A circular RNA circABHD2 and its application in preparing diagnostic kits and therapeutic drugs for endometrial cancer

Abstract

The present invention discloses a circular RNA circABHD2 and its application in the preparation of a diagnostic kit and therapeutic drug for endometrial cancer, belonging to the field of circular RNA. The biomarker is circABHD2, which is produced by reverse splicing and circularization of the 2nd and 3rd exons of the ABHD2 gene on chromosome 15, and the nucleotide sequence is shown in SEQ ID NO: 1. Experimental verification shows that the expression of circABHD2 in endometrial cancer tissues and cells is significantly reduced, and is closely related to the FIGO stage of endometrial cancer patients. It also exerts a tumor inhibitory effect in vitro and can be used as a molecular target for the diagnosis and treatment of endometrial cancer, providing a circular RNA-based diagnosis and treatment solution for endometrial cancer.

Description

Technical Field

[0001] The present invention relates to the field of circular RNA, and in particular to a circular RNA circABHD2 and its application in preparing a diagnostic kit and therapeutic drugs for endometrial cancer. Background Art

[0002] Endometrial cancer (EC) accounts for approximately 7% of all female cancers and ranks first among female reproductive system malignancies in developed countries like Europe and the United States, posing a serious threat to women's health. With rising economic levels, increased life expectancy, and changes in lifestyle and dietary habits, the risk of developing the disease in Chinese women is increasing year by year, with a trend toward younger onset.

[0003] The treatment of endometrial cancer is mainly based on surgery and chemoradiotherapy. The 5-year survival rate of patients confined to the uterine body can reach over 95%. However, even after exhausting comprehensive measures including chemoradiotherapy, endocrine therapy, targeted therapy and immunotherapy, the 5-year survival rate of patients with local metastasis still drops rapidly to 69%, and the five-year survival rate of patients with distant metastasis is even only 17%. Therefore, exploring targets for early diagnosis of endometrial cancer and inhibiting the invasion and metastasis of endometrial cancer are obviously more conducive to patients achieving a good prognosis. Early screening for endometrial cancer in high-risk populations (obesity, diabetes, irregular vaginal bleeding, postmenopausal vaginal bleeding, Lynch syndrome, etc.) and proposing effective anti-invasion and metastasis treatment strategies are of great clinical significance.

[0004] With the rapid development of high-throughput RNA sequencing technology and bioinformatics methods, circular RNAs (circRNAs) specifically expressed in malignant tumors are increasingly being discovered. Their conservation, stability, disease specificity, and detectability make them potential diagnostic, therapeutic, and prognostic biomarkers for malignant tumors. CircRNAs are crucial for regulating the biological behavior of malignant tumors, including cell proliferation, tumor growth, cell cycle regulation, apoptosis, invasion, migration, angiogenesis, chemoresistance, and radiosensitivity. Furthermore, circRNAs play regulatory roles in various signaling pathways associated with the development and progression of malignant tumors, highlighting their potential as therapeutic targets. Furthermore, studies have shown that circUSP7 can induce resistance to anti-programmed death receptor 1 (PD-1) immunotherapy. The development of PBAE / si-ciRS-7 nanocomplexes targeting circUSP7 may represent a promising gene therapy strategy for the treatment of renal cell carcinoma. Given the vast untapped potential of circRNAs in the treatment of endometrial cancer, further exploration of the mechanisms of action of circRNAs in endometrial cancer holds significant potential research value. However, there is no research on circular RNA circABHD2 in existing technologies. Summary of the Invention

[0005] The purpose of the present invention is to provide a circular RNA circABHD2 and its use in the preparation of an endometrial cancer diagnostic kit and a therapeutic drug to solve the problems existing in the above-mentioned prior art. By screening and identifying a new biomarker for diagnosing endometrial cancer, it can be used as an endometrial cancer-specific biological target for the early diagnosis and treatment of endometrial cancer.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a circular RNA biomarker, wherein the biomarker is circABHD2. The circABHD2 is produced by reverse splicing and circularization of exons 2 and 3 of the ABHD2 gene on human chromosome 15, and the nucleotide sequence is shown in SEQ ID NO: 1.

[0008] The present invention also provides specific detection primers for the circular RNA biomarker, wherein the specific detection primers are nucleotide sequences shown in SEQ ID NO: 2-3.

[0009] The present invention also provides the use of the circular RNA biomarker or the specific detection primer in preparing a kit for diagnosing endometrial cancer.

[0010] The present invention also provides use of the circular RNA biomarker detection reagent in preparing a kit for diagnosing endometrial cancer.

[0011] The present invention also provides the use of the circular RNA biomarker in the preparation of an anti-endometrial cancer drug or pharmaceutical composition.

[0012] Preferably, the drug is a drug that promotes overexpression of the circular RNA biomarker.

[0013] The present invention also provides the use of the cyclic RAN biomarker in the preparation of a molecular targeted drug or pharmaceutical composition for endometrial cancer.

[0014] The present invention also provides a kit for diagnosing endometrial cancer, comprising a specific detection primer for detecting the circular RNA, wherein the specific detection primer is a nucleotide sequence shown in SEQ ID NO: 2-3.

[0015] Preferably, the method further comprises RNA extraction reagent, reverse transcription reaction system, housekeeping gene β-actin primer and RCR reaction reagent, and genomic DNA-free reaction system; the housekeeping gene β-actin primer is a nucleotide sequence as shown in SEQ ID NO: 4-5.

[0016] The present invention also provides a drug or pharmaceutical composition comprising the circular RNA biomarker, at least one of an agent that increases the expression of the circular RNA biomarker, and an agent that increases the activity of the expression product of the circular RNA biomarker, and a pharmaceutically acceptable carrier.

[0017] The present invention discloses the following technical effects:

[0018] The present invention provides a circular RNA molecule, circABHD2, and uses the circular RNA as a molecular marker for diagnosing endometrial cancer. The present invention also designs fluorescent quantitative detection primers for the circular RNA circABHD2 molecule. The primers can effectively detect the expression level of circABHD2 in vivo, providing a circular RNA-based detection scheme for the diagnosis of endometrial cancer. In addition, the expression level of circABHD2 in endometrial cancer tissue is significantly lower than that in normal tissue, and overexpression of circABHD2 can significantly inhibit the proliferation, invasion and metastasis of endometrial cancer cells. circABHD2 plays an important role in the malignant behavior mechanism of invasion and metastasis of endometrial cancer and can become a specific target for the treatment of metastatic endometrial cancer. This discovery can provide a basis for the development of new drugs for endometrial cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0020] Figure 1 Figures 1 and 2 show the formation pattern of the circular RNA circABHD2 of the present invention, a peak diagram of the circularization interface verified by sequencing, and a diagram of the relative expression levels in endometrial cancer cells and normal endometrial stromal cells; A is a diagram of the formation pattern of circABHD2, B is a peak diagram of the circularization interface verified by sequencing of circABHD2, and C is a diagram of the subcellular localization of circABHD2 in endometrial cancer cells;

[0021] Figure 2Figure 1 is a graph showing the expression level of circular RNA circABHD2 in endometrial cancer tissues and cells detected by fluorescent quantitative PCR of the present invention; A is the expression of circABHD2 in endometrial cancer tumor tissues and normal tissues, B is the relationship between the expression level of circABHD2 and FIGO stage, C is the receiver operating characteristic (ROC) curve of circABHD2 in endometrial cancer, and D is the expression of circABHD2 in endometrial cancer cells and normal endometrial stromal cells;

[0022] Figure 3 The effects of overexpression of circABHD2 on the proliferation, migration, and invasion of endometrial cancer cells are shown in the following figures; A is the relative expression level of circABHD2 after cells were transfected with a circABHD2-overexpressing plasmid (OE-circABHD2) and a control plasmid (OE-NC); B is the CCK-8 assay result; C is the clone formation assay result; D is the wound healing assay result; and E is the transwell chamber assay result. DETAILED DESCRIPTION

[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0024] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0025] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0026] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the present invention. The present description and examples are intended to be illustrative only.

[0027] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0028] The present invention provides a circular RNA biomarker, which is circABHD2. circABHD2 is produced by reverse splicing and circularization of exons 2 and 3 of the ABHD2 gene on human chromosome 15, and the nucleotide sequence is shown in SEQ ID NO: 1.

[0029] In the above scheme, 19 circular RNAs that were differentially expressed in three groups of endometrial cancer tissues and normal endometrial tissues were identified by RNA sequencing technology, and their expression levels were detected in endometrial cancer cells (HEC-1-A, RL95-2 and ishikawa) and normal endometrial stromal cells (hESC) by RT-qPCR technology. Finally, a 300nt circular RNA molecule circABHD2 was identified in endometrial cancer tissues, and its RNA sequence is shown in SEQ ID NO:1. The circular RNA circABHD2 is produced by reverse splicing and circularization of exons 2 and 3 of the ABHD2 gene, and its circularization interface was verified by Sanger sequencing.

[0030] The present invention also provides specific detection primers for the circular RNA biomarkers, wherein the specific detection primers are nucleotide sequences shown in SEQ ID NO: 2-3.

[0031] In the above scheme, the nucleotide sequence of the target circular RNA molecule circABHD2 can be specifically amplified by the above-mentioned specific detection primers.

[0032] The present invention also provides the use of the aforementioned circular RNA biomarker or the aforementioned specific detection primer in the preparation of a kit for diagnosing endometrial cancer.

[0033] In this study, the expression level of circABHD2 was tested in 32 endometrial cancer tissues and 19 normal endometrial tissues by expanding the clinical sample size. The correlation between expression levels and clinical characteristics was analyzed. The study found that the circular RNA circABHD2 was significantly low in endometrial cancer cells and tissues and was closely associated with the FIGO stage of endometrial cancer patients. Furthermore, the closed loop structure of circABHD2 is not susceptible to RNase R attack and is very stable in vivo, making it an ideal molecular diagnostic marker.

[0034] The specific detection primer can specifically amplify circular RNA circABHD2 and serve as a detection reagent in a kit for early diagnosis of endometrial cancer.

[0035] The present invention also provides use of the above-mentioned circular RNA biomarker detection reagent in the preparation of a kit for diagnosing endometrial cancer.

[0036] The present invention also provides the use of the aforementioned circular RNA biomarker in the preparation of an anti-endometrial cancer drug or pharmaceutical composition.

[0037] In a preferred embodiment, the drug is a drug that promotes overexpression of the above-mentioned circular RNA biomarker.

[0038] The present invention also provides the use of the cyclic RAN biomarker in the preparation of a molecular targeted drug or pharmaceutical composition for endometrial cancer.

[0039] In the above scheme, the present invention transfected endometrial cancer cells HEC-1-A and Ishikawa with a circABHD2 overexpression plasmid or a control plasmid and conducted functional assays to examine the effect of circABHD2 on the invasion and migration of endometrial cancer cells. It was found that circABHD2 significantly inhibited the invasion and migration of endometrial cancer cells. The effect of circABHD2 on the proliferation of endometrial cancer cells was examined using CCK-8 and colony formation assays, revealing that circABHD2 significantly inhibited the proliferation activity of endometrial cancer cells. Therefore, the circular RNA circABHD2 and its analogs, or agents that increase its expression, can be used to prepare molecularly targeted drug compositions for endometrial cancer. Furthermore, by overexpressing circABHD2, the proliferation, invasion, and migration of endometrial cancer cells can be inhibited, and the resulting drugs can be used to prepare anti-endometrial cancer drugs.

[0040] The present invention also provides a kit for diagnosing endometrial cancer, comprising specific detection primers for detecting circular RNA, wherein the specific detection primers are nucleotide sequences shown in SEQ ID NO: 2-3.

[0041] In a preferred embodiment, the method further comprises RNA extraction reagent, reverse transcription reaction system, housekeeping gene β-actin primer and RCR reaction reagent, and genomic DNA-free reaction system; the housekeeping gene β-actin primer is a nucleotide sequence as shown in SEQ ID NO: 4-5.

[0042] In the above protocol, the method for detecting the circular RNA circABHD2 and diagnosing endometrial cancer includes the following steps: ① extracting total RNA from cells; ② removing residual genomic DNA from the extracted RNA using DNase; ③ reverse transcribing the RNA into cDNA; and ④ performing fluorescent quantitative PCR using reverse PCR primers to detect the expression of the circular RNA circABHD2 molecule. Therefore, a reagent combination including specific detection primers for detecting circular RNA can be prepared into a kit for the specific detection of circABHD2.

[0043] The present invention also provides a drug or pharmaceutical composition comprising at least one of a circular RNA biomarker, an agent that increases the expression of the circular RNA biomarker, and an agent that increases the activity of an expression product of the circular RNA biomarker, and a pharmaceutically acceptable carrier.

[0044] Example 1 Screening and identification of the biomarker circABHD2 in endometrial cancer tissue

[0045] 1. Identification of differentially expressed circular RNAs in endometrial cancer using RNA-seq technology

[0046] Clinical samples were collected primarily from female patients undergoing surgical treatment (Table 1). Three samples of tumor tissue were collected from patients with endometrial cancer, and three samples of normal endometrial tissue were collected from age-matched patients with benign lesions. High-throughput RNA sequencing was used to screen for differentially expressed circular RNAs (fold change > 2, p < 0.05, FDR < 0.05) between three pairs of endometrial cancer and normal endometrium. Results revealed that, relative to normal endometrial tissue, eight circular RNAs were highly expressed and eleven were underexpressed in endometrial cancer tissue.

[0047] Table 1 Basic information of clinical samples

[0048]

[0049] 2. Identification of CircABHD2 as a diagnostic marker for endometrial cancer

[0050] 2.1 Identify the presence of circular RNA circ ABHD2 by the following steps:

[0051] (1) Total RNA was extracted from endometrial cancer cells and normal endometrial cells using the Trizol method;

[0052] (2) Reverse transcribe RNA into cDNA using random primers. The reverse transcription reaction system includes: ① Removal of genomic DNA: RNA 1-xμL (2μg), DNase I 1μL, 10× buffer 1μL, RNase-free H2O to 10μL, digest in the reaction solution at 37℃ for 40min, and inactivate the DNA digestion enzyme at 85℃ for 3min. ② Reverse transcription into cDNA: Total RNA 2μg, Random primer 1μL, 2× RT Mix 5μL, RT Enzyme Mix 1μL, RNase-free H2O to 10μL, reaction conditions: 37℃ for 10min, 42℃ for 20min, 85℃ for 5min, 4℃ for 2min. Store at 4℃.

[0053] (3) Reverse amplification primers were designed for PCR amplification. The PCR products were confirmed to be specifically amplified by RNA gel electrophoresis. Fluorescence quantitative PCR was used to detect the expression of circular RNA circABHD2 molecules in tissues and cells. Based on the partial reference sequence provided in the circBase database, reverse PCR amplification primers were designed. The primer sequences were: F: 5'GTGTTTGAACCTGAAGAGCCC 3' (as shown in SEQ ID NO: 2), R: 5'CATTCATCTTGATCAATGTTACTTATTCT3' (as shown in SEQ ID NO: 3); the size of the partial sequence of circular RNA circABHD2 amplified by the primers was 215 bp. Primer sequences for the housekeeping gene β-actin were: F: 5'CACCTTCTACAATGAGCTGCGTGTG 3' (as shown in SEQ ID NO: 4), R: 5'ATAGCACAGCCTGGATAGCAACGTAC 3' (as shown in SEQ ID NO: 5). The PCR reaction system was as follows: 1.0 μL cDNA; 0.3 μL each of the upstream and downstream primers; 7.5 μL 2× Taqman PCR Master Mix; and ddH2O to make up to 15 μL of the reaction system. Reaction conditions were: denaturation at 95°C for 5 minutes, followed by 40 cycles of 95°C for 10 seconds and 60°C for 10 seconds.

[0054] After purification of the PCR product, the objective existence of the interface of circular RNA circABHD2 was verified by Sanger sequencing. The results showed that the formation pattern of circular RNA circ ABHD2 is as shown in the figure. Figure 1 As shown in A, the sequencing verification of the circularization interface peak is as follows Figure 1 As shown in B.

[0055] The RNA sequence of circular RNA circABHD2 is shown in SEQ ID NO: 1 (sequence shown in Table 2, sequence number SEQ ID NO: 1), and the length of its mature circABHD2 sequence is 300 nt.

[0056] Table 2 Sequence list of circABHD2

[0057]

[0058] 2.2 FISH experiments confirmed the subcellular localization of circABHD2

[0059] Using Ribo TM Fluorescence in situ hybridization (FISH) assay was performed using a fluorescence in situ hybridization (FISH) kit (Ribo) to detect the subcellular localization of circABHD2 in EC cells.

[0060] The present invention designed and synthesized a specific probe for the splicing junction of circABHD2. Human U6 FISH probe and human 18S FISH probe were used as nuclear and cytoplasmic controls, respectively. A cell slide was placed on the bottom of a 24-well plate, and 2×10 4 Cells were seeded onto the plates. After 24 hours of culture, the cells were fixed with 4% paraformaldehyde for 10 minutes at 4°C and washed three times with phosphate-buffered saline (PBS). The cells were then incubated with prehybridization buffer at 37°C for 30 minutes and then with hybridization buffer and FISH probe overnight at 37°C in the dark. The next day, the coverslips were washed with wash buffer and PBS, stained with DAPI for 10 minutes, and washed with PBS. Cell images were then captured under a fluorescence microscope.

[0061] The experimental results showed that circABHD2 was mainly present in the cytoplasm of endometrial cancer cells, such as Figure 1 As shown in C.

[0062] 2.3 Verification of circABHD2 expression in endometrial cancer patients after expanding clinical samples

[0063] (1) Expand clinical sample collection: 32 tumor tissues from patients with endometrial cancer and 19 normal endometrial tissues from patients with benign lesions.

[0064] The results showed that the expression level of circABHD2 in tumor tissues was significantly decreased ( Figure 2 A), the expression level of circABHD2 was correlated with the clinical FIGO stage of patients (Table 3, Figure 2 B). Comparison of the diagnostic value of circABHD2 in endometrial cancer showed that the AUC of circABHD2 was 0.865 (P<0.01), suggesting that circABHD2 has a good diagnostic value in endometrial cancer ( Figure 2 C). In summary, the circular RNA circABHD2 of the present invention has a closed circular structure, is not easily attacked by RNase R, exists stably in vivo, and is an ideal molecular diagnostic marker.

[0065] Table 3 Correlation between circABHD2 expression level and clinicopathological parameters

[0066]

[0067] Note: FIGO, International Federation of Gynecology and Obstetrics. *P<0.05

[0068] 2.4 Cell-level validation

[0069] The expression level of circular RNA circ ABHD2 in endometrial cancer (HEC-1-A, ishikawa and RL95-2) was significantly lower than that in normal endometrial stromal cells (hESC). Figure 2 As shown in D.

[0070] Example 2 Identification of the biological functions of CircABHD2 in vivo and in vitro:

[0071] (1) Cell transfection experiment

[0072] A plasmid overexpressing circABHD2 (OE-circABHD2) was constructed, and an empty vector (pcDNA3.1) was used as a negative control (OE-NC). OE-circABHD2 and OE-NC were transfected into endometrial cancer cells by electroporation. The specific steps are as follows:

[0073] 1×10 6 Each cell was mixed with 10 μg of vector in 100 μL of serum-free medium and placed in an electroporation cuvette for transfection using a Nepa21 electroporator. The following parameters were used: ① Perforation pulse: voltage 125 V, pulse length 5 ms, pulse interval 50 ms, pulse number 2, decay rate 10%, polarity +; ② Transfer pulse: voltage 20 V, pulse length 50 ms, pulse interval 50 ms, pulse number 5, decay rate 40%, polarity + / -. Following transfection, cells were immediately plated onto 6-well plates and incubated in an incubator.

[0074] The results showed that transfection of the circABHD2 overexpressing plasmid (OE-circABHD2) significantly increased the expression of circABHD2 in HEC-1-A and ishikawa cells. Figure 3 As shown in A.

[0075] (2) Cell proliferation ability detection

[0076] ①CCK-8 experiment

[0077] The proliferation capacity of HEC-1-A and Ishikawa cells overexpressing circABHD2 was detected by CCK-8 assay. When the cells were in the logarithmic growth phase, they were trypsinized and counted, and then 200 μL of cell suspension was inoculated into 96-well plates (1×10 4 At different time points (0 h, 24 h, 48 h, and 72 h), 10 μL of CCK-8 assay solution (Keygen) was added to each well and incubated at 37°C for 1 h. The absorbance at 450 nm was then measured using a SpectraMax i3x microplate reader.

[0078] The results are as follows Figure 3 B shows that circABHD2 can significantly inhibit the proliferation activity of endometrial cancer cells.

[0079] ② Clone formation experiment

[0080] The cell proliferation ability was detected by colony formation assay. HEC-1-A and Ishikawa cells were collected, counted, and then re-plated into 6-well plates (3×10 3 Cells were cultured for 2 weeks, fixed with 4% paraformaldehyde, stained with 0.4% crystal violet, and counted under a microscope.

[0081] The results showed that circABHD2 could significantly inhibit the colony formation ability of endometrial cancer cells. Figure 3 As shown in C.

[0082] (3) Cell migration and invasion assay

[0083] ① Scratch test

[0084] HEC-1-A and Ishikawa cells overexpressing circABHD2 were obtained and digested with trypsin, and the cells were counted as 1×10 6 Cells were seeded into 6-well plates containing 2 mL of DMEM medium supplemented with 10% serum. After reaching 90% confluency, cells were scratched using a 10 μL pipette tip, and the medium was then replaced with serum-free medium. After 48 hours, cells were observed and photographed under an inverted microscope (100×). The area of the blank area and cell migration rate were calculated using Image J software.

[0085] The results showed that circABHD2 could significantly inhibit the migration of endometrial cancer cells HEC-1-A and ishikawa. Figure 3 As shown in D.

[0086] ②Transwell experiment

[0087] In the migration experiment, 600 μL of complete culture medium containing 20% fetal bovine serum was added to the lower chamber of the transwell (Costar, Corning, NY, USA). 8×10 4 200 μL of serum-free medium was added to each transwell plate (overexpressing circABHD). After incubation at 37°C for 24 hours, the upper chamber was removed and cells were fixed with 800 μL of 4% paraformaldehyde for 30 minutes. The cells were stained with 0.1% crystal violet for 15 minutes at room temperature. After destaining, the cells were imaged and counted under a 200× microscope. For the invasion assay, Matrigel (BD) and serum-free medium were prepared at a 1:4 (v / v) ratio and evenly plated on the upper chamber of the transwell plate. The plates were dried in a 37°C incubator and then rehydrated. The remaining steps were the same as for the cell migration assay. The number of migrating / invading cells in the field of view was counted using Image J software.

[0088] The results showed that circABHD2 could significantly inhibit the invasion ability of HEC-1-A and ishikawa cells. Figure 3 As shown in E.

[0089] The experimental results of the above examples demonstrate that the present invention provides a novel endogenous circular RNA, circABHD2, and designs primers that can specifically amplify circABHD2, and can determine the exact circularization site of circABHD2 by sequencing. RT-qPCR validation revealed that circABHD2 expression in endometrial cancer tissues and cells was significantly lower than that in normal controls and was closely correlated with the FIGO stage of endometrial cancer patients. A series of functional tests confirmed that overexpression of circABHD2 significantly inhibited the proliferation, migration, and invasion of endometrial cancer cells, playing an important regulatory role in the malignant progression of endometrial cancer. Therefore, circABHD2 has the potential to serve as a diagnostic molecular marker for endometrial cancer, and its detection kit can be used for the diagnosis of endometrial cancer. Pharmaceutical compositions comprising at least one of circABHD2, an agent that increases circABHD2 expression, and an agent that increases the activity of circABHD2 expression products can be used to prepare drugs for the treatment of endometrial cancer.

[0090] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Use of a circular RNA biomarker detection reagent in the preparation of a kit for diagnosing endometrial cancer, characterized in that: The nucleotide sequence of the circular RNA biomarker is shown in SEQ ID NO:

1.

2. Use of a circular RNA biomarker overexpression plasmid in the preparation of an anti-endometrial cancer drug, characterized in that: The nucleotide sequence of the circular RNA biomarker is shown in SEQ ID NO: 1; The drug is a drug that promotes the overexpression of the circular RNA biomarker.

3. Use of a circular RNA biomarker overexpression plasmid in the preparation of a molecular targeted drug for endometrial cancer, characterized in that: The nucleotide sequence of the circular RNA biomarker is shown in SEQ ID NO: 1.

Images