Application of Mycobacterium tuberculosis Ag85B DNA vaccine in the preparation of preparations for regulating intestinal function in mice

Abstract

The present invention relates to the technical field of vaccine application, and specifically discloses the application of Mycobacterium tuberculosis Ag85B DNA vaccine in the preparation of a preparation for regulating intestinal function in mice. In the present invention, the Mycobacterium tuberculosis Ag85B DNA vaccine stimulates the intestinal mucosa to produce SIgA antibodies, increases the relative richness of Firmicutes, reduces the relative richness of Bacteroidetes, and increases the richness of Lactobacillus reuteri and Lactobacillus johnsonii.

Description

Technical Field

[0001] The invention relates to the technical field of vaccine application, and in particular to application of Mycobacterium tuberculosis Ag85B DNA vaccine in preparing a preparation for regulating intestinal function of mice. Background Art

[0002] Intestinal microorganisms refer to the huge number of microorganisms that exist in the intestines of animals. These microorganisms rely on the intestines of animals to survive and help the host complete a variety of physiological and biochemical functions. The intestine is not only an important place for human digestion and absorption, but also the largest immune organ, playing an extremely important role in maintaining normal immune defense functions. The human intestine provides a good habitat for microorganisms and has metabolic functions that the human body does not have.

[0003] In terms of phylogenetic status, intestinal microorganisms are basically divided into six phyla: Firmicutes, Bacteroidetes, Proteobacteria, Actinobacteria, Verrucomicrobia, and Fusobacteria, among which Bacteroidetes and Firmicutes are the main dominant bacterial groups.

[0004] Tuberculosis (TB) is a chronic infectious disease caused by infection with Mycobacterium tuberculosis (M.tb) and is one of the three major infectious diseases in the world. Bacillus Calmette-Guérin (BCG) is currently the only vaccine used clinically to prevent tuberculosis and is also the most effective vaccine for preventing tuberculosis. Due to continuous passage, the immune protection effect of BCG is gradually weakened. At the same time, during the preparation of BCG, some genes related to immune memory and protection are lost, resulting in a shortened protection period and a weakened protective immune response. Therefore, BCG has a good immune protection effect on newborns, but its effect on preventing adult pulmonary tuberculosis is very limited. Therefore, it is urgent to accelerate the development of a safer and more effective new vaccine.

[0005] Tuberculosis may cause intestinal disorders, and the vaccine also has certain requirements for the balance of intestinal flora. It is crucial to regulate the intestinal flora when preventing and treating tuberculosis. Therefore, the requirements for vaccines are gradually upgraded. Summary of the invention

[0006] In order to solve the above technical problems, the present invention provides the use of Mycobacterium tuberculosis Ag85B DNA vaccine in the preparation of a preparation for regulating intestinal function. The Mycobacterium tuberculosis Ag85B DNA vaccine stimulates the intestinal mucosa to produce SIgA antibodies, increases the relative richness of Firmicutes, reduces the relative richness of intestinal Bacteroidetes, and increases the richness of intestinal Lactobacillus reuteri and Lactobacillus johnsonii.

[0007] The present invention provides the use of Mycobacterium tuberculosis Ag85B DNA vaccine in the preparation of a preparation for regulating intestinal function. The Mycobacterium tuberculosis Ag85B DNA vaccine can regulate the structure of intestinal flora.

[0008] Furthermore, the preparation process of the Ag85B DNA vaccine is as follows: using pcDNA3.1+ as a eukaryotic expression vector, connecting the signal peptide gene and the Rv1886c gene to the pcDNA3.1+ vector, and constructing a eukaryotic expression plasmid pcD-Ag85B, which is the Mycobacterium tuberculosis Ag85B DNA vaccine;

[0009] The signal peptide gene sequence is shown in SEQ ID NO.1;

[0010] The partial Rv1886c gene sequence of the 85B protein is shown in SEQ ID NO.2;

[0011] The synthesized nucleotide chain gene sequence is shown in SEQ ID NO.3.

[0012] Furthermore, the Mycobacterium tuberculosis Ag85B DNA vaccine increased the relative richness of Firmicutes in the intestinal flora, decreased the relative richness of Bacteroidetes, and increased the richness of Lactobacillus reuteri and Lactobacillus johnsonii.

[0013] Furthermore, the Mycobacterium tuberculosis Ag85B DNA vaccine stimulates the body to produce humoral immune effects: stimulating the intestinal mucosa to produce SIgA antibodies, with an average antibody titer of 1:4500.

[0014] Furthermore, the immunization dose of the pcD-Ag85B recombinant plasmid is 50 μg / mouse.

[0015] Furthermore, the Mycobacterium tuberculosis Ag85B DNA vaccine can be used to prepare drugs or carriers for preventing and treating intestinal diseases.

[0016] Furthermore, the Mycobacterium tuberculosis Ag85B DNA vaccine can be used to prepare drugs or carriers for preventing and treating diarrhea.

[0017] Furthermore, the Mycobacterium tuberculosis Ag85B DNA vaccine can be used to prepare a drug or carrier for preventing and treating dyspepsia.

[0018] Furthermore, the Mycobacterium tuberculosis Ag85B DNA vaccine can be used to prepare drugs for improving the body's immunity.

[0019] Furthermore, the Mycobacterium tuberculosis Ag85B DNA vaccine can be used to prepare drugs for preventing and treating tuberculosis;

[0020] The medicine also has the function of regulating the balance of intestinal flora.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] 1. The present invention uses molecular biological technology to connect the signal peptide gene and the 963p nucleotide sequence of the Rv1886c gene encoding Ag85B of M.tb to pcDNA3.1+ to construct a eukaryotic expression plasmid pcD-Ag85B, namely, Ag85B DNA vaccine. The eukaryotic expression plasmid pcD-Ag85B has the advantages of efficient amplification and stable integration.

[0023] 2. The Ag85B DNA vaccine of the present invention was used to immunize C57BL / 6J mice by intramuscular injection, and it was found that the protein could effectively induce humoral immune effects in the colon mucosa of mice, and improved the colon probiotics-Lactobacillus group. Lactobacillus reuteri and Lactobacillus johnsonii in the Firmicutes-Lactobacillus genus increased significantly (p<0.05); the titer of intestinal mucosal SlgA was 1:4500.

[0024] 3. The eukaryotic expression system constructed by the present invention ensures that the secreted protein is close to the natural protein molecule in terms of molecular structure, physicochemical properties and biological functions. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1The electrophoresis diagram of enzyme digestion identification of the recombinant expression plasmid pcD-Ag85B in the present invention is shown, wherein M: 15kb DNA marker; 1: pcDNA3.1+; 2: pcD-Ag85B; 3: pcD-Ag85B digested products by HindⅢ / Xbal;

[0027] Figure 2 It indicates that after the plasmid of the present invention is transfected into CHO cells, the expression of Ag85B in the cell supernatant is detected by Western blot, wherein, M: Protein marker; 1: CHO transfected with empty plasmid pcDNA3.1+; 2: CHO transfected with pcD-Ag85B;

[0028] Figure 3 It shows the effect of the Ag85B protein of the present invention on the titer of SIgA (n=4) antibody in intestinal mucosa;

[0029] Figure 4 Represents the diversity analysis of mouse intestinal flora in the present invention (n=4);

[0030] Among them, Figure A is a rarefaction curve; Figure B is a hierarchical clustering curve; Figure C is a Venn diagram; D is the Shannon diversity index (Shannon index); Figure E is a principal component analysis diagram; Figure F is an evolutionary tree;

[0031] Figure 5 It represents the species composition and difference analysis of the colon flora of each group of mice in the present invention;

[0032] Among them, Figure A shows the changes in intestinal microbial composition in the Blank group and the Ag85B group;

[0033] Figure B shows the intestinal microbial composition of the Blank and Ag85B groups at the genus level;

[0034] Figure C shows the intestinal microbial composition of the Blank and Ag85B groups at the species level;

[0035] Figure D shows the statistical analysis of the 10 main populations in the Blank and Ag85B groups. DETAILED DESCRIPTION

[0036] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0037] Example 1

[0038] Application of Mycobacterium tuberculosis Ag85B DNA vaccine in the preparation of preparations for regulating intestinal function in mice I. Materials and methods

[0039] 1. Main reagents

[0040] DL15000 DNA Marker (Takara Bio), restriction endonucleases HindⅢ and XbaI (NEB); kanamycin sulfate (Kan), IPTG, agarose, tryptone and yeast extract were purchased from Ningxia Kebo Biotechnology Co., Ltd.; plasmid mini-extraction kit and gel recovery kit were purchased from Tiangen Biochemical Technology Co., Ltd.; endotoxin-free plasmid large-scale extraction kit was purchased from Omega Bio-Tek; mouse anti-Ag85B monoclonal antibody was purchased from Beijing Bioson Biotechnology Co., Ltd.; Lipofectamine TM 3000 transfection agent was purchased from Thermo Fisher; protein marker was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; 1.25% Avertin anesthesia was purchased from Nanjing Aibei Biotechnology Co., Ltd., and HRP-labeled goat anti-mouse IgG secondary antibody was purchased from Merck, USA.

[0041] 2. Cell, strain, and plasmid construction

[0042] Chinese hamster ovary cells (CHO-K1) were purchased from the Chinese Academy of Medical Sciences.

[0043] First, the signal peptide gene sequence and the partial Rv1886c gene sequence encoding the 85B protein were synthesized into nucleotide chains, and then the nucleotide chains were connected between the HindⅢ and XbaI sites of the pcDNA3.1+ vector to construct the eukaryotic expression plasmid pcD-Ag85B, which is the Mycobacterium tuberculosis Ag85B DNA vaccine;

[0044] The signal peptide gene sequence is shown in SEQ ID NO.1;

[0045] SEQ ID NO.1:

[0046] AAGCTTACCATGGGGCGTTTGACCTCCGGCGTCGGGACGGCGGCCCTGCTAGTTGTCGCGGTGGGACTCCGCGTCGTCTGCGCC

[0047] The partial Rv1886c gene sequence of the 85B protein is shown in SEQ ID NO.2;

[0048] SEQ ID NO.2:

[0049] TTCTCCCGGCCGGGGCTGCCGGTCGAGTACCTGCAGGTGCCGTCGCCGTCGATGGGCCGCGACATCAAGGTTCAGTTCCAGAGCGGTGGGAACAACTCACCTGCGGTTTATCTGCTCGACGGCCTGCGCGCCCAAGACGACTACAACGGCTGGGATATCAACACCCCGGCGTTCGAGTGGTACTACCAGTCGGGACTGTCGATAGTCATGCCGGTCGGCGGGCAGTCCAGCTTCTACAGCGACTGGTACAGCCCGGCCTGCGGTAAGGCTGGCTGCCAGACTTACAAGTGGGAAACCTTCCTGACCAGCGAGCTGCCGCAATGGTTGTCCGCCAACAGGGCCGTGAAGCCCACCGGCAGCGCTGCAATCGGCTTGTCGATGGCCGGCTCGTCGGCAATGATCTTGGCCGCCTACCACCCCCAGCAGTTCATCTACGCCGGCTCGCTGTCGGCCCTGCTGGACCCCTCTCAGGGGATGGGGCCTAGCCTGATCGGCCTCGCGATGGGTGACGCCGGCGGTTACAAGGCCGCAGACATGTGGGGTCCCTCGAGTGACCCGGCATGGGAGCGCAACGACCCTACGCAGCAGATCCCCAAGCTGGTCGCAAACAaCACCCGGCTATGGGTTTATTGCGGGAACGGCACCCCGAACGAGTTGGGCGGTGCCAACATACCCGCCGAGTTCTTGGAGAACTTCGTTCGTAGCAGCAACCtGAAGTTCCAGGATGCGTACAACGCCGCGGGCGGGCACAACGCCGTGTTCAACTTCCCGCCCAACGGCACGCACAGCTGGGAGTACTGGGGCGCTCAGCTCAACGCCATGAAGGGTGACCTGCAGAGTTCGTTAGGCGCCCATCATCACCATCACCATTAATCTAGA

[0050] The nucleotide chain gene sequence obtained by synthesis is shown in SEQ ID NO.3;

[0051] SEQ ID NO.3:

[0052] AAGCTTACCATGGGGCGTTTGACCTCCGGCGTCGGGACGGCGGCCCTGCTAGTTGTCGCGGTGGGACTCCGCGTCGTCTGCGCCTTCTCCCGGCCGGGGCTGCCGGTCGAGTACCTGCAGGTGCCGTCGCCGTCGATGGGCCGCGACATCAAGGTTCAGTTCCAGAGCGGTGGGAACAACTCACCTGCGGTTTATCTGCTCGACGGCCTGCGCGCCCAAGACGACTACAACGGCTGGGATATCAACACCCCGGCGTTCGAGTGGTACTACCAGTCGGGACTGTCGATAGTCATGCCGGTCGGCGGGCAGTCCAGCTTCTACAGCGACTGGTACAGCCCGGCCTGCGGTAAGGCTGGCTGCCAGACTTACAAGTGGGAAACCTTCCTGACCAGCGAGCTGCCGCAATGGTTGTCCGCCAACAGGGCCGTGAAGCCCACCGGCAGCGCTGCAATCGGCTTGTCGATGGCCGGCTCGTCGGCAATGATCTTGGCCGCCTACCACCCCCAGCAGTTCATCTACGCCGGCTCGCTGTCGGCCCTGCTGGACCCCTCTCAGGGGATGGGGCCTAGCCTGATCGGCCTCGCGATGGGTGACGCCGGCGGTTACAAGGCCGCAGACATGTGGGGTCCCTCGAGTGACCCGGCATGGGAGCGCAACGACCCTACGCAGCAGATCCCCAAGCTGGTCGCAAACAaCACCCGGCTATGGGTTTATTGCGGGAACGGCACCCCGAACGAGTTGGGCGGTGCCAACATACCCGCCGAGTTCTTGGAGAACTTCGTTCGTAGCAGCAACCTGAAGTTCCAGGATGCGTACAACGCCGCGGGCGGGCACAACGCCGTGTTCAACTTCCCGCCCAACGGCACGCACAGCTGGGAGTACTGGGGCGCTCAGCTCAACGCCATGAAGGGTGACCTGCAGAGTTCGTTAGGCGCCCATCATCACCATCACCATTAATCTAGA。

[0053] 3. Experimental animals

[0054] Ten SPF-grade C57BL / 6J mice, female, 6-7 weeks old, weighing (18±1) g, were purchased from the Experimental Animal Center of Ningxia Medical University (certificate number: SCXK(Ning)2020-0001). All treatments of C57BL / 6J mice in this experiment were bred and used for scientific research purposes and were carried out in accordance with the relevant animal ethics regulations of Ningxia Medical University (2021-N019).

[0055] 4. Identification of eukaryotic expression plasmids

[0056] The constructed plasmid was transformed into DH5α competent cells, spread on LB plates containing kanamycin resistance, and cultured at 37°C overnight. A single colony was selected from the transformed kanamycin LB plate and inoculated into LB liquid medium containing kanamycin and cultured overnight. The plasmid was extracted using a small amount of plasmid extraction kit, double enzyme digestion was performed, and the plasmid was sent to Beijing Ruibo Xingke Biotechnology Co., Ltd. for sequencing. The expression plasmid was named pcD-Ag85B.

[0057] 5. Protein expression identification of pcD-Ag85B plasmid

[0058] (1) Large-scale extraction of pcD-Ag85B plasmid

[0059] Endotoxin-free plasmid extraction kit was used to extract endotoxin-free plasmid. The correctly identified eukaryotic expression plasmid pcD-Rv85B and empty vector plasmid pcDNA3.1+ were extracted, the concentration and purity were determined, and stored at -20°C for future use.

[0060] (2) Plasmid transfection into CHO cells

[0061] CHO cells were inoculated into a 12-well cell culture plate, and the cells were cultured with DMEM nutrient solution containing 10% fetal bovine serum until 80%-90% monolayer was reached. The supernatant was discarded, and the cells were washed with PBS buffer 2-3 times. The recombinant plasmid pcD-Rv85B was transfected into CHO cells according to the instructions of the liposome transfection reagent. After culturing in a 37°C, 5% CO2 incubator for 5 hours, new DMEM culture solution containing 10% fetal bovine serum was replaced and culture was continued for 48 hours.

[0062] (3) Western blot detection of Ag85B expression

[0063] 40 μl of CHO cell culture medium 48 hours after transfection was collected, and 5× sample buffer was added at a volume ratio of 1:4. The sample was loaded after boiling in a boiling water bath for 5 minutes. After separation by 12% SDS-PAGE, it was transferred to a PVDF membrane using a semi-dry electrotransfer instrument, blocked with 5% skim milk powder for 1 hour, and washed with TBST for 10 minutes for a total of 3 times. Mouse anti-Ag85B monoclonal antibody (1:1,000 dilution) was added; HRP-labeled rabbit anti-mouse IgG (1:2000) was added, and the membrane was shaken at 37°C for 60 minutes; ECL luminescent solution was added, and the results were analyzed after development and fixation.

[0064] 6. Animal immunization

[0065] After 1 week of adaptive feeding, the mice were randomly divided into PBS group (Blank group) and pcD-Rv85B recombinant plasmid immunization group (Ag85B group, 50 μg / mouse), with 5 mice in each group. The mice were immunized by thigh muscle injection, and the second immunization was performed 2 weeks after the first immunization, for a total of 2 immunizations.

[0066] 7. Collection of feces and colonic mucosa

[0067] 42 days after the initial immunization, all mice were fasted but not watered for 12 hours and then killed by cervical dislocation. First, the lower abdomen was squeezed and 3 feces were collected aseptically per mouse; second, the colon was cut open and 1 mL of pre-cooled PBS was slowly injected from the front end and collected from the back end, rinsed repeatedly 3 times, and then the supernatant was collected by centrifugation and stored in a -80° refrigerator for later use.

[0068] 8. Intestinal mucosal antibody titer detection

[0069] The indirect ELISA method was used. The Ag85B protein prepared in the early stage of this experiment was formulated into a 2 μg / mL solution and coated on multiple 96-well ELISA plates, 0.1 mL / well, overnight at 4°C; 2% BSA blocking solution was added, 0.1 mL / well, and allowed to stand at 37°C for 2 h; the plates were washed 4 times with TBST, and the centrifuged intestinal mucosal dilution was added (final concentrations were 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, and 1:64000), and a blank control and PBS negative control were set up, and the plates were incubated at 37°C for 1 h; HRP-labeled sheep anti-mouse SIgA (1:1000 dilution) was added, 0.1 mL / well, and incubated at 37°C for 40 min; the plates were washed with PBST, and substrate was added, 0.1 mL / well, and incubated at 37°C in the dark for 15 min; 50 μL 2 mol / L H2SO4 was added to each well to terminate the reaction, and A450 was measured by an ELISA reader. OD value. The highest sample dilution with the test well OD value / negative control OD value > 2.1 times is defined as the antibody titer

[10] .

[0070] 9. Fecal 16S RNA high-throughput sequencing and bacterial community structure analysis

[0071] The genomic DNA of fecal samples was extracted by CTAB method, and the purity and concentration of DNA were tested by agarose gel electrophoresis. Specific primers with barcodes were used. High-FidelityPCR Master Mix with GC Buffer and high-efficiency high-fidelity enzymes were used for PCR, and PCR products were detected by 2% agarose gel electrophoresis. Qualified PCR products were purified by magnetic beads, and the products were recovered using Qiagen's gel recovery kit. The library was constructed using the DNA PCR-Free Sample Preparation Kit. After the constructed library was quantified by Qubit and Q-PCR, it was sequenced on the NovaSeq6000. The above work was completed by Beijing Novogene Technology Co., Ltd. The Uparse algorithm was used to cluster all the Effective Tags of all samples, and the sequences with 97% consistency were clustered into OTUs (Operational Taxonomic Units). At the same time, the representative sequences of OTUs were selected, and the sequences with the highest frequency in OTUs were used as the representative sequences of OTUs. R software was used to analyze the differences between the Alpha diversity index and the Beta diversity index. After the Kruskal-Wallis test and the Wilcoxon rank sum test, the LDA Effect Size analysis method was used to analyze the differences in the intestinal flora. The LDA value >±2 indicated that the difference between the two groups was significant.

[0072] 10. Statistical analysis

[0073] GraphPad-Prism 5 statistical drawing software and SPSS 20.0 statistical analysis software were used to analyze and organize the experimental data. The measurement data were expressed as mean ± standard deviation. For measurement data with normal distribution and equal variance, the two groups were compared using a two-sample t-test. For the detection of logarithmic normal distribution data - antibody titer, a t-test was performed after logarithmic transformation. P < 0.05 was considered statistically significant.

[0074] 2. Results and Analysis

[0075] 1. Enzyme digestion identification of plasmid pcD-Ag85B

[0076] like Figure 1As shown, the double enzyme digestion (HindⅢ and Xbal) product of the eukaryotic recombinant expression plasmid pcD-Ag85B was analyzed by 1% agarose gel electrophoresis, and a band of about 1000 bp was observed, which was consistent with the expected size (963 bp). The gene sequencing results were completely consistent with the signal peptide gene and Rv1886c gene sequences, indicating that the plasmid was successfully constructed.

[0077] 2. Expression detection of Ag85B fusion protein

[0078] 48h after plasmid pcD-Ag85B was transfected into CHO cells, the cell supernatant was collected for Western blot. The results were as follows: Figure 2 As shown, a band appeared at about 35 kDa, which was consistent with the predicted size, while the empty vector did not show this band, indicating that the Ag85B protein expressed by the eukaryotic expression plasmid pcD-Ag85B in CHO cells can be secreted outside the cells.

[0079] 3. Effect of Ag85B protein on the titer of SIgA antibody in intestinal mucosa

[0080] Indirect ELISA results Figure 3 As shown, on day 42 after the first immunization, specific SIgA antibodies were detected in the intestinal mucosa of the immunized mice, with an average antibody titer of 1:4500, indicating that Ag85B protein induced humoral immune effects in the colon mucosa of mice.

[0081] 4. Effect of Ag85B protein on intestinal flora of mice

[0082] (1) Analysis of intestinal flora diversity in the two groups of mice

[0083] Rarefaction Curve and Rank Abundance are common curves that describe the diversity of samples within a group. Figure 4 , Figure A) can directly reflect the rationality of the sequencing data volume and indirectly reflect the species richness in the sample. Hierarchical clustering curve ( Figure 4 , Figure B) can directly reflect the species richness and uniformity in the sample. In the horizontal direction, the species richness is reflected by the width of the curve. The higher the species richness, the wider the curve on the horizontal axis. In the vertical direction, the smoothness of the curve reflects the uniformity of the species in the sample. The flatter the curve, the more uniform the species distribution. Figure 4(Figure B) It can be seen that the width of the curve of the Blank group is smaller than that of the Ag85B group, indicating that the species richness of the Ag85B group is higher than that of the Blank group. The OTU Venn diagram was used to analyze the number of bacterial OTUs and their species intersection. The total OTUs of the Blank group and the Ag85B group were 1071 and 1209, respectively, and the specific OTUs were 227 and 365, respectively, with a total of 844 OUTs, further indicating that the species richness of the intestinal flora in the Ag85B group increased ( Figure 4 , Figure C).

[0084] Shannon Index( Figure 4 , Figure D) The results showed that the α diversity of microorganisms in the Ag85B group was lower than that in the Blank group. β diversity analysis can be used to study the similarities and differences in the bacterial community structure in different samples. Commonly used analysis methods include sample hierarchical cluster analysis, principal coordinate analysis, and multidimensional scaling analysis. This experiment used the weighted_unifrac distance algorithm for principal coordinate analysis (PCoA) on all samples. Figure 4 As shown in (Figure E), Blank and Ag85B groups clustered separately with obvious differences, indicating that the intestinal flora structure of mice immunized with pcD-Ag85B vaccine was different from that of normal mice, indicating that the immune effect of Ag85B protein regulated the composition of the intestinal flora of mice. Figure 4 (Figure F) is a species evolutionary tree at the genus level. The representative sequences of the top 100 genera were obtained through multiple sequence comparison. The branches and sectors represent their corresponding phyla, and the stacked bar chart outside the sector represents the abundance distribution information of the genus in different samples. Compared with the Blank group, the abundance of Lactobacillus, Alistipes and Lachnospiraceae_NK4A136_group in the Ag85B group increased significantly, and all of them are probiotics.

[0085] (2) Species composition and differences of colonic flora in each group of mice

[0086] In order to further analyze the effect of Ag85B protein immunization on the dominant bacterial flora in the mouse colon. Figure 5 As shown in Figure A, the intestinal microbial composition of each group was mainly Bacteroidota, Firmicutes, unidentified_Bacteria, Verrucomicrobiota, Proteobacteria, etc. Compared with the Blank group, the relative abundance of Bacteroidetes decreased and the relative abundance of Firmicutes increased in the Ag85B group. At the genus level, Figure 5As shown in Figure B, the intestinal microbial composition of the two groups was mainly Bacteroides, Lachnospiraceae_NK4A136_group, Akkermansia, Alloprevotella, Alistipes, Rikenellaceae——RC9-gut-group, Geobacter, Turicibacter, Prevotellaceae_UCG_001 and Lactobacillus. Compared with the Blank group, the relative abundance of Lachnospiraceae_NK4A136_group, Alistipes, Geobacter and Lactobacillus in the Ag85 group increased, while the relative abundance of Alloprevotella, Akkermansia, Prevotellaceae_UCG_001, and Rikenellaceae——RC9-gut-group decreased, indicating that the immune effect of Ag85B affected the changes in the intestinal flora at the genus level. Figure 5 As shown in Figure C, the intestinal microbial composition of the two groups was mainly Akkermansia muciniphia, Geobacte anodireducens, Bacteroides_sartorii, Lactobacillus_murinus, Lactobacillus_johnsonii, Lachnospiraceae_bacterium_GAM79, Faecalibacterium_prausnitzii, bacterium_str._51885, Lactobacillus_reuteri and Bacteroides_vulgatus. Statistical analysis of the 10 main species in the Blank and Ag85B groups revealed that only Lactobacillus johnsonii and Lactobacillus reuteri were significantly different between the two groups (p<0.05). Figure 5 (Figure D)

[0087] It should be noted that the Ag85B DNA vaccine prepared by the present invention can also be used in model organisms such as rats, rabbits, pigs and dogs that have a close relationship with human germ lineage. Therefore, the Ag85B DNA vaccine prepared by the present invention has the potential for application in humans.

[0088] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0089] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Application of Mycobacterium tuberculosis Ag85B DNA vaccine in the preparation of a preparation for regulating intestinal function in mice, characterized in that: The Mycobacterium tuberculosis Ag85B DNA vaccine has the function of regulating the structure of intestinal flora; The preparation process of the Ag85B DNA vaccine is as follows: first, the signal peptide gene sequence and the partial Rv1886c gene sequence of the Ag85B protein are synthesized into a nucleotide chain, and then connected to the pcDNA3.1+ vector to construct a eukaryotic expression plasmid pcD-Ag85B, which is the Mycobacterium tuberculosis Ag85B DNA vaccine; The signal peptide gene sequence is shown in SEQ ID NO.1; The partial Rv1886c gene sequence of the Ag85B protein is shown in SEQ ID NO.2; The synthesized nucleotide chain gene sequence is shown in SEQ ID NO.

3.

2. The use of the Mycobacterium tuberculosis Ag85B DNA vaccine according to claim 1 in preparing a preparation for regulating intestinal function in mice, characterized in that: The Mycobacterium tuberculosis Ag85B DNA vaccine increased the relative abundance of Firmicutes in the intestinal flora, decreased the relative abundance of Bacteroidetes, and increased the relative abundance of Lactobacillus reuteri and Lactobacillus johnsonii.

3. Use of the Mycobacterium tuberculosis Ag85B DNA vaccine according to claim 2 in preparing a preparation for regulating intestinal function in mice, characterized in that: The Mycobacterium tuberculosis Ag85B DNA vaccine stimulates the body to produce a humoral immune effect: stimulating the intestinal mucosa to produce SIgA antibodies, with an average antibody titer of 1:4500.

4. The use of the Mycobacterium tuberculosis Ag85B DNA vaccine according to claim 3 in preparing a preparation for regulating intestinal function in mice, characterized in that: The immunization dose of the pcD-Ag85B recombinant plasmid is 50 μg / mouse.

Images