Genetically engineered bacteria capable of efficiently secreting and expressing the key antigen P72 of African swine fever virus and its construction method and application

Abstract

The present invention discloses a genetically engineered bacterium with efficient secretory expression of the key antigen P72 of African swine fever virus and its construction method and application. The genetically engineered bacterium uses Bacillus amyloliquefaciens as a starting strain, and the signal peptide nucleotide sequences encoding proteases yow, AprE, and NprE are fused with the optimized and modified nucleotide sequences encoding antigen P72 to form new fusion genes SyP72, SAP72, and SNP72, which are transformed into Bacillus amyloliquefaciens to obtain three genetically engineered strains. The optimal engineering strain constructed by the present invention is fermented and cultured in an optimized culture medium, and the expression of recombinant antigen P72 is successfully detected in the fermentation broth by SDS-PAGE electrophoresis and Western Blot, and the protein content reaches 4.5mg / mL; through oral and intragastric gavage experiments, the expressed recombinant antigen P72 can effectively stimulate the production of mouse P72 antibodies.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a genetically engineered bacterium capable of efficiently secreting and expressing the key antigen P72 of the African swine fever virus, and a construction method and application thereof. Background Art

[0002] Bacillus is a Gram-positive bacterium. It has only one membrane structure and can directly secrete extracellular enzymes into the culture medium without cell disruption and intracellular protein contamination, which is conducive to subsequent separation and purification. Bacillus has the characteristics of strong acid and alkali resistance, high temperature resistance, high pressure resistance, oxidation resistance, rapid resurrection and strong secretion of enzymes. It also has a perfect secretion system and can directly secrete many proteins into the culture medium. It also has unique innate advantages in the efficient and economical preparation of recombinant proteins. At present, the Bacillus expression system has been successfully used for the large-scale preparation of exogenous proteins such as enzyme preparations and polypeptide drugs. Therefore, Bacillus is an ideal secretory expression host.

[0003] The p72 protein is a viral capsid protein encoded by the B646L gene of ASFV. The gene is 1941bp long, the protein size is 71.19kDa, the protein sequence is highly conserved, and it has good immunogenicity, making it one of the main antigens for detecting infected pigs. Therefore, achieving efficient expression of this antigen has a positive effect on the development of vaccines. The signal peptide is generally located at the N-terminus of the peptide chain and is divided into three regions: the positively charged n region (1-3 residues), the hydrophobic region (7-15 residues) that is mainly composed of neutral amino acids and can form an α-helical structure, and the processing region (3-7 residues) where the negatively charged signal peptidase cuts the signal peptide. As a commonly used protein secretion host, Bacillus contains a wealth of signal peptide sequence resources, including alkaline proteases, amylases, proteases, metalloproteases and other types of signal peptides. At present, antigen protein P72 is usually obtained by transforming Escherichia coli into genetically engineered strains. The proteins expressed by these genetically engineered strains are intracellular proteins. During purification, intracellular proteins need to be released by means of cell disruption, accompanied by a large amount of impurities such as foreign proteins, which seriously affect the subsequent separation and purification. Escherichia coli is a Gram-negative bacterium, and the resulting cell disruption solution contains a large amount of endotoxins. Incomplete removal will seriously affect its medical effect. Summary of the invention

[0004] Purpose of the invention: In view of the problems existing in the prior art, the present invention provides a genetically engineered bacterium with the ability to efficiently secrete and express the key antigen P72 of African swine fever virus, which can efficiently and stably secrete and express the antigen P72 in a Bacillus host. The present invention uses Bacillus amyloliquefaciens as a host bacterium to solve the problem of the presence of a large amount of endotoxin in the protein crushing liquid when the protein is expressed in Escherichia coli. Adding a signal peptide to the target gene to guide the secretion of exogenous protein to the extracellular space can effectively reduce impurities, and the reduction of protein purification steps reduces the loss rate of antigen protein.

[0005] The present invention also provides a construction method and application of the genetically engineered bacteria capable of efficiently secreting and expressing the key antigen P72 of the African swine fever virus.

[0006] Technical solution: In order to achieve the above-mentioned purpose, the genetically engineered bacteria of the present invention that can efficiently secrete and express the key antigen P72 of African swine fever virus, use Bacillus amyloliquefaciens as the starting strain, and fuse the signal peptide nucleotide sequences encoding the proteases yow, AprE, and NprE with the optimized and modified nucleotide sequences encoding the antigen P72 to form new fusion genes SyP72, SAP72, and SNP72, which are transformed into Bacillus amyloliquefaciens to obtain three genetically engineered strains, and the nucleotide sequences of the fusion genes SyP72, SAP72, and SNP72 are shown in SEQ ID NO.1-3.

[0007] Among them, the signal peptide nucleotide sequences of the proteases yow, AprE, and NprE are shown in SEQ ID NOs:4-6, and the optimized and modified nucleotide sequence encoding the antigen P72 is shown in SEQ ID NO:7.

[0008] Wherein, the Bacillus amyloliquefaciens is Bacillus amyloliquefaciens CPLK1314.

[0009] The method for constructing a genetically engineered Bacillus capable of efficiently secreting and expressing the key antigen P72 of African swine fever virus of the present invention comprises the following steps:

[0010] (1) The P72 protein nucleotide sequence was optimized and transformed and fused with the signal peptide nucleotide sequences encoding the proteases yow, AprE, and NprE to form new fusion genes SyP72, SAP72, and SNP72;

[0011] (2) The SyP72, SAP72, and SNP72 gene fragments were double-digested with the constitutive expression vector pTK-PrepUT1T2, and then ligated and transformed to obtain the recombinant secretory expression vectors pTK-SyP72, pTK-SAP72, and pTK-SNP72;

[0012] (3) The recombinant secretory expression vectors pTK-SyP72, pTK-SAP72, and pTK-SNP72 were respectively transferred into Bacillus amyloliquefaciens to construct three genetically engineered Bacillus strains, yP72, AP72, and NP72, which can secrete and express the key antigen P72 of African swine fever virus.

[0013] Among them, the nucleotide sequences of the recombinant secretory expression vectors pTK-SyP72, pTK-SAP72, and pTK-SNP72 in step (2) are shown in SEQ ID NOs: 8-10.

[0014] The invention relates to the use of the genetically engineered bacteria in secretory expression of the key antigen P72.

[0015] In the application process, the genetically engineered bacteria yP72, AP72, and NP72 were inoculated into an optimized culture medium for activation overnight, and then inoculated into the optimized culture medium for fermentation and culture. The supernatant was collected by centrifugation, and the expression of the recombinant antigen P72 was successfully detected in the fermentation broth. The yP72 protein content reached 4.5 mg / mL, the AP72 protein content reached 2 mg / mL, and the NP72 protein content reached 1.5 mg / mL; the genetically engineered bacteria yP72 was the optimal genetically engineered bacteria, and the signal peptide of the protease yow was most suitable for the antigen P72, which could maximize the secretion rate of the antigen.

[0016] The optimized culture medium comprises: 20 g / L soybean cake powder, 2 g / L trypsin, 1.5 g / L yeast extract, 0.5 g / L NaCl, 0.002 g / L magnesium sulfate, 0.001 g / L manganese sulfate, 0.0016 g / L potassium dihydrogen phosphate, and pH 7.0.

[0017] The application of the genetically engineered bacteria described in the present invention in the preparation of oral vaccines for preventing African swine fever.

[0018] The present invention fuses the signal peptide nucleotide sequences encoding proteases yow, AprE and NprE with the optimized and modified nucleotide sequence encoding antigen P72 to form new fusion genes SyP72, SAP72 and SNP72, and then connects them with the constitutive expression vector pTK-PrepUT1T2 to obtain recombinant secretory expression vectors pTK-SyP72, pTK-SAP72 and pTK-SNP72. The recombinant secretory expression vectors pTK-SyP72, pTK-SAP72 and pTK-SNP72 are transferred into Bacillus amyloliquefaciens CPLK1314 through chemical transformation to construct a genetically engineered bacterium that secretes and expresses the key antigen P72 of African swine fever virus.

[0019] For example, the fusion gene SyP72 carries a signal peptide nucleotide sequence encoding the protease yow. The signal peptide can guide the expression and secretion of the optimized and modified antigen P72 to the extracellular space. The antigen P72 secreted to the extracellular space has good solubility and biological activity, and can effectively avoid degradation by intracellular proteases. At the same time, downstream purification does not require cell disruption, and the supernatant can be directly purified.

[0020] Among them, in the constitutive expression vector pTK-PrepUT1T2, T1T2 is a terminator, and PrepU is a constitutive promoter that does not require any inducer and can drive the downstream gene to stably and continuously express the target protein.

[0021] Among them, the constitutive expression vector pTK-PrepUT1T2 is clearly described in the previously applied Chinese patent 202111680804.7. The fusion gene SyP72 and others were artificially synthesized by (Shanghai Shenggong Bioengineering Co., Ltd.). Bacillus amyloliquefaciens CPLK1314, deposit number CCTCCNO: M2017658.

[0022] Preferably, the signal peptide nucleotide sequences encoding proteases yow, AprE, and NprE are fused with the optimized and modified nucleotide sequences encoding antigen P72 to form new fusion genes SyP72, SAP72, and SNP72, and sent to Shanghai Shenggong Biotechnology Co., Ltd. for artificial total synthesis, and the plasmid pTK-PrepUT1T2 double-digested with restriction endonucleases BamHⅠ / EcoRI and the artificially synthesized fusion genes SyP72, SAP72, and SNP72 are mixed with T4 ligase and connected at a constant temperature of 16°C overnight. The ligation product is transformed into competent DH5α, the correct transformant is screened by resistance, and then the plasmid pTK-SyP72, pTK-SAP72, and pTK-SNP72 are extracted by shaking bacteria, and the recombinant secretory expression vectors pTK-SyP72, pTK-SAP72, and pTK-SNP72 are successfully obtained. Prepare Bacillus amyloliquefaciens competent cells, transform the recombinant secretory expression vectors pTK-SyP72, pTK-SAP72, and pTK-SNP72 into Bacillus amyloliquefaciens competent cells, screen the correct transformants through the resistance gene, and make the Bacillus amyloliquefaciens transformants secrete and express the African swine fever antigen P72. Specifically, pick the correct transformants and inoculate them in 5mL of optimized medium containing Kana (5ug / mL), activate them at 37℃ and 180r / min overnight, inoculate them into 100mL of optimized medium containing Kana (5ug / mL) at a ratio of 5:100 for fermentation and culture, shake and culture at 37℃ and 180r / min until the absorbance value in the logarithmic growth phase reaches 2.5-2.8, centrifuge at 10000rpm / min, 4℃, and collect the supernatant. The expression of recombinant antigen P72 was successfully detected in the fermentation broth by SDS-PAGE electrophoresis and Western Blot, and the protein content reached up to 4.5mg / mL. Through oral and intragastric administration experiments, the expressed recombinant antigen P72 can effectively stimulate the production of P72 antibodies in mice. The present invention can lay a foundation for the preparation of an efficient oral ASFV bacillus vaccine.

[0023] The present invention has been analyzed by bioinformatics and found that the P72 protein is encoded by 647 amino acids. Then, according to the preference of codons in Bacillus, the amino acid sequence of the P72 protein is codon optimized. Further, the selected yow protease signal peptide guides the secretion of exogenous proteins to the extracellular space. The present invention fuses the signal peptide nucleotide sequence encoding the protease yow with the optimized and modified nucleotide sequence encoding the antigen P72 to form a new fusion gene SyP72, and uses the characteristics of the signal peptide to guide the secretion and expression of exogenous proteins to improve the secretion rate of the antigen. The key antigen P72 of African swine fever virus can be efficiently and stably secreted and expressed in Bacillus amyloliquefaciens. The engineered strain constructed by the present invention is fermented and cultured in an optimized culture medium, and the expression of the recombinant antigen P72 is successfully detected in the fermentation broth by SDS-PAGE electrophoresis and Western Blot, and the protein content reaches 4.5mg / mL. Through oral and intragastric experiments, the expressed recombinant antigen P72 can effectively stimulate the production of mouse P72 antibodies. The present invention realizes the efficient and stable secretory expression of the key antigen P72 of African swine fever virus (ASFV) in Bacillus, laying a foundation for the preparation of an efficient ASFV Bacillus oral vaccine.

[0024] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0025] The genetically engineered bacteria constructed by the present invention uses Bacillus amyloliquefaciens as the host bacteria. Compared with the genetically engineered bacteria currently commonly using Escherichia coli as the host bacteria, the present invention has the advantages of not needing to break the cells during protein purification, reducing the production of foreign proteins, avoiding the production of endotoxins, etc. The vector pTK-PrepUT1T2 used in the present invention to construct the plasmid is a promoter independently designed by the laboratory, which is a composition-enhanced promoter that does not require any inducer and can drive the downstream gene to stably and continuously express the target protein. Compared with other commonly used vectors, the vector pTK-PrepUT1T2 has the advantages of not needing to add inducers during the fermentation process, being able to express the target protein more efficiently and stably, and having a simple fermentation process. The present invention selects the signal peptide nucleotide sequences of three proteases yow, AprE, and NprE to fuse with the optimized and modified nucleotide sequence encoding antigen P72 to form new fusion genes SyP72, SAP72, and SNP72, and constructs three genetically engineered bacteria yP72, AP72, and NP72, whose protein contents reach 4.5 mg / mL, 2 mg / mL, and 1.5 mg / mL, and screens out the signal peptide of protease yow and antigen P72 to be most suitable, which can maximize the secretion rate of the antigen. Among them, the new fusion gene SyP72 is constructed, and the protein content of the constructed yP72 genetically engineered bacteria significantly exceeds that of other genes and engineered bacteria, and the effect is very significant, indicating that the specific signal peptide and the optimized nucleotide sequence encoding antigen P72 produce very good effects.

[0026] At the same time, the optimized culture medium designed by the present invention increases the content of antigen protein P72 by about 30% compared with the conventional LB culture medium. The genetic engineering strain of Bacillus amyloliquefaciens of the present invention and its construction method and fermentation application lay the foundation for the preparation of efficient ASFV Bacillus vaccine, and are expected to achieve effective prevention and control of African swine fever. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 A shows the construction process of the recombinant secretory expression vector pTK-SyP72; B shows the single enzyme digestion map of plasmid pTK-SyP72: M, DNA 10000bp Marker, SyP72, recombinant secretory expression vector pTK-SyP72 (8128bp); C shows the PCR amplification map of plasmid pTK-SyP72: M, DNA 2000bp Marker, 1, new fusion gene SyP72 (2022bp).

[0028] Figure 2 A shows the construction process of the recombinant secretory expression vector pTK-SAP72; B shows the single restriction enzyme digestion map of plasmid pTK-SAP72: M, DNA 10000bp Marker, SAP72, recombinant secretory expression vector pTK-SAP72 (8149bp); C shows the PCR amplification map of plasmid pTK-SAP72: M, DNA 2000bp Marker, 1, new fusion gene SAP72 (2043bp).

[0029] Figure 3 A shows the construction process of the recombinant secretory expression vector pTK-SNP72; B shows the single enzyme digestion map of plasmid pTK-SNP72: M, DNA 10000bp Marker, SNP72, recombinant secretory expression vector pTK-SNP72 (8212bp); C shows the PCR amplification map of plasmid pTK-SNP72: M, DNA 2000bp Marker, 1, new fusion gene SNP72 (2106bp).

[0030] Figure 4 A is a streak diagram of transformation of Bacillus amyloliquefaciens genetically engineered strain yP72; B is a streak diagram of transformation of Bacillus amyloliquefaciens genetically engineered strain AP72; C is a streak diagram of transformation of Bacillus amyloliquefaciens genetically engineered strain NP72; D is a single colony PCR amplification verification diagram of Bacillus amyloliquefaciens genetically engineered strains yP72, AP72, and NP72: M, DNA 2000bp Marker, SyP72, SyP72 target gene (2022bp), SAP72, SAP72 target gene (2043bp), SNP72, SNP72 target gene (2106bp).

[0031] Figure 5 This is a comparison chart of the protein sample concentrations obtained by fermenting genetically engineered strains yP72, AP72, and NP72 in LB medium and optimized medium.

[0032] Figure 6 This is the SDS-PAGE identification diagram of P72 protein. Lane M is Marker (14.4-116.0 kDa), lane 1 is the fermentation supernatant concentrate of Bacillus amyloliquefaciens CPLK1314, lane 2 is the fermentation supernatant concentrate of genetically engineered bacteria AP72, and lane 3 is the fermentation supernatant concentrate of genetically engineered bacteria yP72. The protein size of P72 is 71.19 kDa.

[0033] Figure 7 This is a Western Blot identification diagram of P72 protein. Lane M is Marker (10-180kDa), lane 1 is the fermentation supernatant concentrate of genetically engineered bacteria AP72, and lane 2 is the fermentation supernatant concentrate of genetically engineered bacteria yP72. The protein size of P72 is 71.19kDa.

[0034] Figure 8 This is a diagram of the immunogenicity test in the oral gavage experiment on mice with genetically engineered strains.

[0035] Fig. 9 This is a diagram of the immunogenicity test in oral experiments with genetically engineered strains of mice. DETAILED DESCRIPTION

[0036] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0037] Unless otherwise specified, the materials and reagents used in the examples of the present invention can be obtained from commercial sources. Experimental methods without specific conditions in the examples are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0038] The expression vector pTK-PrepUT1T2 (see patent application number CN202111680804.7 for details) was provided by Huaiyin Institute of Technology, and the fusion genes SyP72, SAP72, and SNP72 were artificially synthesized by (Shanghai) Shenggong Bioengineering Co., Ltd.

[0039] Bacillus amyloliquefaciens CPLK1314, deposit number CCTCC NO: M2017658, has been publicly deposited in the prior application CN109182197A, and was provided by Huaiyin Institute of Technology.

[0040] Example 1

[0041] Method for constructing recombinant secretory expression vectors pTK-SyP72, pTK-SAP72, and pTK-SNP72

[0042] Based on the ASFV sequence published by NCBI, the original P72 protein nucleotide sequence was optimized (SEQ ID NO.7) by changing synonymous codons according to the preference of codons in Bacillus to increase gene expression and fused with the signal peptide nucleotide sequences encoding proteases yow, AprE, and NprE (SEQ ID NO.4-6) to form new fusion genes SyP72, SAP72, and SNP72, and BamHI and EcoRI restriction sites were added at the beginning and end. The nucleotide sequences of SyP72, SAP72, and SNP72 (SEQ ID NO.1-3) were sent to (Shanghai) Shenggong Biotechnology Co., Ltd. for artificial total synthesis. The plasmid pTK-PrepUT1T2 double-digested with restriction endonucleases BamHI / EcoRI and the artificially synthesized fusion genes SyP72, SAP72, and SNP72 were mixed with T4 ligase and connected at a constant temperature of 16°C overnight. After taking out 100uL of DH5α competent cells from the -80℃ refrigerator, immediately put them in ice to thaw for about 5 minutes; on the operating table, use a pipette to add 5μL of ligation product to the DH5α competent cells, gently tap the bottom of the tube to mix it evenly, and put the EP tube in ice and let it stand for about 30 minutes; after heat shock in a 42℃ water bath for 45s, quickly put the EP tube in ice and let it stand for 2 minutes. On the operating table, add 500 μL of LB liquid culture medium to the EP tube with a pipette, shake gently to mix it thoroughly, and culture it at 37°C, 200 r / min for 60 min; collect the bacteria by centrifugation at 5000 rpm for 5 min, add 150 μL of supernatant to the collected bacteria, mix it by pipetting, and then spread it on an LB resistance plate containing 100 mg / L ampicillin for overnight culture at 37°C to screen the transformants, pick a few single colonies of positive transformants and inoculate them into a 5 ml LB culture tube, culture it at 37°C, 180 r / min for 12 h, and use a plasmid rapid extraction kit to extract the plasmids of pTK-SyP72, pTK-SAP72, and pTK-SNP72. Use the extracted plasmid as a template for PCR detection and identification. According to the nucleotide sequences of SyP72, SAP72, and SNP72, primers were designed using DNAMAN software, and primers SyP72F, SyP72R, SAP72F, SAP72R, SNP72F, and SNP72R were synthesized by Nanjing Shenggong Biotechnology Co., Ltd. Plasmids pTK-SyP72, pTK-SAP72, and pTK-SNP72 were used as templates, and primers SyP72F, SyP72R, SAP72F, SAP72R, SNP72F, and SNP72R were used for PCR amplification. After the PCR reaction, the target fragment was verified by 1% gel electrophoresis, see Figure 1 , 2As shown in , 3, the correct recombinant plasmids pTK-SyP72, pTK-SAP72, and pTK-SNP72 (SEQ ID NO.8-10) were obtained.

[0043] The primers are as follows:

[0044] SyP72F:TTTATGAAAAAATACTGGATATGTATTGCTGTT

[0045] SyP72R:TTTTTAAGTAGAGTAACGAAGAACAGCG

[0046] SAP72F: TTTATGAGAGGCAAAAAAGTATGGATCAG

[0047] SAP72R:TTTTTAAGTAGAGTAACGAAGAACAGCG

[0048] SNP72F:TTTATGCAGAATGAGAGAATGCTGG

[0049] SNP72R:TTTTTAAGTAGAGTAACGAAGAACAGCG

[0050] The PCR amplification system was as follows: DNA 1 μL, Primer F and Primer R: 0.8 μL each, 10×Ex Taq Buffer 2.5 μL, Ex Taq enzyme 0.25 μL, dU plus dNTP Mixture 2 μL, H 2 O: 17.65 μL;

[0051] The PCR reaction program was as follows: pre-denaturation at 94°C for 4 min, denaturation at 94°C for 30 s, annealing at 53°C for 30 s, extension at 72°C for 2 min 26 s, and 33 cycles.

[0052] Example 2

[0053] Construction of genetically engineered Bacillus amyloliquefaciens strains yP72, AP72, and NP72

[0054] The correct recombinant plasmids pTK-SyP72, pTK-SAP72, and pTK-SNP72 (verified in Example 1) were transferred into Bacillus amyloliquefaciens CPLK1314 by chemical transformation. A single colony of Bacillus amyloliquefaciens CPLK1314 was picked and inoculated into 5 mL of GCHE (100 μL of 50% glucose solution and 50 μL of 10% casein hydrolysate solution) liquid culture medium without antibiotics, and cultured overnight at 37°C and 160 r / min for 12 h; 1 mL of the cultured bacterial liquid of Bacillus amyloliquefaciens CPLK1314 was added to 24 mL of new GCHE (480 μL of 50% glucose solution and 240 μL of 10% casein hydrolysate solution) liquid culture medium without antibiotics, and cultured at 28°C and 180 r / min; the culture was continued for 4 h, 3.5 h, and 3.5 h, respectively. h, 2.5h, 1mL of culture fluid was drawn from 24mL of GCHE medium, added to 1mL of GE liquid medium without antibiotics (with 20μL of 50% glucose solution), and cultured at 37°C and 200r / min for 60min; 2mL of culture fluid was transferred to an EP tube, centrifuged at low speed for 10min, concentrated to 400μL, added with 3μg of pTK-SyP72 / pTK-SAP72 / pTK-SNP72 plasmid (prepared in Example 1), cultured at 37°C and 90r / min for 30min, and then cultured at 180r / min for 90min. Centrifuged at low speed for 3min to collect the precipitate. In a sterile environment, add 100 μL of supernatant to the precipitate and resuspend to prepare a bacterial suspension, spread it on an LB plate with Knan (5 ug / mL) resistance and culture it at 37°C overnight, screen the correct transformants, select single colonies and streak them on an LB plate with Knan (5 ug / mL) resistance to obtain three genetically engineered strains of Bacillus amyloliquefaciens yP72, AP72, and NP72; PCR amplification of single colonies of strains yP72, AP72, and NP72 was verified, SyP72 target gene (2022 bp), SAP72 target gene (2043 bp), and SNP72 target gene (2106 bp); see Figure 4 shown.

[0055] GCHE liquid medium (200 mL), 0.4 g potassium L-glutamate, 0.18 g trisodium citrate, 100 mM phosphate buffer (1.06 g KH2PO4, 2.78 g K2HPO4), 0.148 g MgSO4·7H2O, 0.022 g ammonium ferric citrate, 0.101 g tryptophan, sterilized at 120°C for 20 min. 4 mL 50% glucose solution and 2 mL 10% casein compound solution, sterilized separately, 115°C for 15 min.

[0056] GE liquid medium (200 mL): 100 mM phosphate buffer (1.06 g KH2PO4, 2.78 g K2HPO4), 0.4 g potassium L-glutamate, 0.18 g trisodium citrate, 0.148 g MgSO4·7H2O, 0.022 g ammonium ferric citrate, 0.101 g tryptophan, sterilized at 120°C for 20 min. 4 mL 50% glucose solution was prepared separately and sterilized at 115°C for 15 min.

[0057] Example 3

[0058] Optimization of fermentation medium for genetically engineered Bacillus amyloliquefaciens strains yP72, AP72, and NP72

[0059] The genetically engineered Bacillus amyloliquefaciens strains yP72, AP72, and NP72 prepared in Example 2 were activated in 5 mL of LB medium containing Kana (5ug / mL) and in 5 mL of optimized medium containing Kana (5ug / mL), and cultured for 12 hours at 37°C and 180rpm. This logarithmic phase culture solution was used as the seed solution, and inoculated in 100 mL of LB medium containing Kana (5ug / mL) and inoculated in 100 mL of optimized medium containing Kana (5ug / mL) at a volume ratio of 5:100, and cultured at 37°C and 180r / min with shaking until the absorbance value reached 2.5-2.8, and then centrifuged at 10000rpm / min, 4°C, for 5min, and the supernatant was collected. The protein content in the two supernatants was detected by Bradford assay. Standard samples were prepared with bovine serum albumin (BSA). 20 wells on the ELISA plate were selected, and 20 standard samples were added to each well (one replicate was set for each standard sample). Add 200ul Bradford protein quantitative reagent to each well, mix, stand at room temperature for 2 minutes, measure the absorbance of the standard sample at 595nm with a full-wavelength microplate reader, and draw a standard curve. Dilute the supernatant obtained from LB medium fermentation and the supernatant obtained from optimized medium fermentation with 0.15M NaCl, take 20ul and add it to the well of the microplate, then add 200ul Bradfor protein quantitative reagent and mix. Stand at room temperature for 2 minutes, measure the absorbance at 595nm with a full-wavelength microplate reader, and calculate the sample concentration with reference to the standard curve.

[0060] Optimized culture medium: The protein content in the supernatant of yP72 genetically engineered bacteria fermentation reaches 4.5 mg / mL, the protein content in the supernatant of AP72 genetically engineered bacteria fermentation reaches 2 mg / mL, and the protein content in the supernatant of NP72 genetically engineered bacteria fermentation reaches 1.5 mg / mL. LB culture medium: The protein content in the supernatant of yP72 genetically engineered bacteria fermentation reaches 3 mg / mL, the protein content in the supernatant of AP72 genetically engineered bacteria fermentation reaches 1.5 mg / mL, and the protein content in the supernatant of NP72 genetically engineered bacteria fermentation reaches 1 mg / mL. Figure 5 shown.

[0061] Optimized culture medium: soybean cake powder 20g / L, trypsin 2g / L, yeast extract 1.5g / L, NaCl 0.5g / L, magnesium sulfate 0.002g / L, manganese sulfate 0.001g / L, potassium dihydrogen phosphate 0.0016g / L, pH 7.0, sterilization at 120℃ for 20min.

[0062] LB medium: 10 g / L trypsin, 5 g / L yeast powder, 10 g / L NaCl, sterilized at 120°C for 20 min.

[0063] Example 4

[0064] Verification of secretory expression of African swine fever virus key antigen P72 by genetically engineered Bacillus amyloliquefaciens strains yP72 and AP72

[0065] According to (Example 3), the genetically engineered Bacillus amyloliquefaciens strains yP72 and AP72 with the best protein expression were selected and inoculated into an optimized medium containing Kana (5ug / mL) at 37°C and 180r / min for activation overnight, and inoculated into 100mL optimized medium containing Kana (5ug / mL) at a volume ratio of 5:100 for fermentation and culture, and cultured with shaking at 37°C and 180r / min until the absorbance value reached 2.5-2.8, and then centrifuged at 10000rpm / min and 4°C for 5min to collect the supernatant. The expression of recombinant antigen P72 was successfully detected in the fermentation broth by SDS-PAGE electrophoresis and Western Blot, as shown in FIG. Figure 6 , 7 As shown, the protein size of P72 is 71.19 kDa, which further proves that the genetically engineered bacteria yP72 and AP72 can indeed secrete and express the recombinant antigen p72.

[0066] Example 5

[0067] Oral and intragastric administration of genetically engineered Bacillus amyloliquefaciens yP72 in mice

[0068] According to (Example 4), the Bacillus amyloliquefaciens genetically engineered bacteria yP72 with the highest protein content was selected for oral and intragastric administration experiments on mice. 25 5-week-old female mice and pellet feed were purchased from Chengdu Dashuo Experimental Animal Co., Ltd. The mice were raised in a well-ventilated animal room with a temperature controlled at 18-23°C. The mouse growth environment was disinfected and the bedding was replaced regularly. In order to adapt the mice to the new environment, they were pre-fed for 7 days before the experiment. All procedures of the animal experiment were strictly carried out in accordance with relevant national regulations.

[0069] The 25 mice purchased were randomly divided into 5 groups, with 5 mice in each group. Group A1 and A2 were gavaged with wild-type Bacillus amyloliquefaciens and genetically engineered Bacillus amyloliquefaciens yP72 on the 0th, 14th, and 21st days of the experiment, respectively. Each mouse was gavaged with 100 μL (spore volume was 1.0×10 1 In groups B1 and B2, wild-type Bacillus amyloliquefaciens and recombinant Bacillus amyloliquefaciens were fed to mice in the form of mixed feed. The spore content per gram of feed was (spore amount was 1.0×10 6 CFU). C was the control group, which was fed only with basic rations. The above five groups of mice were all fed with fixed amounts of food and free access to drinking water.

[0070] Blood was collected from 5 groups of mice on day 0, 21, 35, and 49 of the experiment and collected in pre-sterilized 2 mL centrifuge tubes, allowed to stand at 37°C for 1 h, placed in a refrigerator at 4°C overnight, and then centrifuged at 3000 rpm / min for 10 min. Serum was collected and divided into 50 μL small amounts and stored at -70°C for detection of serum P72 antibody levels.

[0071] The indirect ELISA method of antigen detection antibody was used to detect the antibody level. The specific operation steps are as follows: (1) Coating: 0.05 mol / L carbonate buffer (pH 9.6) was used as the coating diluent, and the ASFV whole virus was used to coat the 96-well ELISA enzyme-labeled plate. 100uL was added to each well. After coating at 4°C overnight, the plate was washed three times with PBS washing solution, each time with 200uL for 5 minutes.

[0072] (2) Blocking: Add 150uL of PBS blocking solution containing 3% BSA to each well and block at 37°C for 2h. Then discard the blocking solution and wash three times with PBS washing solution, each time with 200uL for 5min.

[0073] (3) Antibody incubation: Preliminary tests were performed on the treated serum supernatants to be tested, and the optimal dilution was selected. The serum supernatants before the test were used as the negative control. 100uL of the diluted serum supernatant was added to each well and incubated at 37°C for 1h. The plates were washed three times with PBS, 200uL each time for 5min.

[0074] (4) Color development: The substrate color development solution was prepared according to the instructions of the EL-TMB color development kit, 100uL was added to each well, and the color was developed at 37°C in the dark for 15 min. Then 50uL of 2mol / L H 2 SO 4 Stop solution to terminate the reaction.

[0075] (5) OD value: Use a microplate reader (450 nm) to measure the absorbance (OD 450 Value) for detection. Figure 8 , 9 As shown, through oral and intragastric administration experiments, the expressed recombinant antigen P72 can effectively stimulate the production of P72 antibodies in mice, proving that the genetically engineered strain constructed by the present invention can produce P72 antibodies in living animals or stimulate living animals to prevent African swine fever virus infection.

Claims

1. Genetically engineered bacteria that can efficiently secrete and express the key antigen P72 of African swine fever virus, It is characterized in that The genetically engineered bacteria uses Bacillus amyloliquefaciens as a starting strain, and fuses the signal peptide nucleotide sequence encoding the protease yow with the optimized and modified nucleotide sequence encoding the antigen P72 to form a new fusion gene SyP72 Transformed into Bacillus amyloliquefaciens to obtain a genetically engineered strain, wherein the fusion gene SyP72 The nucleotide sequence is shown in SEQ ID NO.1; the Bacillus amyloliquefaciens is Bacillus amyloliquefaciens CPLK1314, and its accession number is CCTCCNO: M2017658.

2. A method for constructing a genetically engineered Bacillus capable of efficiently secreting and expressing the key antigen P72 of African swine fever virus according to claim 1, It is characterized in that The steps include: (1) The P72 protein nucleotide sequence was optimized and fused with the signal peptide nucleotide sequence encoding the protease yow to form a new fusion gene SyP72 ; (2) SyP72 The gene fragment and the constitutive expression vector pTK-PrepUT1T2 were double-digested, and then ligated and transformed to obtain the recombinant secretory expression vector pTK-SyP72. (3) The recombinant secretory expression vector pTK-SyP72 was transferred into Bacillus amyloliquefaciens to construct a genetically engineered Bacillus yP72 that secretes and expresses the key antigen P72 of African swine fever virus.

3. The construction method according to claim 2, It is characterized in that The nucleotide sequence of the recombinant secretory expression vector pTK-SyP72 in step (2) is shown in SEQ ID NO:

8.

4. Use of the genetically engineered bacteria according to claim 1 in secretory expression of the key antigen P72.

5. The use according to claim 4, It is characterized in that In the application process, the genetically engineered bacteria yP72 is inoculated into an optimized culture medium for activation overnight, and then inoculated into the optimized culture medium for fermentation and culture. The supernatant is collected by centrifugation, and the expression of the recombinant antigen P72 is successfully detected in the fermentation broth; the optimized culture medium includes: 20 g / L soybean cake powder, 2 g / L trypsin, 1.5 g / L yeast extract, 0.5 g / L NaCl, 0.002 g / L magnesium sulfate, 0.001 g / L manganese sulfate, 0.0016 g / L potassium dihydrogen phosphate, pH 7.

0.

6. Use of the genetically engineered bacteria according to claim 1 in the preparation of an oral vaccine for preventing African swine fever, wherein the genetically engineered bacteria is based on Bacillus amyloliquefaciens as a starting strain, and a signal peptide nucleotide sequence encoding protease yow is fused with an optimized and modified nucleotide sequence encoding antigen P72 to form a new fusion gene SyP72 Transformed into Bacillus amyloliquefaciens to obtain a genetically engineered strain, wherein the fusion gene SyP72 The nucleotide sequence is shown in SEQ ID NO.1; the Bacillus amyloliquefaciens is Bacillus amyloliquefaciens CPLK1314, and its accession number is CCTCCNO: M2017658.

Images