiple probes capable of complementary hybridization to the target DNA sequence amplified in step (c), thereby improving the sensitivity of rare template DNA amplification in samples such as plasma and urine.
[0025] After the genomic DNA is treated with bisulfite, the non-methylated cytosine is converted to uracil, which is then converted to thymine in the subsequent PCR process, which reduces the sequence complexity of the genome and makes it more difficult to amplify specific target fragments. Therefore, preferably, amplification can be used to design multiple methylation-specific Rooptag primers and universal tag primers, and two rounds of PCR amplification can be performed, using the first round of amplification products as templates for the second round of amplification, which can greatly improve the efficiency and specificity of amplification. However, it should be understood that the detection method useful in the present application is not limited thereto.
[0026] The method of the present application can be used for: (i) detecting a sample of a subject to analyze whether the subject has a tumor; (ii) distinguishing a high-risk population of tumors. The method can also be used in cases where the purpose is not to obtain a direct disease diagnosis. In preferred embodiments of the present application, DNA methylation is detected by multiple high-sensitivity MMDEC multiple methylation detection. Those skilled in the art will understand that the method is not limited to this method in actual applications, and other DNA methylation detection methods can also be used. In PCR amplification, the primers used are not limited to those provided in the embodiments.
[0027] Through research and verification of clinical samples, the method of the present application has very high accuracy when used for diagnosing clinical tumors. The present application can be applied to the fields of tumor auxiliary diagnosis, efficacy determination, prognosis monitoring, etc., and has high clinical application value.
[0028] Therefore, the present application provides a method for preparing a tumor detection reagent, comprising: providing the polynucleotide, designing a detection reagent for specifically detecting the target sequence with the full length or fragment of the polynucleotide as the target sequence; wherein at least one methylated CpG site exists in the target sequence.
[0029] The detection reagent according to the present application can include, but is not limited to, primers, probes, etc.; after the marker is obtained, the selection of the detection reagent can be achieved by those skilled in the art.
[0030] As a preferred mode of the present application, the reagent is a primer pair. In a preferred embodiment of the present application, the primers are the primers shown in SEQ ID NO: 5-19, which can obtain an amplification product containing the 001-052th CpG site in SEQ ID NO: 1; after the sequence of the polynucleotide is known, the design of the primers is known to those skilled in the art, and the two primers are on both sides of the specific sequence of the target gene to be amplified (including the CpG sequence, and the CpG complementary to the original methylated gene region, and the CpG complementary to the original demethylated gene region). According to the new finding of the present application, those skilled in the art can design various primers or probes or other types of detection reagents for different positions of the CpG sites or their combinations on the target sequence, which should be included in the technical solution of the present application.
[0031] The reagent can also be a reagent combination (primer combination), which includes more than one set of primers, so that the above-mentioned multiple polynucleotides can be amplified respectively.
[0032] The present application also provides a kit for detecting the methylation pattern of polynucleotides in a sample in vitro, which comprises: a container, and the above-mentioned primer pair in the container.
[0033] In addition, the kit can also include various reagents required for DNA purification and separation, DNA transformation and purification, methylation-specific PCR amplification, etc.
[0034] In addition, the kit can also include an instruction manual, which indicates the detection operation steps and result determination criteria, so as to facilitate the application by those skilled in the art.
[0035] The following will be described in conjunction with specific embodiments Example 1, screening and sequence determination of markers For human genome sequences, the present inventors designed a Rooptag primer for the tumor-specific methylated DNA region in the tumor marker NPBWR1 gene, and the sequence is as follows SEQ ID NO: 1 (chr8:53852030:53852459, Human / hg19) CGGAAGTTTCCTGAAAGAGGGGAGAAGGGTTTGCATTTTTCCTATGGAGGATTCTTCTCTCTCTAGCATTTCGTTTGATGTATTCAACTGGTAGAAGTGAGATTTCAACAGGTAGCAGAGAGCGCTCACGTGGAGGAGGTTTGGGGCGCCGCGGCGCCACCCCCACCCCTCCTCGGGACCGCGCCTATTTCTAAAGTTACACGTCGACGAACTAACCTATGCTTTAAATTCCTCTTTCCAGCCCCGTGAGTCCGCGGCGACATTGGGCCGTGGGGTGGCTGGGAACGGTCCCCTCCTCCGGAAAAACCAGAGAACGGCTTGGAGAGCTGAAACGAGCGTCCGCGAGCAGGTCCGTGCAGAACCGGGCTTCAGGACCGCTGAGCTCCGTAGGGCGTCCTTGGGGGACGCCAGGTCGCCGGCTCCTCTGCCC TECHNICAL SOLUTION
[0036] The present disclosure provides a high-sensitivity multiplex methylation detection (MMDEC) technique that can be used for blood sample detection. The MMDEC technique first uses a Rooptag primer, which includes a target-specific sequence capable of complementary binding to a target DNA and a Roop sequence that does not bind to the target DNA having the target-specific sequence bound, linearly amplifies an internal control gene and a target DNA, and then analyzes the methylated DNA by a detection method using an oligonucleotide capable of complementary binding to a complementary sequence of the target DNA, a probe capable of complementary hybridization to a sequence of the target DNA, and a universal primer that does not complementarily bind to the linearly amplified target DNA. As a result, it is confirmed that the method of the present disclosure can detect methylated DNA with higher sensitivity and accuracy than conventional methods.
[0037] To achieve the above object, the present disclosure provides a method for detecting methylated DNA, comprising the following steps: a method for detecting methylated DNA, comprising: (a) sample purification and rapid transformation: a target DNA-containing sample with at least one abnormal region of CpG island of a non-methylated DNA site to be distinguished from a methylated DNA site; (b) primer design, comprising a target-specific sequence Rooptag primer designed to be capable of complementary binding to the target DNA treated with the reagent and a universal tag primer not complementary to the target DNA; (c) PCR amplification, using the target DNA treated with the reagent in step (a) as a template and the primers constructed in step (b), performing 2 rounds of amplification to amplify the target DNA; (d) probe detection, detecting and amplifying the methylation of the target DNA by a plurality of probes capable of complementary hybridization to the target DNA sequence amplified in step (c), thereby improving the sensitivity of rare template DNA amplification in samples such as plasma and urine.
[0038] The present disclosure also provides a composition for detecting methylated DNA, comprising: at least one reagent for treating a target DNA-containing sample, which modifies non-methylated DNA to be distinguished from methylated DNA; an oligonucleotide comprising a target-specific sequence capable of complementary binding to the target DNA sequence treated with the reagent and a universal primer not complementary to the target DNA; an oligonucleotide capable of complementary binding to the linearly amplified target DNA and a universal primer; and a probe capable of complementary hybridization to the linearly amplified target DNA sequence.
[0039] The present disclosure also provides a kit for detecting tumor-specific methylated DNA, comprising the composition. The present disclosure aims to provide a method for detecting tumors by using DNA methylation modification as a tumor marker and taking advantage of the phenomenon of abnormally high methylation at specific sites in tumors.
[0040] In a preferred embodiment, the tumor includes (but is not limited to): lung cancer, breast cancer, head and neck cancer, prostate cancer, liver cancer, gastric cancer, bladder cancer, and prostate cancer.
[0041] In another preferred embodiment, the sample of the tumor includes (but is not limited to): a blood sample, a pleural effusion sample, and an alveolar lavage sample, an ascites and lavage sample, a bile sample, a fecal sample, a urine sample, a saliva sample, a sputum sample, a cerebrospinal fluid sample, a cervical smear or brush sample, a tissue and cell biopsy sample.
[0042] In a second aspect of the present application, a method for preparing a tumor detection reagent is provided, which comprises: providing the polynucleotide of the first or second aspect, using the full length or fragment of the polynucleotide as a target sequence, and designing a detection reagent for specifically detecting the modification of the CpG site of the target sequence; wherein the target sequence comprises at least one (e.g. 2-27) modified CpG site; preferably, the detection reagent comprises (but not limited to): a primer, a probe.
[0043] In a third aspect of the present application, a reagent or a combination of reagents for specifically detecting the modification of the CpG site of a target sequence is provided, wherein the target sequence is the full length or fragment of the polynucleotide of any one of the first or second aspect, and comprises at least two (e.g. 2-27) modified CpG sites.
[0044] In a preferred embodiment, the reagent or the combination of reagents is designed based on a gene sequence comprising the target sequence, and the gene sequence comprises a gene panel or a gene group.
[0045] In another preferred embodiment, the detection reagent comprises: a primer, a probe.
[0046] In another preferred embodiment, the primer is a primer as shown in SEQ ID NO: 5- SEQ ID NO: 19.
[0047] In a fourth aspect of the present application, the use of the reagent or the combination of reagents of the fifth aspect of the present application for preparing a kit for detecting a tumor is provided; preferably, the tumor comprises (but not limited to): lung cancer, breast cancer, head and neck cancer, malignant pluripotent embryonic carcinoma, prostate cancer, liver cancer, gastric cancer, bladder cancer, prostate cancer.
[0048] In a preferred embodiment, the kit further comprises: a DNA extraction reagent, a DNA transformation and purification reagent, and a multiplex methylation PCR amplification reagent.
[0049] In another preferred embodiment, step (ii) comprises: (1) treating the product of (i) so that the unmodified cytosine is converted to uracil; preferably, the modification comprises 5-methylation modification; preferably, the nucleic acid of step (i) is treated with bisulfite or heavy bisulfite; (2) analyzing the modification of the target sequence in the nucleic acid treated in (1).
[0050] In another preferred embodiment, the methylation profile abnormality refers to the presence of at least one CpG in the polynucleotide sequence, and the methylation degree of the CpG is significantly different between the tumor sample and the normal sample.
[0051] In another preferred embodiment, the method of methylation profiling is not intended to result in a diagnosis of a disease or is not a diagnostic method.
[0052] In a fifth aspect of the present application, a tumor diagnostic kit is provided, comprising a primer pair designed using the sequence of the first or second aspect of the present application and a gene panel or gene group comprising the sequence, to obtain the characteristics of normal cells and tumor cells by DNA methylation state detection.
[0053] Other aspects of the present application will be apparent to those skilled in the art from consideration of the disclosure herein.
[0054] Definitions As used herein, "sample" or "specimen" includes material obtained from any individual or isolated tissue, cells or body fluids (e.g., plasma) suitable for DNA methylation state detection. For example, the sample can include, but is not limited to, blood samples, pleural effusion samples, and alveolar lavage samples, ascites and lavage samples, bile samples, stool samples, urine samples, saliva samples, cerebrospinal fluid samples, cell smear samples, cervical scrape or brush samples, tissue and cell biopsy samples.
[0055] As used herein, "high (degree) methylation" refers to the presence of high methylation modification at CpG in a gene sequence. For example, in terms of methylation-specific PCR (QMSP) analysis, the PCR reaction with methylation-specific primers can obtain the ct value and the difference between the ct value of the internal control primer to determine the methylation state of the DNA (gene) region detected. The smaller the ct value, or the smaller the difference between the ct value of the internal control primer, the higher the degree of methylation.
[0056] Gene markers For a target useful for diagnosing tumors, the methylation state of the gene sequence region of the gene marker is significantly different between tumor tissues and non-tumor tissues, and as long as abnormal high methylation state of the gene sequence region of the gene marker is detected, it can be determined that the subject belongs to a high-risk group of tumors. Moreover, the gene marker exhibits such a significant difference between tumor tissues and non-tumor tissues.
[0057] Accordingly, the present application provides an isolated polynucleotide having a nucleotide sequence as set forth in SEQ ID NO: 1 (or the reverse complement of SEQ ID NO: 1), wherein the cytosine (C) in the 5'-CpG-3' motif is 5-methylcytosine (5mC) in the polynucleotide sequence in the tumor cell. The present application also includes fragments of the polynucleotide having the nucleotide sequence as set forth in SEQ ID NO: 1, and wherein at least one (e.g., 2 to 27) of the methylated CpG sites is present. The polynucleotide or fragment described above can also be used to design a detection reagent or a detection kit.
[0058] In some embodiments of the present application, the fragment of the polynucleotide is, for example, a fragment comprising bases 122 to 309 of SEQ ID NO: 1. The anti-sense strand of the fragment described above is also useful. These fragments are examples of preferred embodiments of the present application; other fragments can also be selected based on the information provided herein, and detected by the MMDEC technique, which is a high-sensitivity technique for detecting multiple methylation sites, for the multiple methylation regions described above.
[0059] The polynucleotides described above can be analyzed for their methylation status by various techniques known in the art as key regions in the genome for which the methylation status is analyzed. Any technique that can be used to analyze the methylation status can be used in the present application.
[0060] The polynucleotides described above, after being treated with bisulfite or heavy bisulfite, the unmethylated cytosine is converted to uracil, while the methylated cytosine remains unchanged.
[0061] Accordingly, the present application also provides polynucleotides obtained by treating the polynucleotides described above (including the complementary strand (anti-sense strand)) with bisulfite or heavy bisulfite, including polynucleotides having the nucleotide sequence as set forth in SEQ ID NO: 1. These polynucleotides can also be used to design a detection reagent or a detection kit.
[0062] The present application also includes fragments of the polynucleotides obtained by treating the polynucleotides described above or their anti-sense strands with bisulfite or heavy bisulfite, and wherein at least one (e.g., 2 to 27) of the methylated CpG sites is present.
[0063] Detection reagents and kits Based on the technology of the present application, detection reagents designed based on the polynucleotide sequence described above are also provided for detecting the methylation profile of the polynucleotide in a sample in vitro. The detection methods and reagents known in the art for determining the sequence, variations and methylation status of a genome can be used in the present application.
[0064] Therefore, the present application provides a method for preparing a tumor detection reagent, comprising: providing the polynucleotide, designing a detection reagent for specifically detecting the target sequence with the full length or fragment of the polynucleotide as the target sequence; wherein at least one methylation CpG site exists in the target sequence.
[0065] The detection reagent described in the present application includes but is not limited to primers, probes, etc.
[0066] The reagent is, for example, a primer pair, and the design of primers after knowing the sequence of the polynucleotide is known to those skilled in the art. For different CpG sites, multiple primers are in the methylation specific region (including the CpG sequence, and the CpG complementary to the original methylation gene region is for the original demethylation gene region). It should be understood that according to the new discovery of the present application, those skilled in the art can design multiple primers or probes or other types of detection reagents for different positions of CpG sites or combinations thereof on the target sequence, which should be included in the technical scheme of the present application. In the preferred embodiment of the present application, the primer includes but is not limited to the primer combination shown in SEQ ID NO: 5- SEQ ID NO: 9, which can obtain an amplification product containing multiple CpG islands in the 100-200bp region of SEQ ID NO: 1; the primers shown in SEQ ID NO: 10- SEQ ID NO: 16, which can obtain an amplification product containing multiple CpG islands in the 200-350bp region of SEQ ID NO: 1; the primers shown in SEQ ID NO: 17- SEQ ID NO: 19, which can obtain an amplification product containing multiple CpG islands in the 360-430bp region of SEQ ID NO: 1; SEQ ID NO: 2 is a universal tag primer, and the probe combination shown in SEQ ID NO: 3- SEQ ID NO: 4.
[0067] As shown in the following Table 1:
[0068] The reagent is a reagent combination (primer combination), which includes more than one set of primers, so that the above-mentioned multiple polynucleotides can be amplified respectively.
[0069] The present application also provides a kit for detecting the methylation pattern of polynucleotides in a sample in vitro, which comprises: a container and the above-mentioned primer pair in the container.
[0070] In addition, the kit can also include various reagents required for DNA extraction, DNA purification, PCR amplification, etc.
[0071] In addition, the kit can further comprise a manual, which indicates the detection steps and the result judging standard, so as to facilitate the application of the skilled in the art.
[0072] Detection method The present application provides a method for detecting the methylation pattern of a polynucleotide in a sample in vitro. The method is based on the principle that bisulfite or bisulfite reagent can convert unmethylated cytosine into uracil, which is converted into thymine in the subsequent PCR amplification, while the methylated cytosine remains unchanged. Thus, after the polynucleotide is treated with bisulfite or bisulfite reagent, the methylated site produces a C / T-like polynucleotide polymorphism (SNP). Based on the above principle, the methylation pattern of the polynucleotide in the sample can be identified, which can effectively distinguish between methylated and unmethylated cytosine.
[0073] The method of the present application comprises: (a) providing a sample and extracting genomic DNA; (b) treating the genomic DNA of step (a) with bisulfite or bisulfite reagent, so that the unmethylated cytosine in the genomic DNA is converted into uracil; (c) analyzing whether there is an abnormal methylation pattern in the genomic DNA treated in step (b).
[0074] The method of the present application can be used to: (i) detect the sample of a subject and analyze whether the subject has a tumor; (ii) distinguish a high-risk population of tumors. The method can also be used in cases where the direct disease diagnosis is not the purpose.
[0075] After the genomic DNA is treated with bisulfite, the unmethylated cytosine is converted into uracil, which is converted into thymine in the subsequent PCR process, which reduces the sequence complexity of the genome and increases the difficulty of PCR amplification of specific target fragments. Therefore, it is preferred to use a multiplex high-sensitivity MMDEC multiplex methylation detection method, and two rounds of PCR amplification are performed, and the amplification product of the first round is used as the template for the second round of amplification, which can effectively improve the efficiency and specificity of amplification. However, it should be understood that the detection method useful in the present application is not limited thereto.
[0076] Through the research and verification of clinical samples, the method of the present application has very high accuracy when used for diagnosing clinical tumors. The present application can be applied to the fields of tumor auxiliary diagnosis, efficacy determination, prognosis monitoring, etc., and has high clinical application value.
[0077] The application will be further described in connection with the following specific examples. It should be understood that these examples are only for the purpose of illustration and are not intended to limit the scope of the application. The experimental procedures in the following examples, unless otherwise indicated, were carried out in accordance with conventional procedures as described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory, 2002, or in accordance with the procedures recommended by the manufacturer.
[0078] Example 2 Determination of detection limit using methylated DNA derived from cell lines This example is a comparison of the detection limit of methylated DNA using the high sensitivity MMDEC multiplex methylation detection technology described in Example 1 and conventional QMSP.
[0079] 1. Sample preparation 1.1 Negative cell line preparation: 293T cell line 1.2 Positive cell line preparation: Jurkat cell line 2. Cell DNA extraction 2.1 Take 10^7-10^9 cells, extract the cell DNA according to the operation of the cell DNA extraction kit of Suzhou Yimaiji Biological Technology Co., Ltd. The extracted cell DNA is quality controlled by nanodrop and agarose electrophoresis. The qualified sample has a concentration of more than 50 ng / uL and obvious electrophoresis bands, and is stored at -20 degrees for use.
[0080] 3. Rapid sulfite conversion of sample DNA The sulfite conversion is carried out according to the method described in the operation instruction of the DNA methylation kit (Fast Easy DNA Methylation Kit) of Suzhou Yimaiji Biological Technology Co., Ltd. The specific steps are as follows: 3.1 Add 50 ul of extracted sample DNA (or negative and positive control) and 100 ul of sulfite conversion solution (freshly prepared) to a PCR tube, mix well, and tightly cover the cap. The steps are modified.
[0081] 3.2 Perform the reaction on a PCR instrument. The reaction conditions are 95 degrees for 15 minutes, 65 degrees for 60 minutes, and then cool to room temperature.
[0082] 3.4 Add 600 ul of binding solution to the nucleic acid purification column, then add the reaction solution to the purification column, mix well, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid.
[0083] 3.5 Add 500 ul of washing solution, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid.
[0084] 3.6 Add 200 ul of desulfurization reagent, stand at room temperature for 20 minutes. Centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid.
[0085] 3.7 Add 500ul wash buffer, centrifuge at 12000rpm for 30 seconds, discard the waste. Repeat this step once.
[0086] 3.8 Transfer the purification column to a 1.5ml EP tube, add 15ul elution buffer to the center of the purification column membrane, stand for 2 minutes.
[0087] 3.9 Centrifuge at 12000rpm for 30 seconds, discard the purification column, and collect the converted DNA sample in a 1.5ml EP tube for use.
[0088] 4 DNA sample detection 4.1 MMDEC technology (1) Primer dilution Dissolve the dry powder of the Rooptag multiplex PCR primer in ultrapure water to prepare a 800μM stock solution, and mix to obtain a final concentration of 2-5μM for each amplification primer.
[0089] Dissolve the dry powder of the universal tag PCR primer in ultrapure water to prepare a 500μM stock solution, and mix to obtain a final concentration of 5-20μM for the amplification primer.
[0090] (2) Prepare the following PCR multiplex reaction system as shown in Table 2 below:
[0091] PCR amplification procedure: 95°C pre-denaturation for 5min; 95°C denaturation for 30s, 68°C annealing for 10s, 62°C annealing for 15s, 15 cycles; 95°C denaturation for 30s, 65°C annealing for 10s, 58°C annealing for 25s, 35 cycles and collect fluorescence.
[0092] 4.2 Conventional QMSP technology (1) Primer design, as shown in Table 3 below:
[0093] (2) Prepare the following PCR reaction system as shown in Table 4 below:
[0094] PCR amplification procedure: 95°C pre-denaturation for 5min; 95°C denaturation for 30s, 68°C annealing for 10s, 62°C annealing for 15s, 45 cycles and collect fluorescence.
[0095] The results show that the conventional QMSP method has a detection rate of 100% in 50-200pg DNA, but a detection rate of 35.3% in 10pg, and a detection rate of 0% in 5pg, while the method of the present disclosure shows a detection rate of 100% in 20-200pg, and a detection rate of 29.4% even in 5pg.
[0096] Comparison of detection rate between traditional method (QMSP) and method of the present disclosure (MMDEC) as shown in Table 5 below:
[0097] Example 3 This example is a comparison of early detection of lung cancer using the high-sensitivity MMDEC multiplex methylation detection technology described in Example 1 and the conventional QMSP described in Example 10.
[0098] 1. Collection of samples 1.1 Collection of negative samples: 14 serum / plasma samples were taken from a benign population of lung nodules aged 25-35 years old, with no family history of lung cancer, and no history of lung cancer disease.
[0099] 1.2 Collection of interference samples: 10 serum / plasma samples were taken from a benign population of lung nodules aged 25-35 years old, with lung inflammation and other diseases.
[0100] 1.3 Collection of lung cancer patient samples: 35 serum / plasma samples were taken from patients clinically identified as lung cancer by cytology.
[0101] 2. Extraction of serum / plasma free DNA 2.1 Take 2 mL of serum / plasma, follow the operation of the magnetic bead method free DNA extraction kit of Suzhou Yimaiji Biological, and use fluorescent PCR for quality control of the extracted free DNA. The ct value less than 28 is a qualified sample, which is stored at -20 degrees for use.
[0102] 3. Rapid conversion of sample DNA with sulfite The sulfite conversion was performed according to the method described in the operation instruction of the DNA methylation kit (Fast Easy DNA Methylation Kit) of Suzhou Yimaiji Biological. Specifically as follows: 3.1 Add 50ul of extracted sample DNA (or negative and positive control) and 100ul of sulfite conversion solution (freshly prepared) to the PCR tube, mix well, and tightly cover the lid. The steps are modified.
[0103] 3.2 Perform reaction on PCR instrument. The reaction conditions are 95 degrees for 15 minutes, 65 degrees for 60 minutes, and then cool to room temperature.
[0104] 3.4 Add 600ul of binding solution to the nucleic acid purification column, then add the reaction solution to the purification column, tightly cover the lid, mix well, centrifuge at 12000rpm for 30 seconds, and discard the waste liquid.
[0105] 3.5 Add 500ul of washing solution, centrifuge at 12000rpm for 30 seconds, and discard the waste liquid.
[0106] 3.6 Add 200ul desulfurization reagent, stand at room temperature for 20 minutes. 12000rpm centrifuge for 30 seconds, discard the waste liquid.
[0107] 3.7 Add 500ul washing solution, 12000rpm centrifuge for 30 seconds, discard the waste liquid. Repeat this step once.
[0108] 3.8 Transfer the purification column to a 1.5ml EP tube, add 15ul elution solution to the center of the purification column membrane, stand for 2 minutes.
[0109] 3.9 12000rpm centrifuge for 30 seconds, discard the purification column, and collect the converted DNA sample in a 1.5ml EP tube for use.
[0110] 4 DNA detection of sample 4.1 MMDEC technology (1) Primer dilution Dissolve the Rooptag multiplex PCR primer dry powder with ultrapure water to prepare a 800μM stock solution, mix to make the final concentration of each amplification primer 2-5μM.
[0111] Dissolve the universal tag PCR primer dry powder with ultrapure water to prepare a 500μM stock solution, and the final concentration of the amplification primer is 5-20μM.
[0112] (2) Prepare the following PCR multiplex reaction system as follows Table 6:
[0113] PCR amplification program: 95℃ pre-denaturation 5min; 95℃ denaturation 30s, 68℃ annealing 10s, 62℃ annealing 15s, 15 cycles; 95℃ denaturation 30s, 65℃ annealing 10s, 58℃ annealing 25s, 35 cycles and collect fluorescence.
[0114] 4.2 Conventional QMSP technology (1) Primer design, as follows Table 7:
[0115] (2) Prepare the following PCR reaction system as follows Table 8:
[0116] PCR amplification program: 95℃ pre-denaturation 5min; 95℃ denaturation 30s, 68℃ annealing 10s, 62℃ annealing 15s, 45 cycles and collect fluorescence.
[0117] 5. Statistical analysis of the detection results of clinical samples, as follows Table 9:
[0118] According to the results of the above-described Examples 1 to 3, the method of the present application is superior in the detection of high sensitivity and multiple methylation levels, and is applicable to a wide range of methylation targets of various tumors.
[0119] As described above, the method for detecting methylated DNA according to the present disclosure uses a Rooptag-specific primer, and can specifically amplify a tumor hypermethylated region in a multiplex primer system, and uses a universal tag primer to uniformly and effectively amplify multi-target DNA, even if the sample contains various types of genes. In addition, the complexity of PCR (real-time PCR) for detecting methylation by linear amplification and the complexity of PCR efficiency are reduced, indicating that the sensitivity of the detection is significantly higher and the method is useful. Furthermore, the method is advantageous in that it can enrich methylated target DNA with higher specificity in the step of linearly amplifying the target DNA, can be used for liquid samples such as plasma / urine having low tumor content, is suitable for clinical applications such as early screening of tumors, recurrence monitoring, etc.
[0120] Although the present disclosure has been described in detail with reference to specific features, it is clear to those skilled in the art that the description is only directed to preferred embodiments and does not limit the scope of the present disclosure. Therefore, the substantial scope of the present disclosure will be defined by the appended claims and their equivalents.
Claims
1. A method for multiplexed high sensitivity MMDEC (multiplexed methylation detection) comprising: (I) treating a sample containing target DNA with at least one reagent that modifies non-methylated DNA sites so as to distinguish them from methylated DNA sites; (II) constructing oligonucleotides comprising a target-specific sequence designed to be capable of complementary binding to a plurality of target DNA treated with the reagent and a universal tag primer that does not complementarily bind to the target DNA; (III) performing a first round of exponential tumor methylation-specific amplification using the target DNA treated with the reagent in step (I) as a template and the oligonucleotides constructed in step (II) as primers; (IV) uniformly amplifying a plurality of tumor-specific target DNA using a universal tag primer capable of complementary binding to the DNA specifically amplified in step (III); and (V) detecting methylation of a plurality of target DNA by probes capable of complementary hybridization to the target DNA sequence amplified in step (IV).
2. The method of claim 1, wherein the reagent is one or more selected from the group consisting of pyrosulfite, sodium bisulfite, ammonium bisulfite, potassium bisulfite, disulfite, and combinations thereof.
3. The method of claim 1, wherein at least one cytosine base is converted to uracil or another base different from cytosine by treatment with the reagent.
4. The method of claim 1, wherein a plurality of target DNA methylation in a sample is detected in a single reactor. A plurality of tumor-specific methylation CpG site modification regions of the same gene or a plurality of tumor-specific methylation CpG site modification regions of a plurality of genes can be detected simultaneously.
5. The detection method of claim 1, wherein the target sequence is a full-length or a fragment of the polynucleotide of any one of claims 1, wherein at least one modified CpG site is present, and the target sequence is specifically detected for the modification of the CpG site.
6. The reagent or combination of reagents of claim 1, wherein the reagent or combination of reagents is directed to a gene sequence comprising the target sequence, and the gene sequence comprises a gene panel or a gene group.
7. The reagent or combination of reagents of claim 6, wherein the reagent or combination of reagents comprises a primer or a probe, and preferably the primer is: a primer set forth in SEQ ID NO: 5 and 6; a primer set forth in SEQ ID NO: 7 and 8; a primer set forth in SEQ ID NO: 9 and 10; a primer set forth in SEQ ID NO: 11 and 12; a primer set forth in SEQ ID NO: 13 and 14; a primer set forth in SEQ ID NO: 15 and 16; a primer set forth in SEQ ID NO: 17 and 18; or a primer set forth in SEQ ID NO:
19. 8. The use of the reagent or the reagent combination of any one of claims 6-7 for preparing a kit for detecting a tumor; preferably, the tumor includes but is not limited to lung cancer, breast cancer, head and neck cancer, prostate cancer, liver cancer, gastric cancer, bladder cancer, prostate cancer.
9. A method for detecting the methylation profile of a sample in vitro, comprising: 1) extracting nucleic acid from the sample; 2) transforming and purifying the nucleic acid; 3) detecting the modification of the CpG site of the target sequence in the nucleic acid of 2); Step 2) comprises: treating the product of 1) so that the unmodified cytosine therein is converted into uracil; preferably, the modification includes 5-methylation modification, preferably, the nucleic acid of step 1) is treated with one or more compositions selected from the group consisting of bisulfite, bisulfite, hydroquinone, thiocyanate, disulfite and combinations thereof.
10. The kit of claims 4 and 6, The detection kit based on the MMDEC technology platform can detect methylation abnormalities below 0.1%, not only can be used for detection of conventional samples such as fecal samples, cerebrospinal fluid samples, cell smear samples, cervical scraping or brushing samples, tissue and cell biopsy samples, etc., but also has better adaptability for samples with small tumor sources such as plasma and urine, and higher detection sensitivity requirements.