Phthalide compound synthase LcP450, nucleotide sequence encoding the same and application thereof

Abstract

The present invention discloses a phthalide compound synthase LcP450, a nucleotide sequence encoding the same and an application thereof, and belongs to the technical field of bioengineering. The amino acid sequence thereof comprises an amino acid sequence shown in SEQ ID No.1 or SEQ ID No.2; or a functional homologous sequence having at least 75% sequence identity with the amino acid sequence shown in SEQ ID No.1 or SEQ ID No.2; or an amino acid sequence having the same protein activity by adding, deleting or replacing one or more amino acids in the amino acid sequence shown in SEQ ID No.1 or SEQ ID No.2. The phthalide compound synthase LcP450 provided by the present invention is helpful to understand the synthesis pathway of phthalide compounds, and provides a new gene resource for increasing the content of butenylphthalide and butylphthalide in Chuanxiong seeds by genetic engineering means.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and relates to a phthalide compound synthase LcP450, a nucleotide sequence encoding the same and an application thereof. The enzyme can be used for the biosynthesis of 3-substituted phthalide compounds (such as butenylphthalide). Background Art

[0002] Phthalide compounds are a class of compounds with pharmaceutical activity isolated from medicinal plants. Ligusticum Chuanxiong hort.) is a plant of the genus Ligusticum of the Apiaceae family. Its root is used as medicine and it is mainly distributed in Sichuan in my country. In traditional Chinese medicine, Chuanxiong is used to treat irregular menstruation, amenorrhea, dysmenorrhea, abdominal pain due to abdominal masses, chest and flank pain, swelling and pain due to falls, headache, rheumatic pain and other related diseases. At present, nearly 60 phthalide compounds have been isolated from Chuanxiong, including ligustilide, butylphthalide and other compounds, which have multiple pharmacological effects such as vasodilation, antioxidant, antithrombotic, antibacterial and anti-inflammatory. Different modification sites and different substituents make phthalide compounds have structural diversity, and also give phthalide monomer compounds different physiological functions and medicinal values. Among them, butylphthalide was found to effectively inhibit the growth of glioma in animal models. At the same time, butylphthalide can also be used as a precursor for the synthesis of butylphthalide, a drug for the clinical treatment of ischemic stroke. Therefore, the study of the synthesis pathway of butenylphthalide is of great significance for increasing the content of butenylphthalide and butylphthalide in Chuanxiong by genetic engineering.

[0003] Cytochrome p450 (CYP450) is widely present in the biological world and has monooxygenase activity. CYP450 accounts for about 1% of plant protein-encoding genes and is the most involved in plant secondary metabolic activities. It has complex substrate selectivity. Cytochrome p450 has a wide range of catalytic activity and catalyzes a variety of primary and secondary metabolic reactions in plants, including the synthesis and metabolism of terpenes, alkaloids, sterols, fatty acids, plant hormones, flavonoids, etc., involving hydroxylation, epoxylation, dehydrogenation, alkylation and other types of reactions. With the continuous development of molecular biology and related technologies, the function of CYP450 in secondary metabolic pathways has been gradually verified, but in the biosynthesis pathway of butylphthalide, no CYP genes involved in the structural modification of phthalide compounds have been identified. Summary of the invention

[0004] The purpose of the present invention is to provide a phthalide compound synthase LcP450 involved in the biosynthesis of butenylphthalide in Chuanxiong, a nucleotide sequence encoding the same and application.

[0005] The first aspect of the present invention provides a phthalide compound synthase LcP450, wherein the amino acid sequence of the phthalide compound synthase LcP450 comprises or consists of the following sequence:

[0006] a) the amino acid sequence shown in SEQ ID No.1 or SEQ ID No.2; or

[0007] b) a functional homologous sequence having at least 75% sequence identity with the amino acid sequence shown in SEQ ID No. 1 or SEQ ID No. 2; or

[0008] c) an amino acid sequence having the same protein activity as that of SEQ ID No. 1 or SEQ ID No. 2 by adding, deleting or replacing one or more amino acids.

[0009] The present invention uses the medicinal plant Chuanxiong of Umbelliferae Ligusticum chuanxiong hort. was selected as the research object, and two genes encoding phthalide synthase LcP450 were screened and isolated, named LcCYP72A and LcCYP716E The encoded protein obtained has the function of catalyzing the substrate ligustilide to produce butenylphthalide.

[0010] In one embodiment of the present invention, the phthalide synthase LcP450 LcCYP72A , LcCYP716E The amino acid sequence is the amino acid sequence shown in SEQ ID No.1 and SEQ ID No.2.

[0011] In one embodiment of the present invention, the phthalide synthase LcP450 LcCYP72A , LcCYP716E The amino acid sequence is a functional homologous sequence having at least 75% sequence identity with the amino acid sequence shown in SEQ ID No. 1 and SEQ ID No. 2. The functional homologous sequence includes, but is not limited to, an amino acid sequence having about 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more, 99.5% or more, 99.9% or more identity with the amino acid sequence shown in SEQ ID No. 1 and SEQ ID No. 2.

[0012] In one embodiment of the present invention, the phthalide synthase LcP450 LcCYP72A , LcCYP716EThe amino acid sequence is an amino acid sequence in which one or more (for example, 1 to 10 or more, specifically, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) amino acids are added, deleted, or substituted in the amino acid sequence shown in SEQ ID No. 1 or SEQ ID No. 2 and has the same protein activity.

[0013] The second aspect of the present invention provides a nucleotide sequence encoding the phthalide compound synthase LcP450.

[0014] Furthermore, the nucleotide sequence encoding the phthalide synthase LcP450 comprises or consists of the following sequence:

[0015] 1) the nucleotide sequence shown in SEQ ID No.3 or SEQ ID No.4; or

[0016] 2) a complementary sequence, a degenerate sequence or a homologous sequence of the nucleotide sequence shown in SEQ ID No.3 or SEQ ID No.4; or

[0017] 3) A nucleotide sequence that hybridizes with the nucleotide sequence shown in SEQ ID No. 3 or SEQ ID No. 4 and can encode a phthalide synthase LcP450.

[0018] In one embodiment of the present invention, LcCYP72A and LcCYP716E The nucleotide sequences are the nucleotide sequences shown in SEQ ID No.3 and SEQ ID No.4.

[0019] In one embodiment of the present invention, LcCYP72A and LcCYP716E The nucleotide sequence is a complementary sequence formed by the nucleotide sequences shown in SEQ ID No.3 and SEQ ID No.4 according to the principle of base complementary pairing, and the complementary sequence may be a sequence having a coding LcCYP72A and LcCYP716E Functionally incomplete complementary sequences or completely complementary sequences.

[0020] In one embodiment of the present invention, LcCYP72A and LcCYP716E The nucleotide sequence is a degenerate sequence of the nucleotide sequences shown in SEQ ID No.3 and SEQ ID No.4. A degenerate sequence means that after changing one or more nucleotide sequences of SEQ ID No.3 and SEQ ID No.4, the amino acid types encoded by the changed nucleotide sequence positions remain unchanged and will not affect LcCYP72A and LcCYP716E Gene function and expression level.

[0021] In one embodiment of the present invention, LcCYP72A and LcCYP716E The nucleotide sequence is a homologous sequence of the nucleotide sequence shown in SEQ ID No.3 and SEQ ID No.4. The homologous sequence includes a sequence encoding a phthalide synthase LcP450 generated by adding and / or replacing and / or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID No.3 and SEQ ID No.4. LcCYP72A and LcCYP716E Active mutant gene, allele or derivative.

[0022] It is further preferred that the homologous sequence is about 80% or more, 85% or more, 90% or more, 95% or more, 99% or more, 99.5% or more, or 99.9% or more similar to the nucleotide sequence shown in SEQ ID No.3 and SEQ ID No.4 and has the ability to encode a phthalide synthase. LcP450 Functional polynucleotides.

[0023] The third aspect of the present invention provides the use of the phthalide synthase LcP450 or the nucleotide sequence encoding the phthalide synthase LcP450 in the synthesis of 3-substituted phthalide compounds, especially in the synthesis of butenylphthalide.

[0024] Wherein, the application of the phthalide compound synthase LcP450 in the synthesis of butenylphthalide includes the following aspects:

[0025] (1) The present invention provides LcCYP72A and LcCYP716E The amino acid sequence or at least part of it can still have biological activity or even new biological activity after some amino acids are removed or replaced.

[0026] (2) Involving the biosynthesis of butylphthalide.

[0027] The application of the nucleotide sequence encoding the phthalide compound synthase LcP450 in the synthesis of butenylphthalide includes the following aspects:

[0028] (1) The nucleotide sequence provided by the present invention or at least part of the nucleotide sequence is modified or mutated. The modification or mutation methods include insertion, deletion, error-prone PCR, reconnection of different sequences, directed evolution of different parts of the sequence with homologous sequences from other sources, or mutagenesis by chemical reagents, etc.

[0029] (2) The nucleotide sequence provided by the present invention or at least a part of the cloned gene of the nucleotide sequence is expressed in an exogenous host or an endogenous host through certain expression systems to obtain the corresponding enzyme activity or other higher biological activity yield.

[0030] (3) The nucleotide sequence or gene or gene cluster of at least part of the nucleotide sequence provided by the present invention can be used to construct a recombinant plasmid through homologous recombination to obtain a new synthetic pathway for the compound, or can be used to obtain a new synthetic pathway for the compound through insertion, replacement, deletion or inactivation.

[0031] The fourth aspect of the present invention provides primers for amplifying nucleotide sequences, wherein the base sequences of the primers are shown as SEQ ID No.5 and SEQ ID No.6 or SEQ ID No.7 and SEQ ID No.8.

[0032] The fifth aspect of the present invention provides a vector into which the nucleotide sequence is transferred.

[0033] There is no specific limitation on the type of vector, and a suitable vector can be selected as needed. For example, the vector includes but is not limited to pEAQ-HT, pSuper-1300, pET-28a, pET30a, pET24b, pESC-Ura, pESC-Trp, pESC-Leu, pESC-His, pGEX2T, pTAex3, pYMB03, preferably pSuper1300 and pET24b.

[0034] The sixth aspect of the present invention provides a genetically engineered host cell, which comprises the amino acid sequence, or the nucleotide sequence, or is introduced with the vector.

[0035] Furthermore, the host cell includes at least one of a plant cell and / or a microbial cell.

[0036] Further, the plant cells include at least one of Chuanxiong cells and tobacco cells. The source of the plant cells here also includes plant parts of explants, including but not limited to: cuttings, tissue culture, cell suspensions and callus.

[0037] Furthermore, the microbial cells include at least one of Streptomyces, Pseudomonas, Bacillus, yeast cells, and Escherichia coli.

[0038] Furthermore, methods for introducing a nucleotide sequence encoding a phthalide synthase LcP450, or a recombinant plasmid, or an expression vector into a host cell in vivo and in vitro include, but are not limited to, electroporation, polyethylene glycol (PEG) conversion, lipofection, heat shock, calcium phosphate precipitation, virus-mediated and microinjection.

[0039] The beneficial effects of the present invention are:

[0040] The invention provides a newly discovered phthalide compound synthase LcP450, which is helpful to understand the synthesis pathway of phthalide compounds, provides a new gene resource for increasing the content of butenylphthalide and butylphthalide in Chuanxiong by genetic engineering means, and is conducive to obtaining corresponding enzymes or higher active products or yields by expressing genes in host cells through directed evolution or cloning. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 is the content of phthalide substances in different tissues of Chuanxiong, where a is butylphthalide, b is butenylphthalide, c is ligustilide A, and d is ligustilide.

[0042] Figure 2 The recombinant plasmid pSuper1300- LcCYP716E and pSuper1300- LcCYP72A PCR identification results.

[0043] Figure 3 For example, GC-MS was used to detect pSuper1300- LcCYP716E and pSuper1300- LcCYP72A Ion chromatogram (TIC) of the enzymatic products.

[0044] Figure 4 is pSuper1300- in Example 2 LcCYP716E and pSuper1300- LcCYP72A Mass spectrum of the main enzymatic product butenylphthalide, with the parent ion and characteristic ion being m / z 188 and m / z 159, respectively.

[0045] Figure 5 is pSuper1300- in Example 2 LcCYP716E and pSuper1300- LcCYP72A Schematic diagram of the reaction mechanism for catalyzing the formation of butenylphthalide from ligustilide. DETAILED DESCRIPTION

[0046] In the present invention, the term "LcP450" is a phthalide compound synthase, and specifically can refer to ligustilide oxidase, or butenylphthalide synthase, and the specific meaning can be determined in combination with the context.

[0047] Below in conjunction with embodiment, technical scheme of the present invention is clearly and completely described, obviously, described embodiment is only a part of embodiment of the present invention, rather than all embodiments. Embodiment is carried out according to conventional experimental conditions or according to the condition suggested by manufacturer's specification. Unless otherwise defined, all professional terms used in the present invention have the same meaning as those skilled in the art are generally understood. In addition, any method and material similar or identical to the described content can be used in the inventive method, based on the embodiment in the present invention, all other embodiments obtained by those skilled in the art under the premise of not paying creative work, all belong to the scope of protection of the present invention.

[0048] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods. The materials, reagents and consumables used are all commercially available unless otherwise specified.

[0049] The materials and reagents involved in the following examples include: Ligusticum chuanxiong hort. plants, purchased from farmers in Junle Town, Pengzhou City, Sichuan Province, available to the public from the Chinese Medicinal Materials World website, and identified as commercial Ligusticum chuanxiong by colleagues with plant taxonomy background in the unit. OMEGA Plant RNA Kit (Omega), NovoScript® Plus All-in-one 1st Strand cDNA Synthesis SuperMix (gDNA Purge) (Novoprotein), KOD OneTM PCR Master Mix -Blue- (Toyobo), Gel & PCR Clean Up Kit (Omega), HiPure PCR Purure Micro Kit (Magen), HiPure Plasmid Micro Kit C (Magen), BamHⅠ (NEB), EocRⅠ (NEB), XbaⅠ (NEB), KpnⅠ (NEB), Fast DNA Assembly Mix (Cistrome), 2×T5 Super PCRMix (Colony) (Beijing Qingke), StarMarker D2000 (Genstar), DH5α (Kangti Life), GV3101 (Video Biological), primer synthesis (Beijing Liuhe BGI Gene Technology Co., Ltd.), gene sequencing (Beijing Liuhe BGI Gene Technology Co., Ltd.).

[0050] Construction of the detection system for butenylphthalide

[0051] In order to analyze the distribution of butylenephthalide in different tissues of Chuanxiong, the roots, stems and leaves of Chuanxiong were extracted with organic solvents such as methanol, ethyl acetate or methyl tert-butyl ether (MTBE). After filtering through a 0.22µm filter membrane, the content of butylenephthalide was determined by gas chromatography-mass spectrometry. The results are shown in Figure 2. Figure 1 shown.

[0052] Example 1 Chuanxiong LcCYP72A and LcCYP716E Clone

[0053] 1. Synthesis of cDNA from the root of Ligusticum chuanxiong

[0054] Take an appropriate amount of Chuanxiong root (stored in -80℃ refrigerator), grind it with liquid nitrogen, extract total RNA from Chuanxiong using Trizon method, and purify the extracted total RNA with DNase I and RNA purification kit to remove genomic contamination in RNA.

[0055] The reverse transcription system was as follows according to the instructions of Novoprotein's first-strand cDNA synthesis kit NovoScript® Plus All-in-one 1stStrand cDNA Synthesis SuperMix (gDNA Purge):

[0056] (1) Reaction of removing genomic DNA:

[0057]

[0058] Incubate at 42°C for 5 min and place on ice after the reaction is complete.

[0059] (2) Reverse transcription reaction:

[0060]

[0061] Incubate at 50°C for 30 min and 75°C for 5 min to terminate the reaction.

[0062] cDNA samples were stored at -20°C.

[0063] 2. LcCYP Gene cloning

[0064] Using cDNA from the root of Chuanxiong as a template, primers for amplifying nucleotide sequences were used. The primers included XbaⅠ and KpnⅠ Restriction site sequence, amplified by PCR LcCYP Genes, and XbaⅠ and KpnⅠThe linear pSuper1300 vector was recombined by double restriction enzyme digestion, and the recombinant plasmid was obtained by using the Fast DNA Assembly Mix kit. After transformation into Escherichia coli DH5α, the plasmid was extracted for PCR identification (Beijing Liuhe BGI Gene Technology Co., Ltd.). The positive recombinant plasmid was named pSuper1300- LcP450 The PCR identification results are as follows Figure 2 shown.

[0065] Among them, the amplification primer sequence of LcCYP72A is as follows:

[0066] LcCYP72A -Forward:

[0067] CTCGATACACCAAATCGACTCTAGA ATGTGGTTTGGACCGGC (the underline in SEQ ID No.5 is the vector sequence).

[0068] LcCYP72A -Reverse:

[0069] CCCTTGCTCACCATGGTACC TAGCTTGTGTACAATCAACTTAG (the underlined sequence in SEQ ID No. 6 is the vector sequence).

[0070] The amplification primer sequences for LcCYP716E are as follows:

[0071] LcCYP716E -Forward:

[0072] CTCGATACACCAAATCGACTCTAGA ATGGATACAATAGAGTTTTTGAGC (the underline of SEQ ID No. 7 is the vector sequence).

[0073] LcCYP716E -Reverse:

[0074] CCCTTGCTCACCATGGTACC TATTTTATGGCGAATTAGACG (the underlined sequence in SEQ ID No. 8 is the vector sequence).

[0075] 3. Glue recycling

[0076] Mix the PCR product with DNA loading buffer and electrophoresed it on a 1% agarose gel at 140V for 15 minutes. Cut the gel containing the DNA fragment with a blade as close to the DNA fragment as possible, put the cut gel into a weighed 1.5 mL centrifuge tube and weigh it, and record the weight of the recovered gel. Add an equal amount of (V:m=1:1) Binging buffer and incubate in a 50℃ water bath for 10 minutes. During this period, invert and mix 2-3 times to promote gel melting and ensure that the gel is completely dissolved. Vortex the gel mixture quickly before loading it on the column. Transfer up to 750 µL of the gel mixture to the recovery purification column, centrifuge at 13000 rpm for 1 minute, discard the permeate, and then return the recovery column to the same collection tube. Add 700 µL Wash Buffer to the purification column, centrifuge at 13000 rpm for 1 min, discard the permeate, and then return the purification column to the collection tube. Centrifuge the empty purification column at 13000 rpm for 1 min to completely remove the residual Wash. Buffer; move the purification column to a 1.5 mL microcentrifuge tube, add 30-50 µL ddH2O (preheated at 65°C) to the purification column, let it stand for 2 min, and centrifuge at 13,000 rpm for 1 min; discard the purification column and store the purified DNA in a -80°C refrigerator.

[0077] Example 2 LcCYP72A and LcCYP716E Heterologous expression of tobacco

[0078] The recombinant vector obtained in Example 1 was introduced into Agrobacterium GV3101, and the recombinant Agrobacterium GV3101 was used to infect Nicotiana benthamiana leaves. The Agrobacterium transformed with the pSuper1300 vector was used as a control strain. Nicotiana benthamiana was cultured at 25°C and 16h of light until it grew to 6 true leaves for Agrobacterium infection. The Agrobacterium containing the recombinant plasmid was cultured at 28°C with an OD of 600 =1.0, resuspend and wash the bacteria once with injection buffer, and then detoxify in injection buffer for 2 h at room temperature and away from light. The injection buffer formula is shown in Table 1. Then, use a 1 mL sterile syringe to inject into the tobacco leaves on the back of the tobacco, keep away from light overnight, and culture at 25℃, 16 h light conditions. After 3 days, inject 100 µM substrate ligustilide. After 1 day, collect the tobacco and store at -80℃ for future use.

[0079] Table 1 Injection buffer formulation

[0080]

[0081] The GC-MS was used to detect the butylphthalide content in transgenic tobacco, and the following steps were taken:

[0082] Sample pretreatment: Tobacco was freeze-dried and ground into powder in a mortar. Every 100 mg of tobacco was extracted with 2 mL of ethyl acetate. The extract was ultrasonically treated for 30 min and centrifuged at 12000 rpm and 4 °C for 10 min. The supernatant was collected and concentrated in vacuo to 0.5 mL. The supernatant was filtered into a brown sample bottle with a 0.45 µm nylon filter for injection.

[0083] GC-MS conditions: GC-MS instrument was Agilent 7890B / 7000C (Agilent Technologies, Waldbronn, USA), mass spectrometer parameters: 70 eV, helium flow rate 1.2 mL min -1 , chromatographic column Agilent HP-5MS (5% phenylmethyl silica, 30 m×250 μm inner diameter, 0.25 μm film thickness); temperature program starting at 50℃, rising to 130℃ at 4℃ / min, then rising to 230℃ at 2℃ / min, retaining for 10min, then rising to 250℃ at 2℃ / min, retaining for 5min; helium flow rate 1.0 mL / min, injection port 250℃; injection mode, pulsed non-split flow, injection volume, 1µL. Mass spectrometry conditions: standard EI source (bombardment energy of 70eV), ion source temperature 230℃, interface temperature 280℃, scanning mass-to-charge ratio (m / z) 40-350, and butylphthalide standard as the control group, the product was qualitatively and quantitatively analyzed.

[0084] The results of heterologous expression of LcCYP72A and LcCYP716E in Nicotiana benthamiana are shown in Figure 3 and Figure 4 As shown, Figure 3 , 4 The results in the literature show that LcCYP72A and LcCYP716E can catalyze the production of ligustilide to butenylphthalide. The catalytic reaction mechanism is as follows Figure 5 shown.

[0085] The above is only a preferred embodiment of the present invention. It should be understood that the present invention is not limited to the form disclosed herein, and should not be regarded as excluding other embodiments, but can be used in various other combinations, modifications and environments, and can be modified within the scope of the concept described herein through the above teachings or the technology or knowledge of the relevant field. The changes and modifications made by those skilled in the art shall not deviate from the spirit and scope of the present invention, and shall be within the scope of protection of the claims attached to the present invention.

Claims

1. A phthalide compound synthase LcP450, characterized in that: The amino acid sequence of the phthalide compound synthase LcP450 is as follows: Composition: the amino acid sequence shown in SEQ ID No.1 or SEQ ID No.

2.

2. The nucleic acid encoding the phthalide synthase LcP450 according to claim 1, characterized in that: The sequence of the nucleic acid consists of the following sequence: the nucleotide sequence shown in SEQ ID No.3 or SEQ ID No.

4.

3. Use of the phthalide compound synthase LcP450 according to claim 1 or the nucleic acid according to claim 2 in the synthesis of butenylphthalide.

4. A primer for amplifying the nucleic acid according to claim 2, characterized in that: The base sequences of the primers are shown as SEQ ID No.5 and SEQ ID No.6 or SEQ ID No.7 and SEQ ID No.

8.

5. A carrier, characterized in that: Comprising the nucleic acid of claim 2.

6. A genetically engineered host cell, characterized in that: The method comprises the amino acid sequence of claim 1, or the nucleic acid of claim 2, or is introduced into the vector of claim 5.

7. The genetically engineered host cell of claim 6, wherein: The host cell includes at least one of a plant cell and / or a microbial cell.

8. The genetically engineered host cell of claim 7, wherein: The plant cells include at least one of Chuanxiong cells and tobacco cells.

9. The genetically engineered host cell of claim 7, wherein: The microbial cells include at least one of Streptomyces, Pseudomonas, Bacillus, yeast cells and Escherichia coli.

Images