A molecular marker Indel-seq44 tightly linked to the QTL of the early flowering trait in maize and its application

Abstract

The present invention belongs to the technical fields of molecular biology and genetic breeding, and discloses a molecular marker Indel-seq44 closely linked to a maize early flowering trait QTL and its application. The present invention obtains an Indels (insertion-deletion) marker significantly associated with the maize early flowering trait, which is located at the sequence positions 150 bp upstream and downstream of the 159,550,344th base on chromosome C03 of the B73 V4 genome, and can explain 23.52% of the phenotypic variation. By performing assisted selection with the Indels detection primers designed according to this molecular marker, the screening efficiency of maize early flowering individual plants can be improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and genetic breeding, and specifically relates to a molecular marker Indel-seq44 tightly linked to a QTL of early flowering trait of corn and an application thereof. Background Art

[0002] The length of the maize flowering period (earing, silking and pollination) directly affects the normal sowing period of the next crop, and the early flowering period of maize makes it possible to fully dehydrate the maize kernels and directly harvest the kernels for mechanization. Analyzing the genetic mechanism of maize flowering period traits and introducing early flowering superior alleles are of great significance for enriching my country's early-maturing maize germplasm bank, cultivating early-maturing varieties suitable for mechanized harvesting in early spring and summer sowing areas, solving the problem of tight crop rotation, making full use of light and temperature resources in high-altitude cold areas, and avoiding low temperature and cold damage in the early growth period and early frost damage in the late growth period.

[0003] The application of traditional breeding technology to improve early-flowering crops has defects such as low selection efficiency and long breeding cycle. With the rapid development of molecular biology and sequencing technology, breeding methods assisted by genotype selection have been proven to be an effective way to solve the dilemma of traditional breeding, and the development of molecular markers with tightly linked traits is an important prerequisite for the application of this technology. Using molecular marker-assisted selection to detect molecular markers closely related to early-flowering traits in corn can effectively reduce the tediousness of phenotypic identification work and avoid being affected by environmental and human factors, guiding the precise introduction or aggregation of traits, which will greatly improve breeding efficiency.

[0004] At present, some molecular markers related to the flowering period of maize have been made public and applied: InDel-PZmC0L3, which is located on chromosome 5 of maize; two specific molecular markers, ZCN8_1245CAP and ZCN8_2339d CAP, have been developed based on the coding gene (ZCN8 gene) of the protein related to the maize flowering period; two InDel markers, JAAS4374 and JAAS437, located on chromosome 9 of maize, can identify a QTL locus for maize flowering period. This locus can explain 10.4% of the phenotypic variation at the silking stage and 3.4% of the phenotypic variation at the tasseling stage; the molecular marker M01 is closely linked to the gene ZmWRKY14 and is located on chromosome 10 of maize. In the RIL population constructed by the early-flowering line CHANG7-2 and the late-flowering line H127R, its phenotypic contribution rates to the number of leaves are 17.01% respectively, and it can be used for the screening of late-flowering and multi-leaf maize germplasms; the molecular markers TE_11.8k and TE_6.5k are closely linked to the ZmELF3.1 gene. By affecting its expression abundance in maize tissues, they are in tight linkage, which is a SNP locus in the maize genome, located at position 272694744 on chromosome 1 of maize. This marker is developed based on the KASP technology and can detect the base at position 272694744 on chromosome 1 of the maize genome in a high-throughput manner, and identify or assist in identifying the maize flowering period according to the genotype of the maize to be tested.

[0005] In this invention, the early-maturing maize local germplasm "Liushihuang" from Shennongjia, Hubei, is used as the material. By using BSA sequencing and linkage analysis, the major QTL loci related to early flowering with breeding application potential in maize are identified, and molecular markers are developed based on the information of the major QTL loci, which has a positive effect on creating new maize early-flowering materials, enriching the maize early-flowering germplasm in China, promoting the breeding of new early-maturing maize varieties suitable for machine harvesting, and improving the maize production efficiency. Summary of the Invention

[0006] The purpose of this invention is to provide the application of molecular marker primers closely linked to the major QTL qEF3.05 locus of the maize early-flowering trait in the screening and breeding of early-flowering traits. By detecting the genotypes of the sequences 150 bp upstream and downstream of the base at position 159550344 on chromosome C03 of the maize B73 V4 genome (https: / / www.maizegdb.org / genome / assembly / Zm-B73-REFERENCE-GRAMENE-4.0), the screening and breeding of early-flowering maize can be achieved.

[0007] To achieve the above purpose, this invention takes the following technical measures:

[0008] Obtaining the major QTL qEF3.05 locus of the maize early-flowering trait:

[0009] (1) The inbred line B73 was crossed with the early-maturing local maize germplasm 'Liushihuang' to construct a backcross introgression line population. Based on the BC4F1 population, leaves of 80 extremely early-flowering and 80 extremely late-flowering individual plants within the population were collected respectively to construct early-flowering and late-flowering DNA pools, which were sent to Beijing Boyun Huakang Gene Technology Co., Ltd. for BSA sequencing (bulked segregant analysis of extreme phenotypes) to obtain the initial mapping interval of the early-flowering QTL. Through BSA sequencing and using the SNP-index association algorithm, a total of 17 candidate regions related to the early-flowering trait were obtained on maize chromosome 3, with a total length of 20.9 Mb;

[0010] (2) Linkage analysis of 13 markers with the target trait was carried out using 80 recombinant individual plants.

[0011] a. 80 recombinant individual plants were screened from the early-flowering population BC4F1F1 population, and the linkage relationship between the target trait and the markers was analyzed using 13 markers (3 SSR markers and 10 newly developed Indel markers within the target region).

[0012] b. Genotype analysis. The CTAB (Cetyltrimethyl Ammonium Bromide) method was used for small-scale maize DNA extraction (Saghai-Maroof et al 1984). PCR was used for genotype identification, and its reaction system was: 2 μl of template DNA with a concentration of about 20 ng, 1 μl of each sense and antisense primer, 7.5 μl of 2×PCR Mix, and 3.5 μl of ddH2O. PCR reaction program: The first step: 95°C for 5 min, the second step: 95°C for 40 s, the third step: 58°C for 40 s, the fourth step: 32 cycles of 2 - 4 cycles, the fifth step: 72°C for 5 min. Capillary electrophoresis was used for single-plant genotype detection.

[0013] The results showed that the target trait locus was detected at 3.05 bin on chromosome 3, within the 591.6 kb interval of Indel-seq41 - Indel-seq47, tightly linked to the Indel-seq44 marker, which could explain the phenotypic contribution rate of 23.52%, and the average additive effect was -4.9260 days. The major QTL locus for early flowering tightly linked to the Indel-seq44 marker was named qEF3.05.

[0014] The application of primers designed for the sequences 150 bp upstream and downstream of the 159550344th base on chromosome C03 of the maize B73 v4 genome in the screening and breeding of maize early-flowering traits belongs to the protection scope of the present invention.

[0015] Application of a reagent for detecting the sequence shown in SEQ ID NO.3 in maize in screening and breeding for early flowering traits of maize.

[0016] In the above application, preferably, the reagent is a primer, specifically:

[0017] Indel-seq44F: TGCAGGTCCATACACTGTGT

[0018] Indel-seq44R: TCATGGGTGGGGAATTTGGG.

[0019] Compared with the prior art, the present invention has the following advantages:

[0020] (1) The present invention has obtained for the first time a major QTL locus qEF3.05 significantly associated with the early flowering trait of maize, which can explain up to 23.52% of the phenotypic variation and can be effectively applied to the genetic improvement of the early flowering trait of maize.

[0021] (2) It has been first studied and found that the molecular marker Indel-seq44 is significantly associated with the early flowering trait of maize, providing a reliable source of molecular markers for the pre-selection of the early flowering trait of maize.

[0022] (3) Using the molecular marker Indel-seq44, the excellent allelic variation of qEF3.05 in maize varieties or lines can be quickly selected during the seedling growth period of maize, which can greatly reduce the workload of breeding screening, shorten the breeding cycle, and accelerate the breeding process of early flowering maize varieties. Detailed implementation manners

[0023] The technical solutions described in the present invention are all conventional techniques in the art unless otherwise specified; the reagents or materials are all from commercial channels unless otherwise specified. In the present invention, unless otherwise specified, the maize genome is referenced to B73V4.

[0024] Example 1:

[0025] Obtaining the major QTL locus qEF3.05 for the early flowering trait of maize:

[0026] (1) The inbred line B73 was crossed with the extremely early-maturing local maize germplasm "Liushihuang" (Bu Yajun. Intercropping Pleurotus sajor-caju in Maize Fields. China State Farms. 1988, 017: 28. DOI: 10.16342 / j.cnki.11-1157 / s.) to construct a backcross introgression line population. Based on the BC4F1F1 population, leaves of 80 extremely early-flowering and 80 extremely late-flowering individual plants within the population were collected respectively to construct early-flowering and late-flowering DNA pools, which were sent to Beijing Boyun Huakang Gene Technology Co., Ltd. for BSA sequencing (bulked segregant analysis of extreme phenotypes) to obtain the initial mapping interval of the early-flowering QTL. Through BSA sequencing and using the SNP-index association algorithm, a total of 17 candidate regions related to the early-flowering trait were obtained on maize chromosome 3, with a total length of 20.9 Mb;

[0027] (2) Linkage analysis of 13 markers with the target trait was carried out using 80 recombinant individual plants

[0028] Eighty recombinant individual plants were screened from the early-flowering population BC4F1F1, and the linkage relationship between the target trait and 13 markers (3 SSR markers and 10 newly developed Indel markers within the target region) was analyzed. The results showed that a target trait locus was detected at the 3.05 bin position of chromosome 3, within the 591.6 kb interval of Indel-seq41 to Indel-seq47, which was tightly linked to the Indel-seq44 marker, and could explain 23.52% of the phenotypic contribution rate, with an average additive effect of -4.9260 days. The major QTL locus for early flowering tightly linked to the Indel-seq44 marker was named qEF3.05.

[0029] Example 2:

[0030] Obtaining a molecular marker primer tightly linked to the QTL locus qEF3.05 for the early-flowering trait in maize:

[0031] (1) Sequences of 150 bp upstream and downstream of the 159550344th base on maize chromosome C03 were extracted, and then using this sequence as a template, primers were designed using the primer design software Primer Premier 6. The optimal primers obtained showed a single band amplification in B73, with a size of 231 bp (shown in SEQ ID NO.1), and a single band amplification in "Liushihuang", with a size of 259 bp (shown in SEQ ID NO.2).

[0032] The primers are as follows:

[0033] Indel-seq44F: TGCAGGTCCATACACTGTGT

[0034] Indel-seq44R: TCATGGGTGGGGAATTTGGG

[0035] The DNA fragment marked by Indel is: ACCCAGTATCAAAAACCAATAAGTCAAC (shown as SEQ ID NO.3).

[0036] Example 3:

[0037] Application of primers designed based on 150 bp upstream and downstream of the 159550344th base on chromosome C03 of maize in screening and breeding of early flowering traits of maize, and the steps are as follows:

[0038] (1) From 813 BC4F1 family populations constructed with "Liushihuang" as the donor and B73 as the recipient (recurrent parent), 25 early flowering and 25 late flowering family materials were selected. Select a plot with medium to upper fertility, uniform soil fertility, and convenient drainage and irrigation, and measure the flowering time (tasseling stage, pollen shedding stage, silking stage) of 50 materials. The experiment adopted a randomized block field experiment design, with 3 replicates. Each material was planted in 1 row, with 10 plants in each row. The flowering time of 50% of the plants in the row was recorded as the flowering period (tasseling stage, pollen shedding stage, silking stage).

[0039] (2) Check the distribution of the two genotypes of the molecular marker Indel-seq44 in the above-mentioned late flowering and early flowering materials. The results show that the genotype of the molecular marker Indel-seq44 is consistent with the recurrent parent in 21 out of 25 late flowering materials, and 4 are heterozygous; while in 25 early flowering materials, 5 are consistent with the recurrent parent and 20 are heterozygous (Table 1).

[0040] (3) The T-test results show that there are extremely significant differences (P<0.01) in the flowering period traits between the two genotypes of "identical to the recurrent parent" and "heterozygous" detected by the molecular marker Indel-seq44, and the heterozygote is judged as the early flowering phenotype.

[0041] The above results are sufficient to show that the molecular marker Indel-seq44 we prepared is highly associated with the early flowering trait of maize, and thus can be used for molecular marker-assisted selection of the early flowering trait of maize.

[0042] Table 1 Marker Indel-seq44 can be used for identification and evaluation of early flowering traits of maize

[0043]

[0044]

[0045]

[0046] In the table, A represents the genotype of the late-flowering parent B73, and H represents the heterozygous genotype.

Claims

1. Use of a reagent for detecting the sequence shown in SEQ ID NO.3 in maize in screening and breeding for early flowering traits of maize.

2. Use of a detection reagent for the sequence 150 bp upstream and downstream of the base at position 159550344 on chromosome C03 of the maize B73 v4 genome in screening and breeding for early flowering traits of maize, wherein the reagent is a primer, specifically: Indel-seq44F: TGCAGGTCCATACACTGTGT Indel-seq44R: TCATGGGTGGGGAATTTGGG.

Images