Enrichment and domestication of methane-oxidizing bacteria and its application method

Abstract

A method for enriching and taming a methane-oxidizing bacterial community and its application, comprising the steps of enriching and activating microorganisms in a methane-rich environmental sample to obtain a methane-oxidizing bacterial community enrichment solution, then taming and culturing the methane-oxidizing bacterial community using a rice field taming culture solution prepared by mixing a rice field soil supernatant and an NMS culture medium, gradually increasing the volume ratio of the rice field supernatant in the rice field taming culture solution during the taming and culturing period to gradually improve the adaptability of the methane-oxidizing bacterial community to the rice field environment, and inoculating the prepared methane-oxidizing bacterial community in the rice field at the tillering stage, the jointing and booting stage, the heading and flowering stage, and the maturity stage. The methane-oxidizing bacterial community has the advantages of strong adaptability to the rice field environment, rapid growth, high methane oxidation rate, and the like.

Description

Technical Field

[0001] The present invention relates to a technology in the field of bioengineering, specifically a method for enriching and domesticating a methane oxidizing bacteria community and an application method for reducing methane emissions in paddy fields. Background Art

[0002] At present, the measures for reducing methane emissions from paddy fields mainly include improving rice planting technology, applying organic fertilizers and soil conditioners, and selecting rice cultivars with underdeveloped aerenchyma. However, the implementation period and degree of these methods are important factors affecting the emission reduction effect and rice yield. If they are not properly selected, not only will the emission reduction effect be unsatisfactory, but the rice yield may even be reduced. The existing industrial culture system and culture method of methane oxidizing bacteria are limited to use in coal mines. The methane oxidizing bacteria obtained by culture are exogenous bacteria and are difficult to adapt to the paddy field environment. They have low tolerance and poor survival ability. It is difficult to form a population advantage in the paddy field, and the effect of methane emission reduction in paddy fields is not good. Summary of the invention

[0003] In view of the above-mentioned deficiencies in the prior art, the present invention proposes a method for enriching and taming a methane-oxidizing bacterial community and applying the method. A methane-rich environmental sample is used as the source of the methane-oxidizing bacterial strain, and methane is used as the sole carbon source. A selective enrichment medium NMS medium is used to activate the indigenous microbial mixed flora enriched in the methane-rich environmental sample to obtain a methane-oxidizing bacterial community enrichment solution. The methane-oxidizing bacterial community enrichment solution is further tamed and cultured by adding a paddy field taming culture solution prepared by adding paddy field soil supernatant in different volume ratios to the NMS medium to obtain a methane-oxidizing bacterial community used for reducing methane emissions in paddy fields. After the methane-oxidizing bacterial community MOPF-1 obtained by enriching and taming coal slag is inoculated in a paddy field, the methane emissions of the paddy field at the tillering stage, jointing and booting stage, heading and flowering stage, and maturity stage are 2.86 mg / m 2 / d, 4.12mg / m 2 / d, 3.58mg / m 2 / d and 2.66mg / m 2 / d, the methane emissions from paddy fields decreased by 35.15%, 40.97%, 42.63% and 50.83% respectively compared with those from uninoculated paddy fields; the methane oxidizing bacteria MOPF-2 obtained by enrichment and domestication of sludge from the secondary sedimentation tank of a sewage treatment plant was inoculated into paddy fields, and the methane emissions from paddy fields at the tillering stage, jointing and booting stage, heading and flowering stage, and maturity stage were 2.54 mg / m 2 / d, 3.95mg / m 2 / d, 2.76mg / m 2 / d and 2.35mg / m 2 / d, the methane emissions from paddy fields decreased by 42.40%, 43.41%, 55.77% and 56.56% respectively compared with those from uninoculated paddy fields; the two methane-oxidizing bacterial communities obtained by enrichment and domestication had no adverse effects on rice yield, and had the advantages of strong adaptability to the paddy field environment, rapid growth and high methane oxidation rate.

[0004] The present invention is achieved through the following technical solutions:

[0005] The present invention relates to a method for enriching and domesticating a methane-oxidizing bacterial community. The method comprises the following steps: enriching and activating microorganisms in a methane-rich environmental sample to obtain a methane-oxidizing bacterial community enrichment solution; then domesticating and culturing the methane-oxidizing bacterial community in a paddy field domestication culture solution prepared by mixing paddy field soil supernatant and NMS culture medium; and gradually increasing the volume ratio of paddy field supernatant in the paddy field domestication culture solution during the domestication and culturing period to gradually improve the adaptability of the methane-oxidizing bacterial community to a paddy field environment, thereby preparing the methane-oxidizing bacterial community.

[0006] The methane-rich environmental samples include: coal slag and secondary sedimentation tank sludge.

[0007] The methane oxidizing bacteria group includes: Clausella obtained from coal slag as a methane-rich environment sample

[0008] The relative abundances of Cloacibacterium, Methylocystis, Emticicia, Chryseobacterium, Azospirillum and Methylomonas were 29.44%, 23.44%, 20.62%, 7.67%, 5.68% and 1.10%, respectively; and the relative abundances of Methylocystis, Cloacibacterium, Methylomonas, Phreatobacter and Flavorbacterium obtained from the secondary sedimentation tank sludge as the methane-rich environment sample were 31.78%, 24.45%, 23.43%, 5.06% and 3.36%, respectively.

[0009] The methane oxidizing bacteria enrichment solution is prepared by the following method:

[0010] Step 1: Take a methane-rich environmental sample, introduce a mixed gas of methane and oxygen in a volume ratio of 1:1, and acclimate at 30°C for 1 week in a closed environment to achieve rejuvenation of the methane oxidizing strain.

[0011] Step 2: Inoculate the rejuvenated methane-rich environmental sample obtained in step 1 into the selective enrichment medium NMS medium, without adding other organic carbon sources, and introduce a mixture of methane and air with a volume ratio of 1:1 for enrichment culture. The bacterial liquid concentration OD 600 Value detection, when OD 600 When the value exceeded 0.6, the culture medium was transferred to fresh NMS culture medium at a volume ratio of 10% and transferred 5 times to obtain a methane-oxidizing bacteria enrichment solution.

[0012] Step 3, the methane oxidizing bacteria enriched solution grown to the logarithmic phase obtained in step 2 is transferred to the paddy field domestication culture solution, and a mixed gas of methane and air with a volume ratio of 1:1 is introduced into the mixed solution containing the methane oxidizing bacteria enriched solution and the paddy field domestication culture solution for domestication culture. The domestication culture is divided into 4 stages. In the first stage, the volume ratio of the paddy field soil supernatant in the paddy field domestication culture solution is 25%, and the volume ratio of the paddy field soil supernatant in the second and third stages is gradually increased by 25%. In the fourth stage, the volume ratio of the paddy field soil supernatant in the paddy field domestication culture solution is 95%, and a methane oxidizing bacteria community is obtained.

[0013] The paddy field acclimation culture solution is prepared by adding paddy field soil supernatant in different volume proportions to NMS culture medium, and the added amount of paddy field soil supernatant accounts for 25-95% of the total volume ratio.

[0014] The paddy field soil supernatant is obtained by adding paddy field soil into sterile water at a mass concentration (W / V) of 2%, oscillating at 30° C. and 150 rpm for 10 minutes, and taking the upper clear liquid after standing for 30 minutes.

[0015] The components and concentrations of the NMS culture medium are: MgSO4·7H2O 0.2 g / L, CaCl2·6H2O 0.14 g / L, KNO3 1.0 g / L, phosphate solution 50 mL / L and trace element solution 2 mL / L.

[0016] The components and concentrations of the phosphate solution are: KH2PO4 5.44 g / L and Na2HPO4 5.68 g / L.

[0017] The components and concentrations of the trace element solution are: Na2-EDTA 1.0 g / L, FeSO4·7H2O 2.0 g / L, ZnSO4·7H2O 0.8 g / L, MnCl2·4H2O 0.03 g / L, H3BO3 0.03 g / L, CoCl2·6H2O 0.2 g / L, CuCl2·2H2O 0.6 g / L, NiCl2·6H2O 0.02 g / L and Na2MoO4·2H2O 0.05 g / L.

[0018] The present invention relates to a rice field methane emission reduction application method based on the above-mentioned methane oxidizing bacteria group. Before transplanting rice seedlings, the roots are immersed in the methane oxidizing bacteria group grown to the logarithmic stage, and then the rice seedlings are transplanted, and the rice seedlings are irrigated together with fertilizers during the tillering stage, the jointing and booting stage, and the heading and flowering stage.

[0019] The cell density of the methane oxidizing bacteria is 10 8 CFU cell / mL, the dosage per acre is 500-1000mL.

[0020] The watering adopts a cell density of 10 8 CFU cell / mL of methane-oxidizing bacteria, use 10-15 kg per acre, and apply fertilizer normally.

[0021] Technical Effects

[0022] The present invention further performs taming culture on the methane oxidizing bacteria enrichment solution by using the rice field taming culture solution, and gradually increases the volume ratio of the rice field supernatant in the rice field taming culture solution during the taming culture period, thereby gradually improving its adaptability to the rice field environment. The methane oxidizing bacteria group MOPF-1 obtained by enriching and taming coal slag in the present invention reaches the middle logarithmic growth phase 3 days after being inoculated into the rice field taming culture solution, and the OD 600 =0.61; the methane emissions from paddy fields after MOPF-1 inoculation at the tillering stage, jointing and booting stage, heading and flowering stage, and maturity stage were 2.86 mg / m 2 / d, 4.12mg / m 2 / d, 3.58mg / m 2 / d and 2.66mg / m 2 / d, compared with the uninoculated paddy field, the methane emissions were reduced by 35.15%, 40.97%, 42.63% and 50.83% respectively; the methane oxidizing bacteria MOPF-2 obtained by enrichment and domestication of sludge from the secondary sedimentation tank of the sewage treatment plant was inoculated into the domesticated culture medium of the rice field and reached the mid-logarithmic growth stage 3 days later, and the OD 600 =0.67; after MOPF-2 was inoculated in rice fields, the methane emissions from rice fields at the tillering stage, jointing and booting stage, heading and flowering stage, and maturity stage were 2.54 mg / m 2 / d, 3.95mg / m 2 / d, 2.76mg / m 2 / d and 2.35mg / m 2 / d, the methane emissions from paddy fields were reduced by 42.40%, 43.41%, 55.77% and 56.56% respectively compared with those of uninoculated paddy fields; the two methane-oxidizing bacteria communities obtained by enrichment and domestication had no adverse effects on rice yield, and had the advantages of strong adaptability to the paddy field environment, rapid growth and high methane oxidation rate, which solved the problem that the methane-oxidizing bacteria communities obtained by existing technology were difficult to adapt to the paddy field environment and had a low methane oxidation rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the composition (genus level) of the methane-oxidizing bacterial community MOPF-1;

[0024] Figure 2 Schematic diagram of the composition (genus level) of the methane-oxidizing bacterial community MOPF-2;

[0025] Figure 3 Schematic diagram of the growth curve of the methane-oxidizing bacteria enrichment solution-1 (before acclimation) and the methane-oxidizing bacteria MOPF-1 (after acclimation) inoculated with the paddy field soil supernatant;

[0026] Figure 4 Schematic diagram of the growth curve of the methane-oxidizing bacteria enrichment solution-2 (before acclimation) and the methane-oxidizing bacteria MOPF-2 (after acclimation) inoculated with the paddy field soil supernatant;

[0027] Figure 5 Schematic diagram of gas chromatography analysis of methane oxidation in rice soil inoculated with and without inoculation of methanotrophic bacteria MOPF-1;

[0028] Figure 6 Schematic diagram of gas chromatography analysis of methane oxidation in rice soil inoculated with and without inoculation of methanotrophic bacteria MOPF-2;

[0029] Figure 7 The graph shows the changes in methane volume in rice soil inoculated with and without methanotrophic bacteria MOPF-1 and MOPF-2.

[0030] Figure 8 Schematic diagram of methane emissions from rice fields inoculated with and without methanotrophic bacteria MOPF-1 and MOPF-2 at different rice planting periods;

[0031] Fig. 9 Schematic diagram of rice yield in rice fields inoculated with and without methanotrophic bacteria MOPF-1 and MOPF-2;

[0032] Fig.10 This is the result of agarose gel electrophoresis of PCR of methane oxidizing bacteria enrichment solution-1 and methane oxidizing bacteria enrichment solution-2. DETAILED DESCRIPTION

[0033] Example 1

[0034] like Figure 1 As shown, this embodiment relates to the preparation and application of a methane oxidizing bacterial community MOPF-1 using surface coal slag as a bacterial source, comprising the following steps:

[0035] Step 1) Take the surface coal slag from Liangshuijing Coal Mine in Luzhou City, Sichuan Province, pass it through a 2 mm sample sieve, place it in a vacuum dryer, use a vacuum pump to extract 50% of the air, inject 50% of methane, ensure that the volume ratio of methane to air is 1:1, 30°C, and close and acclimate for 1 week to achieve the rejuvenation of the methane oxidizing strain of the coal slag.

[0036] Step 2) using the rejuvenated coal slag in step 1 as inoculum for enrichment culture, specifically comprising:

[0037] 2.1) Take 4g of rejuvenated coal slag and inoculate it into 40mL of sterilized selective enrichment medium NMS medium, shake at a constant temperature of 30℃, 150rpm for 2h, and let it stand for 10min. Take 4mL of the coal slag supernatant after standing as seeds and inoculate it into a 100mL sterile anaerobic bottle containing 40mL of NMS medium and seal it with a silicone stopper. Draw out 30mL of air with a syringe, and then inject 30mL of methane with a sterile syringe to make the methane: air volume ratio 1:1. Place the above sterile anaerobic bottle in a constant temperature shaker, culture at 30℃, 180rpm, and measure the bacterial liquid concentration OD every 24h. 600 The gas in the bottle was replaced every 24 hours to maintain a methane: air volume ratio of 1:1. The culture was continued for 7 days until the OD value of the enriched culture solution reached 600 = 0.6. After 7 days of enrichment culture, 4 mL of culture solution was inoculated into 40 mL of NMS medium and cultured for 7 days under the same conditions, and the enrichment culture was transferred 5 times continuously.

[0038] 2.2) Take 4 mL of the bacterial liquid after the fifth enrichment culture and inoculate it into a 100 mL sterile anaerobic bottle filled with 40 mL of NMS medium and seal it with a silicone stopper. Draw 30 mL of air with a syringe, and then inject 30 mL of methane with a sterile syringe to make the methane: air volume ratio 1:1. Cultivate at 30°C and 180 rpm. After 24 hours, take 2 mL of the gas in the anaerobic bottle with a syringe and use a gas chromatograph to detect the methane concentration. The test results show that the methane oxidation rate on the second day can reach 90.88%.

[0039] 2.3) Take the bacterial solution from the 3rd day of the 5th enrichment culture for bacterial solution PCR to amplify the methane oxidation-related gene pmoA. The amplification reaction system is 25 μL, containing 2 μL bacterial solution, 12.5 μL PowerPol 2×PCR Mix (Abclonal, RK20719), 0.5 μL upstream primer A189 (5′-GGNGACTGGGACTTCTGG-3′), 0.5 μL downstream primer mb661 (5′-CCGGMGCAACGTCYTTACC-3′), and 9.5 μL ddH2O. The PCR reaction was amplified in a Bio-Rad T100 thermal cycler (Bio-Rad, USA) according to the following program: 98℃ pre-denaturation for 10 min; 98℃ 10s, 56℃ 30s, 72℃ 40s, 30 cycles; 72℃ 5min. PCR amplification products were separated by 1% EB-containing agarose gel electrophoresis, observed and photographed by gel imaging system. PCR products were purified by TIANgel Purification Kit (Tiangen, China) column purification kit, and the purified PCR products were sequenced by ABI 3730xl fully automatic DNA sequencer (ABI, CA, USA), and the sequencing results were uploaded to NCBI for Blast comparison.

[0040] The above sequencing results show that the bacterial liquid from the fifth enrichment culture was amplified by PCR to obtain a band of about 500 bp ( Fig.10 ), the PCR product was sequenced, totaling 476 bp, and the specific sequence is shown in Seq ID No.1.

[0041] After Blast comparison, the highest similarity was to the methane oxidation-related gene pmoA fragment of Uncultured bacterium clone pMT12E, with a similarity of 99.34%, indicating that methane oxidizing bacteria existed in the bacterial solution of the fifth enrichment culture. Therefore, it was considered that the enrichment culture was completed and methane oxidizing bacterial enrichment solution-1 was obtained.

[0042] The NMS medium has the following composition: MgSO4·7H2O 0.2, CaCl2·6H2O 0.14, KNO3 1.0, phosphate solution 50mL / L, trace element solution 2mL / L; the composition of the phosphate solution is (g / L): KH2PO4 5.44, Na2HPO4

[0043] 5.68; the composition of trace element solution is (g / L): Na2-EDTA 1.0, FeSO4·7H2O 2.0, ZnSO4·7H2O0.8,

[0044] MnCl2·4H2O 0.03, H3BO30.03, CoCl2·6H2O 0.2, CuCl2·2H2O 0.6, NiCl2·6H2O0.02;

[0045] Na2MoO4·2H2O 0.05.

[0046] Step 3) Take 4 mL of the above-mentioned methane-oxidizing bacteria enrichment solution-1 grown to the logarithmic phase and transfer it to a 100 mL sterile anaerobic bottle containing 40 mL of paddy field soil supernatant and NMS medium mixed with a rice field acclimation culture solution, and acclimate according to the acclimation steps and corresponding acclimation conditions shown in Table 1. In each acclimation step, 30 mL of air is drawn with a syringe, and then 30 mL of methane is injected with a sterile syringe to make methane: air = 1:1, 30°C, 180rpm culture, and the acclimation culture is continued for 4 times to obtain the methane-oxidizing bacteria group MOPF-1.

[0047] Table 1 Acclimation culture stages and acclimation conditions

[0048]

[0049] In this example, during the gradual acclimation process of the methane-oxidizing bacteria enrichment solution-1, the bacterial solution concentration OD at each acclimation stage was 600 The changes in the values ​​and methane oxidation rate are shown in Table 2:

[0050] Table 2 Methane oxidation rate during the acclimation process of methane oxidizing bacteria enrichment solution-1

[0051]

[0052]

[0053] Compared with the methane oxidation rate of the methane-oxidizing bacteria enrichment solution in the selective enrichment medium NMS, the methane oxidation rate of the bacteria in the rice field acclimation culture medium was reduced, but it still showed a certain methane degradation effect. With the gradual acclimation, the OD of the methane-oxidizing bacteria enrichment solution after inoculation with the rice field acclimation culture medium on the third day was 600 The value gradually increased, indicating that the bacterial community successfully eliminated the strains with weak adaptability during the gradual domestication process and was finally able to adapt to the paddy field environment;

[0054] Take 4 mL of the above-mentioned methane-oxidizing bacteria MOPF-1 grown to the logarithmic phase and inoculate it into 40 mL of the rice field acclimation culture medium. Use a syringe to draw 30 mL of air, and then use a sterile syringe to inject 30 mL of methane to make methane: air = 1:1. Culture at 30°C and 180 rpm. The bacterial solution concentration OD is measured every 24 h. 600 The test results showed that the methane oxidizing bacteria MOPF-1 reached the mid-logarithmic growth stage on the third day, and the OD600 =0.61( Figure 3 ).

[0055] Step 4) 40 g of actual paddy field soil from Pudong New District, Shanghai was taken into an anaerobic bottle, 40 mL of the above-mentioned methane oxidizing bacteria MOPF-1 was added, and paddy field soil without the methane oxidizing bacteria MOPF-1 of the present invention was used as a blank sample. Methane was filled into the anaerobic bottle to make methane: air = 1:1, and the methane oxidation rate of the methane oxidizing bacteria MOPF-1 in the paddy soil was detected. After testing, the methane oxidation rate of the paddy soil inoculated with the methane oxidizing bacteria MOPF-1 was 21.11 mL / d, and the methane oxidation rate of the uninoculated paddy soil was 4.608 mL / d. Compared with the uninoculated paddy soil, the methane oxidation rate was increased by 55% ( Figure 5 , Figure 7 ).

[0056] The above-mentioned methane-oxidizing bacteria group MOPF-1 grown to the logarithmic phase was collected by centrifugation and sent to Beijing Novogene Technology Co., Ltd. for 16S rDNA amplicon sequencing. DNA was extracted using the Tiangen magnetic bead method universal genome extraction kit, and the V3-V4 region of the 16S rRNA gene was selected as the target fragment for amplification and sequencing. The primer sequences were: 341F: CCCTACACGACGCTCTTCCGATCTG; 805R: GACTGGAGTTCCTTGGCACCCGAG AATTCCA. The PCR product was electrophoresed with agarose gel, and the band with a length of 400-450bp was selected and recovered and purified using the GeneJET gel recovery kit. The DNA library was constructed using the NEB DNA library construction kit, and after being quantified and quality inspected by the Qubit 2.0 instrument, the 16S rDNA amplicon was sequenced using the Illumina MiSeq sequencing platform. After removing non-specific amplification sequences and chimeras from the original data obtained by sequencing, valid sequences were obtained. Clustering was performed according to the distance between valid sequences, and different operational taxonomic units (OTUs) were divided according to the similarity between sequences. Bioinformatics statistical analysis was performed on the operational taxonomic units at a similarity level of 97%. The RDP Classifier Bayesian algorithm was used to classify the operational taxonomic units into species, and the community composition of the methanotrophic bacteria MOPF-1 at different taxonomic levels was statistically analyzed. Table 1 shows the genus-level species abundance of the methanotrophic bacteria MOPF-1. A fan diagram of the genus-level species composition of the methanotrophic bacteria MOPF-1 was drawn based on the genus-level species abundance, as shown in Table 1. Figure 1 As shown. Figure 1It can be seen that the composition of the bacterial community at the genus level is mainly Cloacibacterium, Methylocystis, Emticicia, Chryseobacterium, Azospirillum and Methylomonas, and the relative abundance of the six is ​​29.44%, 23.44%, 20.62%, 7.67%, 5.68% and 1.10%, respectively.

[0057] Table 1 Species abundance at genus level in methanotrophic bacterial community MOPF-1

[0058]

[0059]

[0060]

[0061] The above-mentioned methane-oxidizing bacteria group MOPF-1 grown to the logarithmic phase was inoculated into the sterilized MNS medium, with methane:air = 1:1, 30°C, 180r / min shaking until 10 8 CFU cell / mL. Before transplanting rice seedlings, immerse the roots in the methane oxidizing bacteria MOPF-1 for 15 minutes, and then transplant the rice seedlings. The dosage per mu is 500-1000mL; use 10-15 kg per mu during the tillering stage, jointing and heading stage, and heading and flowering stage, and irrigate together with conventional fertilizers. At the same time, a blank control group without inoculation of methane oxidizing bacteria MOPF-1 was set. The treatment group inoculated with methane oxidizing bacteria MOPF-1 and the blank control group each had 3 plots, arranged in random blocks, and the plot area was 30m 2 . The small plots are separated by isolation boards, and single-row single irrigation is implemented. The small plots are impermeable and fertilizer does not leak. The experimental fertilization, field irrigation and drainage, pest and disease control and other measures are consistent with those of conventional production fields. The methane flux monitoring of the experimental sample plots is completed by static box gas chromatography, and monitoring is carried out at the tillering stage, jointing and booting stage, heading and flowering stage and maturity stage respectively. The static box consists of a top box and a base with a diameter of 20 cm. A gas collector is set on the top box, and a temperature monitoring device is installed. An electric fan is installed on the top of the box to ensure the balance of gas concentration in the box. The outside is wrapped with a 2 cm thick insulation partition, and a water tank is provided on the top of the base for water injection and sealing during sampling. The base of the static box is buried in the sampling point 3 weeks before collecting samples to ensure that the base is level and does not move during the entire observation period. Gas samples are collected from 9:00 to 11:00 on each sampling day. Gas was collected through a three-way valve using a 100 mL medical syringe and injected into a 500 mL aluminum foil light-proof gas sampling bag. It was stored at low temperatures using ice packs and an incubator. Methane concentration was analyzed using a gas chromatograph. Rice yield and straw yield were measured at the rice maturity stage. 3 m 2For actual yield determination, 6 representative rice holes were selected from each plot.

[0062] The results showed that after inoculation with the methane-oxidizing bacteria MOPF-1, the methane emissions from paddy fields at the tillering stage, jointing and booting stage, heading and flowering stage, and maturity stage were 2.86 mg / m 2 / d, 4.12mg / m 2 / d, 3.58mg / m 2 / d and 2.66mg / m 2 / d, while the methane emissions from uninoculated paddy fields during tillering, flowering and maturity were 4.41 mg / m 2 / d, 6.98mg / m 2 / d, 6.24mg / m 2 / d and 5.41mg / m 2 / d, the methane emissions from paddy fields decreased by 35.15%, 40.97%, 42.63% and 50.83% respectively compared with those from uninoculated paddy fields. The rice yield and straw yield after inoculation with methane-oxidizing bacteria MOPF-1 were 5.33t / hm 2 and 4.87t / hm 2 , slightly higher than the rice and straw yields of uninoculated paddy fields (rice yield: 4.97t / hm 2 , Straw yield:

[0063] 4.25t / hm 2 ), indicating that the rice yield and straw yield of the rice field were not adversely affected after inoculation with the methane-oxidizing bacteria MOPF-1.

[0064] Example 2

[0065] The concentrated sludge collected from the secondary sedimentation tank of Shanghai Municipal Investment Wastewater Treatment Plant was used as the bacterial strain for enrichment and domestication culture, and the implementation method was the same as that of Example 1.

[0066] The methane-oxidizing bacteria enrichment solution-2 was amplified by PCR to obtain a band of about 500 bp ( Fig.10 ), the PCR product was sequenced, a total of 470 bp, the specific sequence is shown in Seq ID No2.

[0067] After Blast comparison, the highest similarity was to the methane oxidation-related gene pmoA fragment of Uncultured bacterium clone TA-R34, with a similarity of 94.28%, indicating that methane oxidizing bacteria existed in the bacterial solution of the fifth enrichment culture.

[0068] Table 3 Methane oxidation rate during acclimation of methane-oxidizing bacteria enrichment solution-2

[0069]

[0070] Table 2 shows the species abundance at the genus level of the methanotrophic bacteria community MOPF-2. A fan diagram of the species composition at the genus level of the methanotrophic bacteria community MOPF-2 was drawn based on the species abundance at the genus level. Figure 2 As shown. Figure 2 It can be seen that the composition of the bacterial community at the genus level is mainly Methylocystis, Cloacibacterium, Methylomonas, Phreatobacter and Flavobacterium, and the relative abundance of the five is 31.78%, 24.46%, 23.43%, 5.06% and 3.36%, respectively.

[0071]

[0072]

[0073]

[0074] Take 4 mL of the above-mentioned methane-oxidizing bacteria MOPF-2 grown to the logarithmic phase and inoculate it into 40 mL of the rice field acclimation culture medium. Use a syringe to draw 30 mL of air, and then use a sterile syringe to inject 30 mL of methane to make methane: air = 1:1. Culture at 30°C and 180 rpm. The bacterial solution concentration OD is measured every 24 h. 600 The test results showed that the methane oxidizing bacteria MOPF-2 reached the mid-logarithmic growth stage on the third day, and the OD 600 =0.67( Figure 4 ).

[0075] 40 g of actual paddy field soil from Pudong New District, Shanghai was taken into an anaerobic bottle, 40 mL of the above-mentioned methane oxidizing bacteria MOPF-2 was added, and the paddy field soil without the methane oxidizing bacteria MOPF-2 of the present invention was used as a blank sample. Methane was filled into the anaerobic bottle to make methane: air = 1:1, and the methane oxidation rate of the methane oxidizing bacteria MOPF-2 in the paddy soil was detected. After testing, the methane oxidation rate of the paddy soil inoculated with the methane oxidizing bacteria MOPF-2 was 22.16 mL / d, which was 58.52% higher than that of the uninoculated paddy soil ( Figure 6 , Figure 7 ).

[0076] The above-mentioned methane-oxidizing bacteria group MOPF-2 grown to the logarithmic phase was inoculated into the sterilized MNS medium, with methane: air = 1:1, 30°C, 180r / min shaking until 10 8CFU cell / mL. Before transplanting rice seedlings, immerse the roots in the methane oxidizing bacteria group MOPF-2 for 15 minutes, and then transplant the rice seedlings. The dosage per mu is 500-1000mL; use 10-15 kg per mu during the tillering stage, jointing and booting stage, and heading and flowering stage, and irrigate together with conventional fertilizers. At the same time, a blank control group without inoculation of methane oxidizing bacteria group MOPF-2 was set. The results showed that after inoculation of methane oxidizing bacteria group MOPF-2, the methane emissions of rice fields at the tillering stage, jointing and booting stage, heading and flowering stage, and maturity stage were 2.54 mg / m 2 / d, 3.95mg / m 2 / d, 2.76mg / m 2 / d and 2.35mg / m 2 / d, the methane emissions from paddy fields decreased by 42.40%, 43.41%, 55.77% and 56.56% respectively compared with those from uninoculated paddy fields. The rice yield and straw yield after inoculation with methane-oxidizing bacteria MOPF-2 were 5.43t / hm 2 and 5.07t / hm 2 , slightly higher than the rice yield and straw yield of the uninoculated rice fields, indicating that the rice yield and straw yield of the rice fields were not adversely affected after inoculation with the methanotrophic bacteria MOPF-2.

[0077] Compared with the prior art, the methane-oxidizing bacteria MOPF-1 obtained by enriching and domesticating coal slag in this method reached the mid-logarithmic growth stage 3 days after inoculation into the rice field domestication culture solution, and the OD 600 =0.61; the methane emissions from paddy fields after MOPF-1 inoculation at the tillering stage, jointing and booting stage, heading and flowering stage, and maturity stage were 2.86 mg / m 2 / d, 4.12mg / m 2 / d, 3.58mg / m 2 / d and 2.66mg / m 2 / d, compared with the uninoculated paddy field, the methane emissions were reduced by 35.15%, 40.97%, 42.63% and 50.83% respectively; the methane oxidizing bacteria MOPF-2 obtained by enrichment and domestication of sludge from the secondary sedimentation tank of the sewage treatment plant was inoculated into the domesticated culture medium of the rice field and reached the mid-logarithmic growth stage 3 days later, and the OD 600 =0.67; after MOPF-2 was inoculated in rice fields, the methane emissions from rice fields at the tillering stage, jointing and booting stage, heading and flowering stage, and maturity stage were 2.54 mg / m 2 / d, 3.95mg / m 2 / d, 2.76mg / m 2 / d and 2.35mg / m 2 / d, the methane emissions from paddy fields decreased by 42.40%, 43.41%, 55.77% and 56.56% respectively compared with those from uninoculated paddy fields; the two methane-oxidizing bacterial communities obtained by enrichment and domestication had no adverse effects on rice yield.

[0078] The above-mentioned specific implementation can be partially adjusted in different ways by those skilled in the art without departing from the principle and purpose of the present invention. The protection scope of the present invention shall be based on the claims and shall not be limited by the above-mentioned specific implementation. Each implementation scheme within its scope shall be subject to the constraints of the present invention.

Claims

1. A method for reducing methane emissions from rice fields based on methane oxidizing bacteria, characterized in that: Before transplanting rice seedlings, immerse the roots in the methane-oxidizing bacteria that have grown to the logarithmic stage and then transplant the rice seedlings. Water them together with fertilizers during the tillering stage, jointing and booting stage, and heading and flowering stage. The methane-oxidizing bacteria are prepared by enriching and activating microorganisms in a methane-rich environmental sample to obtain a methane-oxidizing bacteria enrichment solution, and then acclimating and culturing the methane-oxidizing bacteria using a rice field acclimation culture solution prepared by mixing a rice field soil supernatant and an NMS culture medium. During the acclimation and culturing period, the volume ratio of the rice field supernatant in the rice field acclimation culture solution is gradually increased to gradually improve its adaptability to the rice field environment, and a cell density of 10 8 CFU cell / mL of methanotrophic bacteria; In the immersion, the methane oxidizing bacteria are used in an amount of 500-1000 mL per mu; The watering adopts a cell density of 10 8 CFU cell / mL of methane-oxidizing bacteria, use 10-15 kg per acre, and apply fertilizer normally.

2. The rice field methane emission reduction application method according to claim 1 is characterized in that: The methane-rich environmental samples include: coal slag and secondary sedimentation tank sludge.

3. The rice field methane emission reduction application method according to claim 1 or 2, characterized in that: The methane oxidizing bacteria group includes: Clausella ( Cloacibacterium ), Methylocystis ( Methylocystis ), Bacillus pamoate ( Emticicia )、Chryseobacterium Chryseobacterium ), Azospirillum ( Azospirillum ) and Methylomonas ( Methylomonas ), the relative abundances of the six were 29.44%, 23.44%, 20.62%, 7.67%, 5.68%, and 1.10% respectively; and Methylocystis ( Methylocystis ), Clausella Cloacibacterium ), Methylomonas ( Methylomonas ), Subaerial bacteria ( Phreatobacter ), Flavobacterium ( Flavobacterium ), and the relative abundances of the five were 31.78%, 24.45%, 23.43%, 5.06%, and 3.36%, respectively.

4. The rice field methane emission reduction application method according to claim 1 is characterized in that: The methane oxidizing bacteria enrichment solution is prepared by the following method: Step 1, taking a methane-rich environmental sample, introducing a mixture of methane and oxygen in a volume ratio of 1:1, at 30°C, and sealing and acclimatizing for 1 week to achieve rejuvenation of the methane-oxidizing strain; Step 2: Inoculate the rejuvenated methane-rich environmental sample obtained in step 1 into the selective enrichment medium NMS medium, without adding other organic carbon sources, and introduce a mixture of methane and air with a volume ratio of 1:1 for enrichment culture. The bacterial liquid concentration OD 600 Value detection, when OD 600 When the value exceeds 0.6, the culture medium is transferred to fresh NMS medium at a volume ratio of 10% and transferred for 5 times to obtain the enriched solution of methane oxidizing bacteria. Step 3, the methane oxidizing bacteria enriched solution grown to the logarithmic phase obtained in step 2 is transferred to the paddy field acclimation culture solution, and a mixed gas of methane and air with a volume ratio of 1:1 is introduced into the mixed solution containing the methane oxidizing bacteria enriched solution and the paddy field acclimation culture solution for acclimation culture. The acclimation culture is divided into 4 stages. In the first stage, the volume ratio of the paddy field soil supernatant in the paddy field acclimation culture solution is 25%, the volume ratio of the paddy field soil supernatant in the paddy field acclimation culture solution in the second stage is 50%, the volume ratio of the paddy field soil supernatant in the paddy field acclimation culture solution in the third stage is 75%, and the volume ratio of the paddy field soil supernatant in the paddy field acclimation culture solution in the fourth stage is 95%, thereby obtaining a methane oxidizing bacteria community.

5. The rice field methane emission reduction application method according to claim 1 is characterized in that: The paddy field acclimation culture solution is prepared by adding paddy field soil supernatant in different volume ratios to NMS culture medium, and the added amount of paddy field soil supernatant accounts for 25-95% of the total volume ratio.

6. The rice field methane emission reduction application method according to claim 1 is characterized in that: The paddy field soil supernatant is obtained by adding paddy field soil to sterile water at a mass concentration (W / V) of 2%, oscillating at 30° C. and 150 rpm for 10 min, and taking the supernatant after standing for 30 min.

7. The rice field methane emission reduction application method according to claim 1 is characterized in that: The components and concentrations of the NMS culture medium are: MgSO4·7H2O 0.2 g / L, CaCl2·6H2O 0.14 g / L, KNO3 1.0 g / L, phosphate solution 50 mL / L and trace element solution 2 mL / L.

8. The rice field methane emission reduction application method according to claim 7 is characterized in that: The components and concentrations of the phosphate solution are: KH2PO4 5.44 g / L and Na2HPO4 5.68 g / L.

9. The rice field methane emission reduction application method according to claim 7 is characterized in that: The components and concentrations of the trace element solution are: Na2-EDTA 1.0 g / L, FeSO4·7H2O 2.0 g / L, ZnSO4·7H2O 0.8 g / L, MnCl2·4H2O 0.03 g / L, H3BO3 0.03 g / L, CoCl2·6H2O 0.2 g / L, CuCl2·2H2O 0.6 g / L, NiCl2·6H2O0.02 g / L and Na2MoO4·2H2O 0.05 g / L.

Images