Escherichia coli zjut-mhol and application thereof in producing heme oxygenase-1

By optimizing the codons and mutagenesis of the mouse HO-1 gene, a high-yield Escherichia coli strain producing HO-1 was constructed, solving the problem of low HO-1 expression activity and achieving efficient preparation of HO-1 lyophilized powder to meet the needs of clinical drug research.

CN115975837BActive Publication Date: 2026-03-03ZHEJIANG UNIV OF TECH
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202210819968.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-12
Publication Date
2026-03-03
Estimated Expiration
2042-07-12

AI Technical Summary

Technical Problem

In existing technologies, HO-1 has low expression activity and low expression levels, which makes it difficult to meet the needs of HO-1-related functional research and clinical drug applications.

Method used

The mouse HO-1 gene was codon optimized and expressed in Escherichia coli. Through restriction endonuclease treatment and recombinant plasmid construction, combined with ultraviolet mutagenesis, a high-producing strain of Escherichia coli zjut-mho1 was obtained. After fermentation and induced expression, HO-1 lyophilized powder was obtained.

Benefits of technology

The enzyme activity of HO-1 was significantly improved, achieving efficient preparation of HO-1 with an enzyme activity of 122 U/g dry bacterial cells and 91.8 U/g lyophilized powder enzyme activity, meeting the needs of clinical drug research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115975837B_ABST
    Figure CN115975837B_ABST
Patent Text Reader

Abstract

The application discloses an escherichia coli zjut-mhol and application thereof in production of heme oxygenase-1, and a gene of mouse-derived HO-1 is synthesized and cloned by using a preferred codon optimization method, a gene recombinant escherichia coli capable of producing HO-1 is constructed, and a mutant strain with high enzyme activity and stable passage is obtained through ultraviolet mutagenesis, and the mutant strain can be applied to preparation of HO-1. The strain is cultured for enzyme production, and the bacterial body with intracellular active HO-1 is obtained, and the enzyme production activity is 122 U / g according to the mass of the dry bacterial body. The HO-1 freeze-dried powder is separated from the bacterial body, and the enzyme activity of the freeze-dried powder is 91.8 U / g.
Need to check novelty before this filing date? Find Prior Art

Description

(I) Technical Field

[0001] This invention relates to the preparation of heme oxygenase-1, and particularly to a strain of Escherichia coli zjut-mhol and its application in heme oxygenase-1. (II) Background Technology

[0002] Heme oxygenase (HO, EC 1.14.99.3) is the initiating and rate-limiting enzyme in the breakdown of heme, converting heme into biliverdin and iron ions (Fe). 2+ ) and carbon monoxide (CO), the reaction formula is shown in Figure 1 Heme (HO) is widely distributed in mammalian tissues, with the highest concentrations in the liver and kidneys, and is also found in some algal and plant cells. Currently, three isoenzymes of HO have been reported: HO-1, HO-2, and HO-3. HO-1 is the inducible form and is the main enzyme oxidizing heme to biliverdin; HO-2 is the constitutive form, but its expression level is low, and its function is thought to be related to the neural signaling role of carbon dioxide (CO); HO-3 was recently discovered, and while structurally similar to HO-2, its function in the breakdown of heme is weaker.

[0003] In recent years, the functions of HO-1 and its relationship with diseases have gradually become known. Firstly, HO-1 breaks down heme, preventing heme from damaging cells; the catalytic process consumes O2, reducing the generation of oxygen free radicals. Secondly, the catalytic product of HO-1, Fe... 2+ Fe, CO, and bilirubin play a protective role in tissue cells during oxidative stress, among which Fe 2+ It binds to proteins to form ferritin, and the formation of ferritin can reduce intracellular iron. 2+ The concentration of HO-1 can also upregulate the Fe concentration on the endoplasmic reticulum. 2+ Channels that promote intracellular Fe 2+ Pumped out to prevent Fe 2+ HO-1 mediates oxidative stress damage; furthermore, bilirubin, as a metabolite of HO-1, can effectively scavenge oxygen free radicals and prevent lipid peroxidation of cells. Moreover, free bilirubin is more effective than conjugated bilirubin in inhibiting the breakdown of low-density lipoprotein. In recent years, scholars from various countries have conducted extensive research on the functions of HO-1. Research results indicate that HO-1 has very important physiological effects in anti-inflammation, anti-oxidation, anti-apoptosis, and anti-proliferation, and it holds promise as an effective therapeutic drug for clinical application.

[0004] Currently, there are research reports and patent applications both domestically and internationally regarding the expression of algal or mouse-derived HO-1 in Escherichia coli. However, the expression activity and level of HO-1 remain low. Therefore, this invention uses the HO-1 gene nucleotide sequence from the mouse (Mus musculus) gene as a template. After codon optimization, the gene is expressed in Escherichia coli. Following UV mutagenesis and screening, a strain of HO-1 with significantly enhanced enzyme production activity was obtained. This strain can be used for fermentation to prepare HO-1. (III) Summary of the Invention

[0005] The purpose of this invention is to provide a *Escherichia coli* zjut-mhol with significantly enhanced heme oxygenase-1 (HO-1) activity and its application in heme oxygenase-1, which solves the problem that HO-1 can only be extracted from animal viscera at present, and provides highly active HO-1 for research on HO-1 related functions and as a clinical drug.

[0006] The technical solution adopted in this invention is:

[0007] This invention provides a high-yield HO-1 Escherichia coli zjut-mho1 strain, deposited at the Guangdong Provincial Center for Microbial Culture Collection, accession number: GDMCC No:62484, deposit date: May 18, 2022, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, postcode: 510075.

[0008] The *Escherichia coli* zjut-mho1 strain of this invention is obtained by the following steps:

[0009] (1) Based on the mouse (Mus musculus) HO-1 gene sequence (sequence shown in SEQ ID No.1) provided on NCBI (https: / / www.ncbi.nlm.nih.gov), the codons of E. coli were optimized (sequence shown in SEQ ID No.2), and a restriction endonuclease Nco I site was introduced at the 5′ end and a restriction endonuclease Xho I site was introduced at the 3′ end of the sequence. The mouse HO-1 gene containing Nco I / Xho I restriction sites was chemically synthesized.

[0010] (2) The synthesized HO-1 gene nucleotide sequence and plasmid vector pET-28a were digested with restriction endonucleases Nco I and Xho I, respectively. After electrophoresis and gel extraction, the target gene fragment and the open-circular plasmid vector pET-28a were ligated with T4 DNase and transformed into E. coli DH5α competent cells by heat shock. Positive transformants were screened, and the plasmid was extracted and double-digested to verify its correctness, thus obtaining the recombinant plasmid pET-28a-mho1 (see electrophoresis image). Figure 2 ).

[0011] (3) The pET-28a-mho1 recombinant plasmid prepared in step (2) was transformed into Escherichia coli BL21(DE3) competent cells by heat shock method, positive transformants were screened, and the recombinant bacteria was obtained and named Escherichia coli mho1 strain.

[0012] (4) Using Escherichia coli mho1 strain as the starting strain, the strain was mutagenized by ultraviolet irradiation and screened to obtain a strain with HO-1 production activity 25.9% higher than that of the starting strain, namely Escherichia coli zjut-mho1 strain.

[0013] This invention also relates to the application of the aforementioned *Escherichia coli* zjut-mho1 in the fermentation production of HO-1, wherein the application is as follows: *Escherichia coli* zjut-mho1 is inoculated into an enzyme-producing medium containing 50 μg / mL kanamycin (Kan) and cultured at 35–37°C with shaking at 180–200 rpm until OD is reached. 600 = 0.824–2.17 (preferably cultured at 37℃ and 200r / min in a shaker for 4h to OD) 600 =2.17), add isopropyl-β-D-thiogalactoside (IPTG) to a final concentration of 0.1–1.0 mmol / L (preferably 0.5 mmol / L), and induce culture at 25–30 °C and 180–200 r / min for 6–10 h until OD. 600 =2.35–8.21 (preferably induced in a shaker at 30℃ and 200r / min for 10h to OD) 600 =8.21), to obtain a culture medium containing HO-1, and collect wet bacterial cells by centrifugation; the wet bacterial cells are ultrasonically disrupted and then centrifuged to obtain cell lysate; the cell lysate is freeze-dried to obtain HO-1 lyophilized powder. The final concentration composition of the enzyme-producing culture medium is: yeast extract powder 20–30 g / L, peptone 10–12.5 g / L, glycerol 4–5 g / L, K2HPO4 10–12.5 g / L, KH2PO4 3–4 g / L, solvent is deionized water, pH 7.0–7.4.

[0014] Furthermore, before fermentation, the *Escherichia coli* zjut-mho1 is first cultured to prepare a seed culture, and the seed culture is inoculated into an enzyme-producing medium containing 50 μg / mL kanamycin at an inoculation amount of 3%–5% (preferably 3%).

[0015] Further, the method for obtaining HO-1 lyophilized powder is as follows: Escherichia coli zjut-mho1 culture medium is centrifuged at 4°C and 8000 r / min for 5–10 min, and the wet cells are collected and resuspended in 0.1 mol / L PBS buffer at pH 7.4. The cells are then disrupted by sonication (preferably on ice, power 300W, sonication for 2 seconds, interval 4 seconds, 200 cycles), centrifuged at 10000 r / min for 5–10 min at 4°C, and the supernatant is collected to obtain cell lysis buffer. The cell lysis buffer is then freeze-dried to obtain HO-1 lyophilized powder. The volume of the pH 7.4, 0.1 mol / L PBS buffer used is 5–12 mL / g based on the wet weight of the cells.

[0016] Furthermore, the cell lysate freeze-drying method is as follows: place the cell lysate in a clean culture dish (preferably 9 cm in diameter), freeze it at -80°C, and then transfer it to a freeze dryer at -40°C and a vacuum of 20 Pa to freeze until completely dry, to obtain HO-1 freeze-dried powder.

[0017] Furthermore, the method for expanding the seed culture of *E. coli* zjut-mho1 is as follows: At an inoculation rate of 1% (v / v), transfer frozen *E. coli* zjut-mho1 culture preserved in a 20% glycerol aqueous solution, or pick up *E. coli* zjut-mho1 slant cells twice with an inoculation loop, and inoculate into LB liquid medium containing 50 μg / mL Kan. Incubate at 37°C and 180 rpm for 10–12 h until OD (dose retardation). 600 =3.03–3.42, yielding the seed culture for expansion. The LB liquid medium composition is: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, solvent is deionized water, pH 7.2–7.4. The recombinant Escherichia coli zjut-mho1 bacterial culture frozen in 20% glycerol aqueous solution is prepared by culturing the bacteria in LB liquid medium at 37°C and 180 r / min for 12 h, then mixing it with an equal volume of 40% sterile glycerol aqueous solution and storing it at -80°C.

[0018] Furthermore, the preferred composition of the enzyme-producing culture medium is: 24 g / L yeast extract powder, 12 g / L peptone, 4 g / L glycerol, 12.5 g / L K2HPO4, 4 g / L KH2PO4, with deionized water as the solvent and pH 7.0.

[0019] Furthermore, the specific steps for producing HO-1 by fermentation of Escherichia coli zjut-mho1 include:

[0020] (1) The cryopreserved *Escherichia coli* zjut-mho1 cells were inoculated into LB slant medium containing 50 μg / mL Kan and cultured at 37°C for 24 h to obtain slant cells. The final concentration of the LB slant medium was: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 20 g / L agar, deionized water as solvent, pH 7.2–7.4, and sterilized by autoclaving at 121°C for 20 min.

[0021] (2) Pick two loops of the slant culture from step (1) or transfer 1% (v / v) of frozen *E. coli* zjut-mho1 culture stored in 20% glycerol aqueous solution and inoculate it into LB liquid medium containing 50 μg / mL Kan. Incubate at 37°C and 180 r / min for 10–12 h to obtain OD. 600 =3.03–3.42 seed liquid.

[0022] (3) At an inoculation rate of 3%–5% by volume, transfer the seed culture prepared in step (2) into an enzyme-producing medium containing 50 μg / mL Kan, and incubate at 35–37℃ and 150–200 r / min in a shaker for 3–4 h until OD. 600 =0.824–2.17, add IPTG to a final concentration of 0.1–1.0 mmol / L as an inducer, and incubate for 6–10 h in a shaker at 25–30 °C and 150–200 r / min to obtain OD. 600 =2.35–8.21 in culture medium.

[0023] (4) Collect the bacterial cells by centrifuging the culture medium from step (3) at 4°C and 8000 r / min for 5–10 min. Resuspend the bacterial cells in 5–12 mL of pH 7.4, 0.1 mol / L PBS buffer per gram of wet bacterial cell precipitate. Disrupt the cells by sonication under ice bath conditions (300 W power, 2 s sonication, 4 s interval, 200 cycles). Centrifuge at 4°C and 10000 r / min for 5–10 min, collect the supernatant, and obtain the cell lysate.

[0024] (5) Place the cell lysate obtained in step (4) into a sterile culture dish with a diameter of 9 cm, freeze it at -80°C, and then transfer it to a freeze dryer at -40°C and a vacuum degree of 20 Pa to freeze until completely dry, to obtain HO-1 lyophilized powder.

[0025] Compared with existing technologies, the beneficial effects of this invention are mainly reflected in the following: This invention synthesizes and clones the mouse-derived HO-1 gene optimized with preferred codons, constructs a recombinant Escherichia coli capable of producing HO-1, and obtains a mutant strain with high enzyme activity and stable passage through ultraviolet mutagenesis, which can be used for the preparation of HO-1. After enzyme-producing culture, this strain yields bacterial cells with intracellular HO-1 activity, with an enzyme activity of 122 U / g based on dry bacterial cell mass. HO-1 lyophilized powder is isolated from the bacterial cells, and the enzyme activity of the lyophilized powder is 91.8 U / g. (iv) Description of the attached drawings

[0026] Figure 1 The reaction formula for HO-1 participating in the catabolism of heme.

[0027] Figure 2 Electrophoresis image of recombinant plasmid pET-28a-mho1 after double digestion with Nco I / Xho I (M: Marker; 1: digestion product).

[0028] Figure 3 Photographs of Escherichia coli zjut-mho1 (a: Escherichia coli control with pET-28a; b: Escherichia coli mho1).

[0029] Figure 4 SDS-PAGE electrophoresis image of Escherichia coli mho1 strain expressing HO-1 (M: Marker; 1: Escherichia coli control carrying pET-28a; 2: Escherichia coli mho1 cell lysate).

[0030] Figure 5 Bilirubin concentration—A 450 The standard curve. (V) Detailed Implementation

[0031] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0032] In the following examples, unless otherwise specified, the experimental methods were performed in accordance with conventional molecular biology experimental methods, such as those described in "Molecular Biology Experiment Guide" (3rd edition, Science Press, 2015) edited by Wei Qun, or in accordance with the instructions of the kit.

[0033] In the embodiments of the present invention, LB slant medium, LB plate medium, LB liquid medium and enzyme-producing medium used for culturing recombinant Escherichia coli, Kan with a final concentration of 50 μg / mL was added before inoculation. Kan was added in the form of an aqueous solution with a concentration of 50 mg / mL.

[0034] The OD of the Escherichia coli culture medium described in this invention600 The value is the absorbance measured at 600 nm wavelength after diluting the culture medium with deionized water by a certain factor, multiplied by the dilution factor. The dilution factor should be based on the OD measured by the spectrophotometer. 600 Between 0.3 and 0.8, use uninoculated culture medium diluted by the same factor as a reference.

[0035] The culture medium used in the embodiments of this invention has the following composition:

[0036] The final concentration of LB slant culture medium was: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 20 g / L agar, with deionized water as the solvent, pH 7.2–7.4, and autoclaved at 121°C for 20 min.

[0037] The LB liquid medium consists of: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, and deionized water as the solvent, with a pH of 7.2-7.4. 20 mL of the medium is placed in a 100 mL Erlenmeyer flask, sealed with eight layers of gauze, and sterilized by autoclaving at 121°C for 20 minutes.

[0038] The enzyme-producing medium consisted of 24 g / L yeast extract, 12 g / L peptone, 4 g / L glycerol, 12.5 g / L K₂HPO₄, and 4 g / L KH₂PO₄. It was sterilized at 121°C for 20 minutes using deionized water as the solvent, with a pH of 7.0. 50 mL of the enzyme-producing medium was placed in a 250 mL Erlenmeyer flask, sealed with eight layers of gauze, and autoclaved at 121°C for 20 minutes.

[0039] Example 1: Construction of a recombinant Escherichia coli strain mho1 expressing the HO-1 gene

[0040] The recombinant Escherichia coli zjut-mho1 strain expressing HO-1 described in this invention is constructed according to the following steps:

[0041] (1) Based on the HO-1 sequence of mouse (Musmusculus) (GenBank: NM_010442.2:133-1002, nucleotide sequence shown in SEQ ID No. 1) provided by the NCBI (https: / / www.ncbi.nlm.nih.gov) database, the codon-optimized HO-1 gene sequence was obtained by E. coli preferred codon optimization (sequence shown in SEQ ID No. 2), and an Nco I restriction site CCATGG was introduced at the 5′ end and an Xho I restriction site CTCGAG was introduced at the 3′ end. The codon-optimized HO-1 gene sequence was chemically synthesized. The chemical synthesis of the gene sequence was completed by Sangon Biotech (Shanghai) Co., Ltd.

[0042] SEQ ID No. 1:

[0043] ATGGAGCGTCCACAGCCCGACAGCATGCCCCAGGATTTGTCTGAGGCCTTGAAGGAGGCCACCAAGGAGGTACACATCCAAGCCGAGAATGCTGAGTTCATGAAGAACTTTCAGAAGGGTCAGGTGTCCAGAGAAGGCTTTAAGCTGGTGATGGCTTCCTTGTACCATATCTACACGGCCCTGGAAGAGGAGATAGAGCGCAACAAGCAGAACCCAGTCTATGCCCCACTCTACTTCCCTGAGGAGCTGCACCGAAGGGCTGCCCTGGAGCAGGACATGGCCTTCTGGTATGGGCCTCACTGGCAGGAAATCATCCCTTGCACGCCAGCCACACAGCACTATGTAAAGCGTCTCCACGAGGTGGGGCGCACTCACCCTGAGCTGCTGGTGGCCCACGCATATACCCGCTACCTGGGTGACCTCTCAGGGGGTCAGGTCCTGAAGAAGATTGCACAGAAGGCCATGGCCTTGCCCAGCTCTGGGGAGGGCCTGGCTTTTTTTACCTTCCCGAACATCGACAGCCCCACCAAGTTCAAACAGCTCTATCGTGCTCGAATGAACACTCTGGAGATGACACCTGAGGTCAAGCACAGGGTGACAGAAGAGGCTAAGACCGCCTTCCTGCTCAACATTGAGCTGTTTGAGGAGCTGCAGGTGATGCTGACAGAGGAACACAAAGACCAGAGTCCCTCACAGATGGCGTCACTTCGTCAGAGGCCTGCTAGCCTGGTGCAAGATACTGCCCCTGCAGAGACACCCCGAGGGAAACCCCAGATCAGCACTAGCTCATCCCAGACACCGCTCCTCCAGTGGGTCCTCACTCTCAGCTTCCTGTTGGCAACAGTGGCAGTGGGAATTTATGCCATGTAA

[0044] SEQ ID No.2:

[0045] ATGGAGCGTCCGCAGCCGGATTCTATGCCGCAGGATCTGTCTGAAGCACTGAAAGAGGCGACCAAGGAAGTTCACATTCAGGCAGAAAACGCTGAATTTATGAAAAACTTTCAGAAAGGTCAGGTTAGCCGTGAAGGTTTCAAGCTGGTGATGGCGTCTCTGTACCACATCTATACTGCGCTGGAAGAAGAAATCGAACGCAACAAACAGAACCCGGTTTACGCACCGCTGTACTTCCCGGAAGAACTGCATCGTCGTGCAGCGCTGGAACAGGATATGGCATTCTGGTACGGTCCGCACTGGCAGGAAATCATTCCGTGTACTCCGGCAACTCAGCACTACGTTAAACGTCTGCACGAAGTTGGTCGTACTCACCCGGAACTGCTGGTTGCACACGCGTACACCCGTTACCTGGGTGACCTGTCCGGTGGTCAGGTTCTGAAAAAAATTGCACAGAAAGCTATGGCACTGCCGTCTTCTGGTGAAGGTCTGGCTTTTTTCACTTTCCCGAACATTGATTCTCCGACCAAATTCAAACAGCTGTACCGTGCGCGCATGAACACTCTGGAAATGACCCCGGAAGTTAAACACCGTGTTACCGAGGAGGCAAAAACCGCTTTCCTGCTGAACATCGAACTGTTCGAAGAACTGCAGGTTATGCTGACCGAAGAGCACAAAGATCAGTCTCCGAGCCAGATGGCAAGCCTGCGCCAACGTCCGGCATCTCTGGTTCAGGATACTGCTCCGGCAGAAACCCCGCGTGGTAAACCGCAGATCTCTACCTCCTCTTCCCAGACCCCGCTGCTGCAGTGGGTTCTGACCCTGTCTTTCCTGCTGGCGACCGTAGCTGTCGGTATCTACGCAATGTAA.

[0046] (2) The HO-1 gene sequence described in step (1) and the expression plasmid vector pET-28a were digested with restriction endonucleases Nco I and Xho I, respectively. After the digestion products were recovered by electrophoresis gel excision, the target gene fragment and the plasmid vector were ligated using T4 DNA ligase to obtain the recombinant plasmid. The recombinant plasmid was transformed into E. coli DH5α competent cells by heat shock method, positive transformants were screened, and the recombinant plasmid was extracted for restriction enzyme digestion identification. The results showed that the sequence size (870 bp) was consistent with the target sequence size (see electrophoresis image). Figure 2 Sequencing confirmed that the inserted sequence was correct, and the recombinant plasmid pET-28a-mho1 was obtained.

[0047] (3) The recombinant plasmid pET-28a-mho1 obtained in step (2) was transformed into Escherichia coli BL21(DE3) competent cells by heat shock, and positive transformants were screened to obtain recombinant Escherichia coli containing the HO-1 gene of recombinant plasmid pET-28a-mho1, which was named Escherichia coli mho1 strain.

[0048] (4) Pick a single colony of Escherichia coli mho1 and inoculate it into LB liquid medium, and incubate at 37℃ and 180 r / min for 4 h (OD). 600 =0.824), add IPTG to a final concentration of 0.5 mmol / L, and induce culture at 25℃ and 180 r / min for 8 h until OD. 600 =2.35.

[0049] (5) Collect the bacterial cells by centrifuging 45 mL of the culture medium from step (4) at 4°C and 8000 r / min for 10 min (see bacterial cell photo). Figure 3 0.265 g of wet bacterial cells were obtained. The cells were resuspended in 2 mL of 0.1 mol / L PBS buffer (pH 7.4). The cells were then sonicated under ice bath conditions (300 W power, 2 s operation, 4 s interval, 200 operations). After centrifugation at 10000 r / min for 10 min at 4 °C, the supernatant was collected to obtain a clear cell lysate.

[0050] (6) Perform SDS-PAGE protein electrophoresis analysis on the cell lysate prepared in step (5) (see...) Figure 4 The results showed that the recombinant bacteria expressed a protein with a molecular weight of approximately 33 kDa, which is consistent with the molecular weight of HO-1 (32.9 kDa), indicating that the recombinant E. coli that can express the HO-1 gene was successfully constructed.

[0051] The restriction endonucleases Nco I and Xho I, and T4 DNA ligase were purchased from Dalian Takara Bio Inc. Plasmid pET-28a, Escherichia coli DH5α strain and BL21(DE3) strain, DNA gel extraction kit, and plasmid mini-preparation kit were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0052] Example 2: Expression of HO-1 by Escherichia coli mho1 strain

[0053] The culture method for expressing HO-1 using Escherichia coli mho1 strain can be performed according to the following steps:

[0054] (1) The slant cells of Escherichia coli mho1 strain stored at 4℃ were inoculated into LB slant medium containing 50 μg / mL Kan and cultured at 37℃ for 24 h to obtain fresh slant cells.

[0055] (2) Pick two loops of the slant cells from step (1) and inoculate them into 20 mL of LB liquid medium containing 50 μg / mL Kan. Incubate at 37°C and 180 r / min for 12 h to obtain OD. 600 =3.42 seed liquid.

[0056] (3) At an inoculation rate of 3% by volume, transfer 1.5 mL of the seed culture prepared in step (2) into 50 mL of LB liquid medium and incubate at 37°C and 180 r / min for 3 h (OD). 600 =1.90), IPTG was added to a final concentration of 0.5 mmol / L as an inducer, and the expression was cultured in a shaker at 25℃ and 180 r / min for 6 h to obtain OD. 600 =3.46 culture medium.

[0057] (4) Take 45 mL of the culture medium from step (3), centrifuge at 4℃ and 8000 r / min for 10 min to collect the cells, and obtain 0.387 g of wet cells. Resuspend the cells in 4.5 mL of pH 7.4, 0.1 mol / L PBS buffer, and sonicate the cells under ice bath conditions (300 W power, 2 s working time, 4 s interval, 200 times). Centrifuge at 4℃ and 10000 r / min for 10 min, and take the supernatant to obtain clear cell lysate. Measure the HO-1 activity of the lysate. The HO-1 activity of Escherichia coli mho1 cell lysate was measured to be 0.126 U / mL based on the fermentation liquid volume and 96.9 U / g based on the dry cell mass.

[0058] The method for determining HO-1 activity is as follows: 200 μL of the cell lysis buffer, 50 μL of 0.5 mmol / L heme chloride solution, 449 μL of 0.1 mol / L pH 7.4 PBS buffer, 40 μL of 10.0 g / L bovine serum albumin aqueous solution, 50 μL of 40 mmol / L D-glucose-6-phosphate disodium (G-6-P-Na2) solution, 1 μL of 1 U / μL glucose-6-phosphate dehydrogenase (G-6-PD) solution, 10 μL of 20 mmol / L NADPH solution, and 200 μL of crude biliverdin reductase enzyme solution. After mixing the above solutions thoroughly in a test tube (this is the reaction system), incubate at 37°C for 30 min. Measure the A content of the sample before and after the reaction. 450 , by bilirubin-A 450 Standard curve ( Figure 5 The concentration C of bilirubin generated in the system was calculated. 胆红素 Then calculate the enzyme activity of HO-1 using the following formula.

[0059]

[0060] In the formula: C 胆红素 — The bilirubin concentration in the reaction system, calculated from the bilirubin standard curve, in μg / mL; V1 — the total volume of the enzyme reaction system, i.e., 1 mL; V2 — the volume of cell lysis buffer added to the reaction system, i.e., 0.2 mL; T — the reaction time, i.e., 30 min.

[0061] The definition of HO-1 activity: In a buffer system at 37°C and pH 7.4, under the condition of excess biliverdin reductase, the amount of enzyme that catalyzes the conversion of heme into 1 μg of bilirubin per minute is defined as one activity unit (U).

[0062] The 0.5 mmol / L heme chloride solution was prepared by dissolving in DMSO and stored in a brown bottle protected from light at 4°C. The 0.1 mol / L, pH 7.4 PBS buffer was prepared by mixing 0.1 mol / L NaH₂PO₄ and 0.1 mol / L Na₂HPO₄ aqueous solutions at a volume ratio of 19:81. The 40 mmol / L G-6-P-Na₂ solution, 1 U / μL G-6-PD solution, and 20 mmol / L NADPH solution were all prepared using sucrose-containing Tris-HCl buffer. The sucrose-containing Tris-HCl buffer was prepared by adding 8.557 g of sucrose to 100 mL of 20 mmol / L, pH 7.4 Tris-HCl buffer and stored at 4°C.

[0063] The crude biliverdin reductase solution is prepared by using biliverdin reductase-producing Escherichia coli zjut-bvr strain (GDMCC NO: 61045) as a cell lysate according to steps (1)–(4) of this embodiment. For the specific preparation method, please refer to the Chinese invention patent “Escherichia coli zjut-bvr and its application in the preparation of biliverdin reductase (ZL202010912807.8)”.

[0064] Example 3: Mutagenesis and selection to obtain Escherichia coli strain zjut-mho1

[0065] The *E. coli* zjut-mho1 strain was obtained through mutagenesis and screening using the following method:

[0066] (1) Cell preparation: Two loops of Escherichia coli mho1 strain slant were inoculated into 20 mL of LB liquid medium and cultured at 37 °C and 180 r / min for 12 h with shaking. 1 mL of the bacterial solution was taken into a centrifuge tube, centrifuged at 8000 r / min for 5 min, the supernatant was discarded, and an equal volume of sterile physiological saline (0.85% NaCl aqueous solution) was added to resuspend the bacterial cells. The cells were then centrifuged again at 8000 r / min for 5 min to collect the cells. This washing process was repeated once. The cells were then resuspended in 10 mL of sterile physiological saline in a 50 mL Erlenmeyer flask for later use.

[0067] (2) Mutagenesis: Take six sterile culture dishes with a diameter of 6 cm and add 1 mL of the above bacterial suspension to each. Open the lid of the culture dish and irradiate it under a 20W ultraviolet lamp at a distance of 30 cm for 0, 30, 45, 60, 75, and 90 s respectively. Dilute each bacterial suspension with sterile physiological saline to 1×10⁻⁶. -3 –1×10 -7 Take 0.1 mL of the diluted bacterial solution and spread it onto LB agar plates. Wrap the plates in black cloth and incubate at 37°C for 24 hours. The final concentration of the LB agar plate is the same as that of the LB slant medium. After autoclaving at 121°C for 20 minutes, cool to approximately 50°C, add Kan to a final concentration of 50 μg / mL, shake well, and pour 20 mL into sterile petri dishes with a diameter of 9 cm. Cool and set aside.

[0068] The above plate colony counting results showed that the lethality gradually increased with the extension of ultraviolet irradiation time, reaching 90% after 75s of irradiation. It is generally believed that the mutagenesis effect is better when the lethality rate is between 90% and 99.9% (Shi Qiaoqin, Wu Songgang. Industrial Microbial Breeding [M]. Beijing: Science Press, 2013). Therefore, mutant colonies were picked from plates after 75s and 90s of ultraviolet irradiation.

[0069] (3) Screening: Single colonies were picked from the plates after UV irradiation and mutagenesis, transferred to LB slant medium, and cultured at 37℃ for 24h. Then, the bacterial cells were picked and inoculated into LB liquid medium and cultured at 37℃ and 180r / min for 3h. IPTG with a final concentration of 0.5mmol / L was added as an inducer and expressed in a shaker at 25℃ and 180r / min for 6h. The HO-1 enzyme activity was determined according to the method in Example 2. The top 10 mutant strains with relatively high enzyme activity were selected from the screened strains for rescreening (3 replicates for each strain). The HO-1 production activity of the 10 rescreened strains is shown in Table 1.

[0070] Table 1. Enzyme production activity of mutant strains subjected to UV mutagenesis (based on dry cell weight) after rescreening

[0071]

[0072]

[0073] After secondary screening, strain mho1-uv-32 showed a significant increase in enzyme activity, rising by 25.9% compared to the original strain. After five subcultures on LB slant medium, the HO-1 production activity of mho1-uv-32 remained stable. This strain was renamed *Escherichia coli* zjut-mho1 and deposited with the Guangdong Provincial Microbial Culture Collection Center (GDMCC No. 62484) on May 18, 2022. The address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, 510075, China.

[0074] Escherichia coli zjut-mho1 was cultured in LB liquid medium at 37°C and 180 r / min for 12 h. The culture medium was then mixed with an equal volume of 40% sterile glycerol aqueous solution and stored at -80°C.

[0075] Example 4: Escherichia coli zjut-mho1 producing HO-1 under preferred conditions

[0076] Based on the *E. coli* strain zjut-mho1 capable of producing HO-1 obtained in Example 3, the expression conditions for HO-1 production by this strain were optimized. After optimization, the expression level of HO-1 was significantly increased. The culture method steps for the optimized *E. coli* zjut-mho1 strain to produce HO-1 are as follows:

[0077] (1) Transfer 0.2 mL of the *Escherichia coli* zjut-mho1 glycerol culture prepared in Example 3 and inoculate it into 20 mL of LB medium at a volume fraction of 1%. Incubate at 37°C and 200 r / min in a shaker for 10 h to obtain OD. 600 =3.03 zjut-mho1 seed solution.

[0078] (2) Transfer 2.5 mL of the seed culture prepared in step (2) and inoculate it into 50 mL of enzyme-producing medium at an inoculation rate of 5% by volume. Incubate at 37°C and 200 r / min for 4 h. (OD) 600 =2.17), add IPTG to a final concentration of 0.5 mmol / L as an inducer, and induce culture for 10 h at 30℃ and 200 r / min in a shaker (OD). 600 =8.21).

[0079] (3) Take 45 mL of the culture medium from step (2), centrifuge at 4°C and 8000 r / min for 10 min to collect the cells, and obtain 0.933 g of wet cells. Add 5 mL of pH 7.4, 0.1 mol / L PBS buffer to resuspend the cells. Under ice bath conditions, sonicate the cells (300 W power, 2 s working time, 4 s interval, 200 times). Centrifuge at 4°C and 10000 r / min for 10 min, and take the supernatant to obtain a clear cell lysate. Determine the HO-1 activity of the lysate according to the method in Example 2.

[0080] According to the method of this embodiment, the HO-1 activity of Escherichia coli mho1 cell lysate was measured to be 0.374 U / mL based on fermentation broth volume and 121 U / g based on dry cell mass.

[0081] Example 5: Preparation of HO-1 lyophilized powder

[0082] Following the method in Example 4, Escherichia coli zjut-mho1 cells expressing HO-1 were cultured, and HO-1 lyophilized powder was prepared according to the following steps:

[0083] (1) Prepare OD according to the method in Example 4 600 100 mL of culture medium with a pH of 8.16 was centrifuged at 4°C and 8000 rpm for 10 min to collect the bacterial cells, yielding 1.93 g of wet bacterial cells. 10 mL of 0.1 mol / L PBS buffer (pH 7.4) was added, and the cells were sonicated under ice bath conditions (300 W power, 2 s operation, 4 s interval, 200 operations). After centrifugation at 4°C and 10000 rpm for 10 min, a clear cell lysate was obtained.

[0084] (2) All the HO-1 cell lysate prepared in step (1) was placed in a 9cm sterile culture dish, frozen at -80℃, and then transferred to a freeze dryer at -40℃ and a vacuum of 20Pa for freeze drying to obtain 366mg of HO-1 crude enzyme solution lyophilized powder. The enzyme activity of the HO-1 lyophilized powder was 91.8U / g.

Claims

1. Escherichia coli (E. coli) Escherichia coli zjut-mho1, deposited at Guangdong Provincial Center for Microbial Culture Collection, accession number: GDMCC No: 62484, deposited on May 18, 2022, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, postcode: 510075.

2. The use of the E. coli zjut-mhol of claim 1 in the fermentation production of heme oxygenase-1, characterized in that, The application is that E. coli zjut-mho1 is inoculated into an enzyme-producing medium containing 50 μg / mL kanamycin, and is cultured at 35-37℃ and 180-200 r / min until OD 600 =0.824-2.17, 0.1-1.0 mmol / L IPTG is added to obtain a final concentration, and the culture is induced at 25-30℃ and 180-200 r / min until OD 600 =2.35-8.21, a culture solution containing heme oxygenase-1 is obtained, wet bacteria are collected by centrifugation, the wet bacteria are ultrasonically broken, and a cell lysate is obtained by centrifugation; the cell lysate is freeze-dried to obtain a heme oxygenase-1 freeze-dried powder; and the enzyme-producing medium has a final composition of 20-30 g / L yeast extract powder, 10-12.5 g / L proteose peptone, 4-5 g / L glycerol, 10-12.5 g / L K2HPO4, 3-4 g / L KH2PO4, and deionized water as a solvent, and has a pH of 7.0-7.

4.

3. Use according to claim 2, wherein the compound is ###0002### Before the Escherichia coli zjut-mho1 is fermented, seed liquid is prepared through seed amplification culture, and the seed liquid is inoculated into enzyme production medium containing 50 μg / mL kanamycin at a volume concentration of 3%-5%.

4. The use according to claim 2, wherein The method for obtaining the hemin oxygenase-1 freeze-dried powder is as follows: the culture solution containing hemin oxygenase-1 is centrifuged at 8000 r / min for 5-10 min at 4 ℃, the wet bacteria are collected, and then resuspended with PBS buffer solution with pH 7.4 and 0.1 mol / L; the bacteria are broken by ultrasonic waves, the supernatant is collected by centrifugation at 10000 r / min for 5-10 min at 4 ℃, and the cell lysate is obtained; the cell lysate is freeze-dried to obtain the hemin oxygenase-1 freeze-dried powder; the ultrasonic breaking condition is as follows: power 300 W, ultrasonic 2 s, interval 4 s, and work 200 times.

5. The use according to claim 4, wherein the compound is ###0002### The freeze-drying method of the cell lysate is as follows: the cell lysate is placed in a clean culture dish, frozen with a freezing ice at-80 ℃, and then transferred into a freeze-drying machine with a vacuum degree of 20 Pa at-40 ℃ to freeze until completely dried, so as to obtain the hemin oxygenase-1 freeze-dried powder.

6. The use according to claim 3, wherein the compound is ###0002### The seed expansion culture method of the E. coli zjut-mho1 is as follows: 20% glycerol aqueous solution frozen E. coli zjut-mho1 bacterial liquid is removed with a volume concentration of 1% inoculation amount, or E. coli zjut-mho1 slope bacterial bodies are inoculated twice, inoculated into LB liquid medium containing 50 μg / mL kanamycin, and cultured at 37°C, 180 r / min in a shaking bed for 10-12 h to OD 600 =3.03-3.42, to obtain the expanded seed liquid; the LB liquid medium is composed of 10 g / L proteose peptone, 5 g / L yeast extract powder, 10 g / L NaCl, and deionized water as a solvent, and has a pH of 7.2-7.

4.

7. The use according to claim 2, wherein the compound is ###0002### The enzyme production medium comprises the following components: yeast extract powder 24 g / L, peptone 12 g / L, glycerol 4 g / L, K2HPO4 12.5 g / L, KH2PO4 4 g / L, and deionized water as a solvent, and the pH is 7.0.

Citation Information

Patent Citations

  • Expression and purification method of heme oxygenase-1, and epitopes thereof

    CN101870981A

  • Recombinant escherichia coli zjut-ho1 and application thereof in preparation of biliverdin

    CN109182232A

  • Escherichia coli zjut-bvr and application thereof in preparation of biliverdin reductase

    CN112143691A