Ligand binding assay for gdf15

By using magnetic bead SELEX technology for screening and site-directed mutagenesis optimization, a highly specific and stable GDF15 aptamer APT2TM was obtained, solving the problem of early glaucoma diagnosis and providing an early screening and rapid diagnostic tool.

CN115976029BActive Publication Date: 2026-02-06EYE & ENT HOSPITAL SHANGHAI MEDICAL SCHOOL FUDAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211724297.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-30
Publication Date
2026-02-06
Estimated Expiration
2042-12-30

AI Technical Summary

Technical Problem

Current technologies struggle to diagnose glaucoma accurately in its early stages. Current diagnostic methods require visual impairment of more than 50% in patients to make an accurate diagnosis, and there is a lack of molecular tools that specifically identify GDF15.

Method used

Highly specific aptamers APT1 and APT2 were obtained by screening using magnetic bead SELEX technology. APT2T was obtained through truncation optimization, and APT2TM was obtained through site-directed mutagenesis, which improved binding affinity and stability.

Benefits of technology

It achieves high affinity, strong specificity and high stability binding to GDF15. The aptamer can be used for the capture and detection of GDF15 and the development of therapeutic drugs for related diseases, providing early screening and rapid diagnostic tools.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115976029B_ABST
    Figure CN115976029B_ABST
Patent Text Reader

Abstract

The application relates to the technical field of biological medicine engineering, and relates to an aptamer specifically combined with GDF15, a sequence general formula of which is as follows: 5'-AGCAGCACAGAGGTCAGATG-N 40 -CCTATGCGTGCTACCGTGAA-3'; wherein N is any one of A, T, G and C, four deoxyribonucleotide bases, 40 represents the number of random bases, and the sequence is preferably as shown in any one of SEQ ID NO. 1-4. The aptamer has wide application prospects and can be used for GDF15 capture in a system, GDF15 detection in and out of a body, development of GDF15 therapeutic drugs in related diseases and construction of a targeted drug delivery system and the like. The aptamer has great potential for practical application.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine engineering, relates to the technical field of biological medicine engineering in ophthalmology, and in particular to an aptamer specifically combined with growth differentiation factor 15 (GDF15) and application thereof. BACKGROUND

[0002] Glaucoma is a group of neurodegenerative diseases with common features of optic disc atrophy and excavation, visual field defects and visual acuity decline. Glaucoma has the characteristics of insidious onset, difficulty in early diagnosis, irreversible damage to visual function, etc. Early screening, early diagnosis and early intervention of glaucoma can effectively block or delay the progression of the disease, thereby protecting patients from severe visual loss.

[0003] At present, glaucoma diagnosis mainly relies on comprehensive evaluation of intraocular pressure measurement, morphological and functional examination. However, there is a huge difference in intraocular pressure between patients, and morphological and functional examination can only accurately diagnose when the patient's visual function is damaged by more than 50%. Therefore, early diagnosis of glaucoma has always been a hot and difficult point in this field. Growth differentiation factor 15 (GDF15) is a characteristic biomarker related to optic nerve damage in glaucoma. A large number of studies have confirmed that the level of GDF15 in intraocular fluid has a significant dose-dependent relationship with the occurrence and development of glaucoma. By accurately monitoring GDF15, it will help the screening, diagnosis and intervention of glaucoma.

[0004] The problem to be solved at present is to obtain a molecular tool that can specifically recognize GDF15. As a new type of biological recognition molecule, aptamer can specifically recognize and bind to the target with high affinity. It is usually a ssDNA or RNA molecule obtained from a random nucleic acid library by using an in vitro screening technology, i.e. Systematic evolution of ligands by exponential enrichment (SELEX). Aptamer can be used for the capture, detection and imaging of specific targets, as well as the research and development of corresponding therapeutic drugs and the construction of targeted drug delivery systems, due to its advantages of chemical synthesis, easy labeling and modification, low immunogenicity and toxicity, high affinity and specificity, etc. It has broad application prospects in the fields of analysis, diagnosis and medicine. SUMMARY

[0005] The present application is to solve the above technical problems, and aims to provide an aptamer specifically combined with GDF15 and application thereof.

[0006] The present application aims to provide several single-chain DNA aptamers capable of binding to GDF15 with high affinity and strong specificity. Aptamers APT1 and APT2 are first screened and tested for affinity between the two aptamers and GDF15, obtaining an aptamer APT2 with the lowest affinity constant (K D ) value.

[0007] The second object of the present application is to optimize the aptamer APT2 in a truncated manner to provide a GDF15 aptamer APT2T with better binding ability but shorter length. It not only maintains high recognition specificity to GDF15, but also increases the binding affinity from 9.2nM to 1.07nM.

[0008] The third object of the present application is to continue optimizing the aptamer APT2T. In order to further improve the structural stability of the aptamer, we perform site-directed mutagenesis on APT2T to obtain the aptamer APT2TM. Compared with APT2T, APT2TM not only folds into a more stable G-quadruplex structure, but also maintains consistent binding strength and specificity to GDF15.

[0009] The fourth object of the present application is to provide applications of the aptamer, such as the application of the aptamer in preparing a GDF15 separation and enrichment reagent, in preparing a GDF15 detection reagent, kit or sensor, and in preparing a drug for diagnosing, alleviating or treating a GDF15-mediated disease, such as early screening and rapid diagnosis and treatment of glaucoma.

[0010] In order to achieve the above objects, the main technical solutions of the present application are as follows: (1) high-specificity aptamers APT1 and APT2 targeting GDF15 are obtained through magnetic bead SELEX technology screening; (2) high-specificity and high-affinity aptamer APT2 targeting GDF15 is obtained through truncation optimization; and (3) high-specificity, high-affinity and high-stability aptamer APT2TM targeting GDF15 is obtained through mutation optimization. The specific technical solutions are as follows:

[0011] In the first aspect of the present application, an aptamer specifically binding to GDF15 is provided, and the sequence of the aptamer is as follows: 5'-AGCAGCACAGAGGTCAGATG-N 40 -CCTATGCGTGCTACCGTGAA-3'; wherein N is any one of A, T, G and C, and 40 represents the number of random bases.

[0012] The following representative sequences are obtained through magnetic bead-SELEX technology screening:

[0013] APT1: ACTAGGTCAGGATACTGTTGCGCACGCCCAGAGTTATCTA (SEQ ID NO. 1);

[0014] APT2: TGAGGCGAGTAGGATAGGGTATGGGATGGGTTCGTTGCAC (SEQ ID NO. 2).

[0015] The second aspect of the present application provides an aptamer APT2T: GGATAGGGTATGGGATGGG (SEQ ID NO. 3) which is a truncated version of APT2 and has a higher binding affinity but a shorter length.

[0016] The third aspect of the present application provides an aptamer APT2TM: GGGTAGGGTATGGGATGGG (SEQ ID NO. 4) which is a mutated version of APT2 and has a higher stability and a consistent binding affinity and specificity to GDF15.

[0017] Preferably, the aptamer APT2TM or APT2T or APT2 can be chemically modified at its 3' end or 5' end with biotin, FITC, thiol, etc.

[0018] The fourth aspect of the present application provides the use of the aptamer, selected from any one of the following situations:

[0019] (1) the use of the aptamer in the preparation of a GDF15 detection reagent, kit or sensor;

[0020] (2) the use of the aptamer in the preparation of a GDF15 capture, separation and purification preparation.

[0021] (3) the use of the aptamer in the development of a new method for diagnosing blinding eye diseases. The new method for diagnosing blinding eye diseases is based on the binding of the aptamer to GDF15 and can be used for early screening and rapid diagnosis of glaucoma.

[0022] (4) the use of the aptamer in the construction of a targeted drug delivery system. The targeted drug delivery system is based on the recognition of the aptamer to GDF15 and can be used for targeted transport and site-specific release of drugs.

[0023] (5) the use of the aptamer in the preparation of a nucleic acid drug. The drug is based on the neutralization or blocking effect of the aptamer to GDF15 and can be used to alleviate or treat diseases mediated by GDF15.

[0024] In a fifth aspect, the present application provides a pharmaceutical composition of an aptamer specifically binding to GDF15, wherein the aptamer specifically binding to GDF15 is used as an active ingredient, and a pharmaceutically acceptable carrier is further included.

[0025] Preferably, the pharmaceutical composition is a preparation for early screening and rapid diagnosis of glaucoma.

[0026] The pharmaceutical composition of the present application and the pharmaceutically acceptable adjuvant together constitute a pharmaceutical preparation composition, so as to more stably exert the curative effect, and these preparations can ensure the conformational integrity of the aptamer core sequence disclosed in the present application, and can also protect the multifunctional groups of the protein and prevent degradation (including but not limited to condensation, deamination or oxidation).

[0027] The beneficial guarantees and effects of the present application are as follows:

[0028] 1. The present application fixes GDF15 on the surface of magnetic beads, and a group of aptamers with high specificity for recognizing GDF15 is obtained through the screening of magnetic bead SELEX technology. The screening technology has the characteristics of simple operation, high repeatability, greatly simplified construction technology route, low production cost and short purification period. As a new type of molecular recognition probe, the aptamer has the advantages of low cost, stable properties and convenient modification, and is suitable for large-scale application in the industrialized production of biological and pharmaceutical industries.

[0029] 2. The present application further improves the binding affinity, targeting specificity and structural stability of the aptamer through optimization of truncation and mutation schemes.

[0030] 3. The aptamer of the present application has the advantages of high affinity, strong specificity, good stability, low immunogenicity, low preparation cost, easy modification and labeling, etc. as a molecular recognition tool for GDF15. It can be used for the capture of GDF15 in the system, the detection of GDF15 in vitro and in vivo, and the development of therapeutic drugs and the construction of targeted drug delivery systems mediated by GDF15 in related diseases.

[0031] Therefore, the aptamer of the present application has great potential for practical application. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 It is a schematic diagram of the magnetic bead SELEX technology.

[0033] Figure 2 It is the recovery rate of ssDNA binding to GDF15.

[0034] Figure 3 It is the binding dissociation curve of the aptamer APT1.

[0035] Figure 4 It is the binding dissociation curve of the aptamer APT2.

[0036] Figure 5 Predicted graph of aptamer secondary structure.

[0037] Figure 6 Binding dissociation curve for aptamer APT2T.

[0038] Figure 7 Binding dissociation curve for aptamer APT2T. DETAILED DESCRIPTION

[0039] The application is further described in connection with the following embodiments. It will be understood that these embodiments are intended to illustrate the application and not to limit its scope.

[0040] The experimental procedures in the following examples, unless otherwise specified, were generally performed according to routine conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise specified. Unless otherwise defined, all other technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. In addition, any method and material similar or equivalent to those described herein can be used in the practice of the present application. The preferred methods and materials described herein are intended to be illustrative only and are not intended to be limiting.

[0041] Example 1. Construction of aptamer screening library and primers thereof

[0042] 1. Construction of ssDNA library with length of 80 nucleotides

[0043] 5'-AGCAGCACAGAGGTCAGATG-N 40 -CCTATGCGTGCTACCGTGAA-3' (SEQ ID NO. 5); wherein N represents any one of bases A, T, C, G, N 40 represents a random sequence with length of 40 nucleotides.

[0044] 2. Construction of primers

[0045] Upstream primer: 5'-AGCAGCACAGAGGTCAGATG-3' (SEQ ID NO. 6);

[0046] Downstream primer 1: 5'-TTCACGGTAGCACGCATAGG-3' (SEQ ID NO. 7);

[0047] Downstream primer 2:

[0048] 5'-poly(dA20)-Spacer18-TTCACGGTAGCACGCATAGG-3' (SEQ ID NO. 8).

[0049] Example 2. Screening of GDF15 aptamers

[0050] like Figure 1 As shown, to obtain high-affinity aptamers that specifically bind to GDF15, we immobilized the GDF15 protein on the surface of magnetic beads via EDC / NHS chemical coupling and performed 10 rounds of screening. To improve screening efficiency, blank magnetic beads were introduced for reverse screening starting from the 5th round, and competitive reverse targets, including BSA, HSA, GTX, ATP, LCN1, and BDNF, were gradually added to the forward system for co-incubation to further improve the specificity of the screening.

[0051] The specific screening process is as follows: (1) Take 50 μL of GDF15 magnetic beads, rinse several times with screening buffer (PBS containing 2 mM MgCl2, pH 7.2), then add blocking buffer (containing 0.1 mg / mL yeast tRNA and 1 mg / mL BSA screening buffer) and incubate for 30 minutes. (2) Dissolve the ssDNA library in the screening buffer, 95°C water bath for 10 min, ice bath quenching for 5 min, room temperature for 10 min, then add to the blocked GDF15 magnetic beads, incubate at room temperature with low speed rotation. (3) After incubation, first rinse several times with screening buffer to remove unbound ssDNA, then add 100 μL of enzyme-free water, 95°C water bath for 10 min, then recover the ssDNA specifically bound to GDF15. (4) Take the eluted ssDNA as a template for PCR amplification, the reaction system includes: 10 μL of Hot start premix (5x); 2.5 μL of upstream and downstream primers (10 μM); 5 μL of template; finally add sterile water to make up the system to 50 μL, a total of 40 tubes. The amplification conditions are as follows: 94°C, pre-denaturation for 1 min; 95°C, denaturation for 30 s; 60°C, annealing for 30 s; 72°C, extension for 30 s; finally 72°C, extension for 2 min; a total of 20 cycles. (5) Add urea-denatured loading buffer to the amplified PCR library, 95°C water bath for 10 min, ice bath quenching for 5 min, room temperature for 5 min, then load into 12% urea-denatured polyacrylamide gel holes, electrophoresis at a constant voltage of 300 V. (6) After electrophoresis, add 20 ml of ddH2O and 5 μL of nucleic acid fluorescent dye to a clean dish, mix well, and then place the gel in the dish, and gently shake on a horizontal shaker. (7) After staining for 5-10 min, place the gel on a fluorescence imaging system, cut and recover the lower end ssDNA library into a 2 mL test tube, add 1.5 mL of ddH2O, boil the gel for 30 min, and then centrifuge to recover the supernatant. (8) Recover the ssDNA in the supernatant of the purification kit, and redissolve in the screening buffer for the next round of screening. II kit to recover and purify ssDNA in the supernatant, and redissolve in the screening buffer for the next round of screening.

[0052] According to the above screening process, repeat the process until the 10th round, the recovery rate of ssDNA is significantly increased Figure 2 ). Therefore, stop the screening, and perform high-throughput sequencing and multiple sequence alignment analysis on the enriched library, and finally obtain aptamers APT1 and APT2.

[0053] Example 3. Determination of intermolecular interaction by biofilm interference technology

[0054] Bio-layer interferometry is a real-time method for analyzing molecular interactions. The principle is that the instrument emits white light to the sensor surface, and the light is reflected after passing through the bio-layer of the sensor. Some frequencies of the reflected light will interfere constructively with the incident light, while others will interfere destructively. These interference light waves are detected by a spectrometer, forming an interference spectrum, and displayed as the relative displacement intensity of the interference spectrum. Therefore, once the number of molecules bound to the sensor surface changes, the spectrometer will detect the displacement of the interference spectrum in real time, and this displacement directly reflects the change in the thickness of the bio-layer on the sensor surface. That is, when the aptamer fixed on the bio-layer of the sensor interacts with GDF15 in the solution, it causes the thickness of the bio-layer to change, thereby generating a relative displacement, which increases or decreases with the increase or decrease of the binding amount of GDF15, and finally reaches a balance state and gives the corresponding binding curve, dissociation curve and affinity constant in real time.

[0055] The specific implementation process is as follows: (a) dissolve the biotin-labeled aptamer with a screening buffer, then place it in a 95°C water bath for 10 min, quench it in an ice bath for 5 min, and place it at room temperature for 10 min to promote the formation of a stable spatial structure; (b) add 200 μL of the screening buffer, the aptamer, the GDF15 protein and the screening buffer into the 96-well plate in sequence; (c) the streptavidin-coated sensor is immersed into each reaction well according to the instrument setting program, and after the five steps of sensor balancing, aptamer solidification, rinsing, GDF15 (or HSA, BSA) binding and dissociation, the results are shown in Figure 3 and Figure 4 As shown, the aptamers APT1 and APT2 can bind to GDF15 with high affinity and strong specificity, and the binding affinity constants are 28 and 9.2 nM, respectively.

[0056] Example 4. Optimization and identification of aptamer

[0057] In order to further improve the performance of the aptamer, truncation and mutation optimization strategies are introduced, respectively. As shown in Figure 5 APT2 can form a G-quadruplex structure based on QGRS prediction. By truncating the redundant sequences at both ends of the G-quadruplex, the core sequence of the G-quadruplex APT2T is generated. It not only maintains high recognition specificity to GDF15, but also increases the binding affinity to 1.07 nM Figure 6 ). In order to further improve the structural stability of the aptamer, we performed site-directed mutagenesis on APT2T to obtain aptamer APT2TM. Compared with APT2T, APT2TM not only folds into a more stable G-quadruplex structure, but also maintains consistent binding strength and specificity to GDF15 Figure 7). In addition, the aptamer APT2™ also showed high affinity to GDF15 protein of rat origin, and the binding affinity constant was 8.38 nM.

[0058] The above has been specifically described to the preferred embodiments of the present application, but the present application is not limited to the embodiments, and those skilled in the art can make various equivalent modifications or replacements without departing from the spirit of the present application, and these equivalent modifications or replacements are all included in the scope defined by the claims of the present application.

Claims

1. An aptamer that specifically binds to GDF15, characterized in that, The sequence of the aptamer is shown in any one of SEQ ID NO.1 to SEQ ID NO.

4.

2. The use of the aptamer that specifically binds to GDF15 as described in claim 1 in the preparation of GDF15 capture, separation, and purification formulations.

3. The use of the aptamer that specifically binds to GDF15 as described in claim 1 in the preparation of GDF15 detection or diagnostic reagents, kits, or sensors.

Citation Information

Patent Citations

  • Nucleic acid aptamers combined with high affinity of brain-derived neurotrophic factor and application of nucleic acid aptamers combined with high affinity of brain-derived neurotrophic factor

    CN115074367A