Application of hsa_circ_0005756 in the preparation of a kit for diagnosing gastric cancer

By using hsa_circ_0005756 as a marker in the gastric cancer diagnosis kit, qPCR is used to detect the expression in plasma exosomes, the problem of early diagnosis of gastric cancer is solved, and early detection and accurate diagnosis are achieved.

CN115976206BActive Publication Date: 2025-08-05JIANGSU UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211263830.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-17
Publication Date
2025-08-05
Estimated Expiration
2042-10-17

AI Technical Summary

Technical Problem

There is a lack of effective circRNA markers in the prior art for early diagnosis of gastric cancer, resulting in the delay in the clinical diagnosis of early gastric cancer.

Method used

Hsa_circ_0005756 was used as a diagnostic marker for gastric cancer. By detecting the expression of hsa_circ_0005756 in plasma exosomes, qPCR amplification primer pair was used for detection, and differentially expressed circRNA molecules were screened for screening out gastric cancer by combining cluster maps and volcanic maps to develop a kit for diagnosing gastric cancer.

Benefits of technology

It realizes the early diagnosis of gastric cancer, improves the accuracy and convenience of diagnosis, and can detect gastric cancer patients in early stages, and meets the results of clinical pathological biopsy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115976206B_ABST
    Figure CN115976206B_ABST
Patent Text Reader

Abstract

The present invention provides the use of hsa_circ_0005756 in preparing a kit for diagnosing gastric cancer, belonging to the field of molecular diagnostic technology. Based on the results of plasma exosome circRNA chip sequencing, the present invention screened hsa_circ_0005756 as a candidate circRNA molecule using P value and multiple difference as indicators, and verified the feasibility of hsa_circ_0005756 as a gastric cancer diagnostic marker using a large number of samples from healthy people and gastric cancer patients. Therefore, the use of a reagent for detecting the expression level of hsa_circ_0005756 in preparing a kit for diagnosing gastric cancer, and the screening method for hsa_circ_0005756 is also applicable to plasma exosome circRNA markers for other diseases, has broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular diagnosis, and specifically relates to the use of hsa_circ_0005756 in preparing a kit for diagnosing gastric cancer. Background Art

[0002] Gastric cancer is the fifth most common malignant tumor worldwide and the second leading cause of cancer death in my country. Diagnosis relies on pathological biopsy, and early-stage patients often have no specific symptoms. By the time a diagnosis is made, most patients are already in the advanced stages, with a poor prognosis. Therefore, there is an urgent need for a convenient and accurate diagnostic method to aid in the early diagnosis of gastric cancer.

[0003] Exosomes are cell-derived vesicles with diameters ranging from 40 to 160 nm. They contain a rich supply of proteins, nucleic acids, lipids, and other substances, and serve as a crucial medium for intercellular communication. Due to their widespread distribution in various bodily fluids, exosome-based detection has become a new target for liquid biopsy in recent years.

[0004] circRNA is a novel type of non-coding RNA with a covalent ring structure. Due to its circular structure, it has greater stability, a longer half-life, and the advantage of tissue-specific distribution. It is widely involved in tumor progression and is closely related to tumor proliferation, apoptosis, migration, drug resistance, and prognosis. It has great application value as a diagnostic biomarker for tumors. Currently, due to technical limitations, the detection of plasma exosomal circRNA is still immature. However, exosomal circRNA has the advantages of greater stability and higher abundance, making it well-suited for early diagnosis of tumors.

[0005] However, there are currently no reports on circRNAs for the early diagnosis of gastric cancer, which seriously delays the early diagnosis and treatment of gastric cancer in clinical practice. Summary of the Invention

[0006] In view of this, the object of the present invention is to provide a use of hsa_circ_0005756 in the preparation of a kit for diagnosing gastric cancer, wherein the hsa_circ_0005756 is differentially expressed in gastric cancer and healthy people, and hsa_circ_0005756 is used as a diagnostic marker for gastric cancer to achieve the purpose of early diagnosis of gastric cancer.

[0007] The present invention provides the use of hsa_circ_0005756 as a gastric cancer diagnostic marker in the preparation of a kit for diagnosing gastric cancer.

[0008] The present invention provides use of a reagent for detecting the expression level of hsa_circ_0005756 in preparing a kit for diagnosing gastric cancer.

[0009] Preferably, the nucleotide sequence of hsa_circ_0005756 is shown in SEQ ID NO: 1.

[0010] Preferably, the source of hsa_circ_0005756 is exosomes.

[0011] Preferably, the reagent for detecting the expression level of hsa_circ_0005756 is a primer pair for qPCR amplification of hsa_circ_0005756;

[0012] The primer pair used for qPCR amplification of hsa_circ_0005756 is a forward primer with a nucleotide sequence such as SEQ ID NO: 2 and a reverse primer with a nucleotide sequence such as SEQ ID NO: 3.

[0013] Preferably, the kit further comprises qPCR amplification reagents and / or reverse transcription reagents.

[0014] Preferably, the method for diagnosing gastric cancer comprises the following steps:

[0015] Extracting exosomal circRNA molecules from the sample to be tested;

[0016] The extracted exosome RNA molecules were reverse transcribed to obtain cDNA;

[0017] The cDNA is used as a template, and the primer pair for qPCR amplification of hsa_circ_0005756 is used to perform qPCR amplification to obtain an amplification result;

[0018] The risk of gastric cancer is determined based on the amplification results of the sample to be tested.

[0019] Preferably, the reaction system for qPCR amplification is 20 μl, specifically comprising the following components: 10 μl of 2×AceQ qPCRSYBR GreenMasterMix, 0.4 μl of 10 μM forward primer, 0.4 μl of 10 μM reverse primer, 2 μl of cDNA, and 7.2 μl of RNase-free ddH2O;

[0020] The reaction program of the qPCR amplification was 95°C for 5 min; 95°C for 10 s, 54°C for 30 s, 75°C for 1 s, 40 cycles; 60°C for 15 s, and 95°C for 15 s.

[0021] Preferably, the judgment method is that if the relative expression level of hsa_circ_0005756 in plasma exosomes is ≥-1.54395, the sample has a risk of coming from a gastric cancer patient, and a comprehensive judgment is made in combination with the results of clinical pathological biopsy.

[0022] The present invention provides a method for screening the gastric cancer diagnostic marker hsa_circ_0005756, comprising the following steps:

[0023] Exosomes were extracted from samples of confirmed gastric cancer patients and healthy subjects respectively;

[0024] Exosomes from different populations were tested on circRNA chips to obtain cluster diagrams and volcano diagrams of different populations;

[0025] The cluster diagrams and volcano diagrams of the different populations were analyzed to screen candidate circRNA molecules that showed significant differences and a fold difference FC ≥ 2 among different populations;

[0026] Using the candidate circRNA molecule as the target and samples from healthy people and gastric cancer patients as the detection objects, the expression level differences of different candidate circRNA molecules in healthy people or gastritis patients and gastric cancer patients were detected respectively, and circRNA molecules with significant differences in expression levels were screened to obtain hsa_circ_0005756.

[0027] Preferably, the reagent for detecting the expression level of hsa_circ_0005756 is a primer pair for qPCR amplification;

[0028] The primer pair for qPCR amplification is a forward primer with a nucleotide sequence such as SEQ ID NO: 2 and a reverse primer with a nucleotide sequence such as SEQ ID NO: 3.

[0029] The present invention provides the use of hsa_circ_0005756 as a diagnostic marker for gastric cancer in the preparation of a kit for diagnosing gastric cancer. The present invention uses samples of gastric cancer confirmed by physicians based on gastroscopy and pathological sections, as well as samples from healthy individuals, as research subjects. Using plasma exosome circRNA microarray detection results, the authors screened for exosome circRNAs, namely hsa_circ_0005756, that were differentially expressed in gastric cancer patients and healthy individuals, using P-value and fold difference as indicators. The differential expression of hsa_circ_0005756 in exosomes of samples from gastric cancer patients and healthy individuals was then verified by measuring the expression of hsa_circ_0005756 in these two populations, confirming that hsa_circ_0005756 is an ideal diagnostic marker for gastric cancer. The present invention also detects the expression level of exosome hsa_circ_0005756 in unknown samples, and predicts whether the unknown samples have the risk of gastric cancer based on the judgment criteria. The prediction results are consistent with the results of gastroscopy and case biopsy, indicating the application of hsa_circ_0005756 as a diagnostic marker for gastric cancer in the preparation of a kit for diagnosing gastric cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Cluster analysis diagram (A) and volcano plot (B) of the plasma exosome circRNA chip results used in the present invention;

[0031] Figure 2 The amplification curve and melting curve diagram of hsa_circ_0005756 and the internal reference gene β-actin detected by real-time fluorescence quantitative PCR provided by the present invention.

[0032] Figure 3 Schematic diagram of TA cloning and sequencing identification of the qPCR product of hsa_circ_0005756 provided by the present invention.

[0033] Figure 4 Schematic diagram of agarose electrophoresis of the products of cDNA and gDNA amplified in two cell lines using the specific primers for hsa_circ_0005756 provided by the present invention.

[0034] Figure 5 Schematic diagram of the relative expression changes of hsa_circ_0005756 and linear RNA β-actin before and after RNase R treatment provided by the present invention.

[0035] Figure 6 Schematic diagram of the real-time fluorescence quantitative PCR comparison of the expression differences of hsa_circ_0005756 in plasma exosomes of 49 healthy subjects and 56 gastric cancer patients provided by the present invention.

[0036] Figure 7 Schematic diagram of the ROC curve analysis of the specificity and sensitivity of plasma exosomes hsa_circ_0005756 for gastric cancer diagnosis provided by the present invention.

[0037] Figure 8 Schematic diagram of the expression differences of hsa_circ_0005756 in plasma exosomes of 24 gastric cancer patients before and after surgery provided by the present invention. DETAILED DESCRIPTION

[0038] The present invention provides use of hsa_circ_0005756 as a gastric cancer diagnostic marker in preparing a kit for diagnosing gastric cancer.

[0039] In the present invention, the nucleotide sequence of hsa_circ_0005756 is preferably as shown in SEQ ID NO: 1 (GCAAGTTAGGAAATCAACATTGAATCCCAATGCAAAGGAGTTCAACCCACGTTCCTTCTCTCAGCCAAAGCCTTCTACTACCCCAACTTCACCTCGGCCTCAAGCACAACCTAGCCCATCTATGGTGGGTCATCAACAGCCAACTCCAGTTTATACTCAGCCTGTTTGTTTTGCACCAAATATGATGTATCCAGTCCCAGTGAGCCCAGGCGTGCAACCTTTATACCCAATACCTATGACGCCCATGCCAGTGAATCAAGCCAAGACATATAGAGCAGGTAAAG). The source of hsa_circ_0005756 is preferably exosomes. The tissue source of the exosomes is preferably plasma exosomes.

[0040] The present invention provides use of a reagent for detecting the expression level of hsa_circ_0005756 in preparing a kit for diagnosing gastric cancer.

[0041] In the present invention, the nucleotide sequence of hsa_circ_0005756 is preferably as shown in SEQ ID NO: 1 (GCAAGTTAGGAAATCAACATTGAATCCCAATGCAAAGGAGTTCAACCCACGTTCCTTCTCTCAGCCAAAGCCTTCTACTACCCCAACTTCACCTCGGCCTCAAGCACAACCTAGCCCATCTATGGTGGGTCATCAACAGCCAACTCCAGTTTATACTCAGCCTGTTTGTTTTGCACCAAATATGATGTATCCAGTCCCAGTGAGCCCAGGCGTGCAACCTTTATACCCAATACCTATGACGCCCATGCCAGTGAATCAAGCCAAGACATATAGAGCAGGTAAAG). The source of hsa_circ_0005756 is preferably exosomes. The tissue source of the exosomes is preferably plasma exosomes.

[0042] In the present invention, the reagent for detecting the expression level of hsa_circ_0005756 is a primer pair for qPCR amplification of hsa_circ_0005756. The primer pair for qPCR amplification of hsa_circ_0005756 is a forward primer with a nucleotide sequence such as SEQ ID NO: 2 and a reverse primer with a nucleotide sequence such as SEQ ID NO: 3. The kit preferably also includes an internal reference gene amplification primer, a qPCR amplification reagent and / or a reverse transcription reagent. The internal reference gene amplification primer is preferably a primer for amplifying β-actin. The primer for amplifying β-actin preferably includes a forward primer with a nucleotide sequence such as SEQ ID NO: 4 and a reverse primer with a nucleotide sequence such as SEQ ID NO: 5. The qPCR amplification reagent is preferably AceQ qPCR SYBRGreen MasterMix. The reverse transcription reagent is preferably HiScript1st Strand cDNA Synthesis Kit. The kit preferably further includes reagents required for extracting plasma exosomes and / or reagents required for extracting exosome circRNA. The reagents required for extracting plasma exosomes are preferably ExoQuick TM The reagents required for extracting total exosome circRNA preferably include at least one of chloroform, anhydrous ethanol, and miRNeasy SerμM / Plasma Kit.

[0043] In the present invention, the method for diagnosing gastric cancer preferably comprises the following steps:

[0044] Extracting exosomal circRNA molecules from the sample to be tested;

[0045] The extracted exosome RNA molecules were reverse transcribed to obtain cDNA;

[0046] The cDNA is used as a template, and the primer pair for qPCR amplification of hsa_circ_0005756 is used to perform qPCR amplification to obtain an amplification result;

[0047] The risk of gastric cancer is determined based on the amplification results of the sample to be tested.

[0048] In the present invention, the method for extracting exosome circRNA molecules from the test sample preferably comprises extracting exosomes from the test sample and extracting circRNA molecules from the exosomes. The test sample is preferably plasma. The method for extracting exosomes from the test sample is preferably using ExoQuick TMAfter the sample is treated with the Exosome Precipitation Solution, solid-liquid separation is performed, and the solid phase is collected to obtain exosomes. The method for extracting circRNA molecules from the exosomes preferably involves first extracting total RNA molecules and then isolating circRNA molecules from the total RNA molecules.

[0049] The present invention has no special limitation on the reverse transcription reaction method, and the reverse transcription method known in the art can be used. In the embodiment of the present invention, the reverse transcription conditions are preferably 10×RT Mix 2μl, Random hexamers (50ng / μl) 1μl, HiScriptIII Enzyme Mix 2μl, RNA

[0050] ≤1μg, supplemented with 20μl of RNase-free ddH2O. The reaction conditions for reverse transcription are preferably 37°C for 15min; 85°C for 5min.

[0051] In the present invention, the reaction system of the qPCR amplification is preferably 20 μl, specifically including the following components: 2×AceQqPCR SYBR Green MasterMix 10 μl, 10 μM forward primer 0.4 μl, 10 μM reverse primer 0.4 μl, cDNA 2 μl, RNase free ddH2O 7.2 μl; the reaction procedure of the qPCR amplification is 95°C 5 min; 95°C 10 s, 54°C 30 s, 75°C 1 s, 40 cycles; 60°C 15 s, 95°C 15 s. The present invention has no special restrictions on the instrument used for the qPCR amplification, and a qPCR instrument well known in the art can be used. In the embodiment of the present invention, an Applied Biosystems Inc., Inc. well known in the art is used. 3. Real-time fluorescence quantitative PCR was performed in an instrument.

[0052] In the present invention, after qPCR amplification, the Ct value of the sample was analyzed, the relative expression level was calculated according to Formula 1, and the analysis and graphing were performed using Graphpad Prism.

[0053] △Ct=CT hsa_circ_0005756 -CT β-actin Formula I;

[0054] Where -△Ct is the vertical coordinate.

[0055] In the present embodiment, the present invention only combines the relative expression level of hsa_circ_0005756 in the plasma exosomes of 49 normal subjects and 56 gastric cancer patients in this embodiment. Figure 6As shown in the figure, the mean values of the two groups of data are -2.69582 and -1.54395, respectively. Therefore, it can be considered that in the samples shown in this example, when the relative expression level of hsa_circ_0005756 in plasma exosomes is ≥-1.54395, the sample may be from a gastric cancer patient. However, other possibilities are not excluded and the specific judgment still needs to be made in combination with the results of clinical pathological biopsy.

[0056] The present invention provides a method for screening the gastric cancer diagnostic marker hsa_circ_0005756, comprising the following steps:

[0057] Exosomes were extracted from samples of confirmed gastric cancer patients, gastritis patients, and healthy subjects;

[0058] Exosomes from different populations were tested on circRNA chips to obtain cluster diagrams and volcano diagrams of different populations;

[0059] The cluster diagrams and volcano diagrams of the different populations were analyzed to screen candidate circRNA molecules that showed significant differences and a fold difference FC ≥ 2 among different populations;

[0060] Using the candidate circRNA molecule as the target and samples from healthy people and gastric cancer patients as the detection objects, the expression level differences of different candidate circRNA molecules in healthy people or gastritis patients and gastric cancer patients were detected respectively, and circRNA molecules with significant differences in expression levels were screened to obtain hsa_circ_0005756.

[0061] In the present invention, the basis for the diagnosis is the physician's judgment based on the results of gastroscopy and case biopsy. The source of the circRNA chip is preferably the BioAo Jingdian Human Circular RNA Chip v2 chip.

[0062] In the present invention, the reagent for detecting the expression level of hsa_circ_0005756 is preferably a primer pair for qPCR amplification;

[0063] The primer pair for qPCR amplification is a forward primer with a nucleotide sequence such as SEQ ID NO: 2 and a reverse primer with a nucleotide sequence such as SEQ ID NO: 3.

[0064] The following examples describe in detail the use of hsa_circ_0005756 provided by the present invention in preparing a kit for diagnosing gastric cancer and differentiating between gastric cancer and gastritis. However, these examples should not be construed as limiting the scope of protection of the present invention.

[0065] Example 1

[0066] Screening method for plasma exosome hsa_circ_0005756

[0067] 1. Chip Sequencing

[0068] 1.1 After obtaining informed consent from the patients, plasma was collected from three patients undergoing gastric cancer surgery, followed by plasma from three age- and sex-matched healthy subjects undergoing physical examinations. Gastric cancer patients were confirmed as having gastric cancer by a physician through gastroscopy and pathological examination, and had no other major organ dysfunction. Exclusion criteria included patients with gastric cancer who had concurrent other medical conditions, such as other tumors, liver or kidney dysfunction, or were participating in other clinical trials.

[0069] 1.2 Preliminary processing of plasma samples:

[0070] (1) Collect 6-10 ml of cubital venous blood using an EDTA anticoagulant tube and gently invert it 5 times immediately after collection to mix thoroughly.

[0071] (2) After standing for at least 30 min, centrifuge the blood collection tube at 4°C, 3000 rpm, for 10 min to obtain plasma;

[0072] (3) The upper plasma layer was transferred to a 1.5 ml EP tube and centrifuged at 4°C, 3000 g, for 15 min to remove cell debris;

[0073] (4) The centrifuged plasma was aliquoted, registered, and stored at -80°C.

[0074] 1.3. Plasma exosome circRNA chip sequencing

[0075] (1) Biogene human circular RNA chip v2 was used for sequencing, and differentially expressed molecules were screened with P < 0.05 and expression difference fold FC ≥ 2.

[0076] See the results Figure 1 The results showed that the expression level of hsa_circ_0005756 in the three gastric cancer patients in the chip results was higher than that in the three healthy subjects.

[0077] 2. Verification of hsa_circ_0005756 expression levels in plasma exosomes

[0078] 2.1 Extraction of exosomes from plasma samples:

[0079] (1) Thaw the sample stored at -80°C on ice, pipette 250 μl into a new EP tube, add 63 μl ExoQuick™ Exosome Precipitation Solution, mix gently by pipetting, and let stand at 4°C for 30 min to precipitate exosomes;

[0080] (2) Centrifuge at 4°C, 1500g for 30 min, remove the supernatant, and centrifuge again at 4°C, 1500g for 5 min. Carefully remove the supernatant without touching the precipitate.

[0081] (3) Add 200 μl of finished PBS and mix thoroughly to dissolve the exosome precipitate. Let it stand at 4°C for at least 10 min to dissolve the precipitate.

[0082] 2.2 Extraction of total exosome RNA:

[0083] (1) Add 1 ml of QIAZOL Lysis Reagent to the exosome pellet, vortex and pipette to mix, and let stand at room temperature for 5 min;

[0084] (2) Add 200 μl (equal volume to the exosome sample) of chloroform, shake vigorously for 30 seconds, and then let it stand at room temperature for 2-3 minutes;

[0085] (3) Centrifuge at 4°C, 12,000 g, for 15 min, and transfer the upper aqueous phase to a new EP tube;

[0086] (4) Add 1.5 times the volume of pre-cooled anhydrous ethanol to the upper aqueous phase and mix thoroughly by pipetting;

[0087] (5) The mixture from step (4) was pipetted into the adsorption column (which has been placed in the collection tube) at a rate of 700 μl / time, centrifuged at room temperature, 12,000 g, for 15 s, and the lower filtrate was discarded. Repeat this process several times.

[0088] (6) Add 700 μl of RWT buffer to the adsorption column, centrifuge at room temperature, 12,000 g, for 15 s, and discard the lower filtrate;

[0089] (7) Add 500 μl of RPE buffer to the adsorption column, centrifuge at room temperature, 12,000 g for 15 s, and discard the lower filtrate;

[0090] (8) Add 500 μl of 80% ethanol to the adsorption column, centrifuge at room temperature, 12,000 g, 2 min, and discard the lower filtrate and outer collection tube;

[0091] (9) Place the adsorption column in a new 2 ml collection tube and centrifuge at room temperature, 12,000 g, for 5 min;

[0092] (10) Place the adsorption column in a new EP tube, add 14 μl of RNase-free water to the middle membrane of the adsorption column, and let it stand for 5 min;

[0093] (11) Centrifugation at room temperature, 12000g, 1 min, and washing the membrane to obtain the RNA solution;

[0094] (12) Aspirate all the RNA solution and drip it into the middle membrane of the adsorption column again. Let it stand at room temperature for 5 minutes and then centrifuge it again at room temperature, 12000g, 1 minute, and wash the membrane to obtain the RNA solution.

[0095] (13) To prevent degradation, the RNA solution was immediately reverse transcribed.

[0096] 2.3 Reverse transcribe RNA into cDNA, see Table 1 for details.

[0097] Table 1 Reverse transcription system

[0098]

[0099] The reaction product can be placed at 4°C for immediate use in PCR reactions (see Table 2 for reaction conditions), or stored at -20°C for use within six months, or stored at -80°C to avoid repeated freezing and thawing.

[0100] Table 2 Reverse transcription reaction

[0101]

[0102] ,2.4 The real-time fluorescence quantitative PCR reaction system is shown in Table 3, and the reaction procedure is shown in Table 4.

[0103] Table 3 qPCR reaction system

[0104]

[0105] Applied 3. Perform the reaction in a real-time fluorescence quantitative PCR instrument.

[0106] Table 4 qPCR reaction procedure

[0107]

[0108] 2.5. qPCR Results Analysis

[0109] (1) qPCR results show the amplification curve and melting curve of hsa_circ_0005756 and β-actin, such as Figure 2 As shown;

[0110] (2) The qPCR product of hsa_circ_0005756 was recovered, and the TA cloning plasmid was constructed and sequenced. Figure 3 shown.

[0111] 2.6. Circularity verification of hsa_circ_0005756:

[0112] (1) gDNA (genomic DNA) amplification experiment:

[0113] Specific primers were used to amplify both cDNA and gDNA samples, and the products were subjected to agarose gel electrophoresis. The results showed that hsa_circ_0005756 could be amplified in the cDNA samples of the two cell lines, but not in the gDNA samples, indicating that it was formed by post-transcriptional regulation.

[0114] RNase R tolerance test:

[0115] RNase R is an exoribonuclease that can digest almost all linear RNAs but not circRNAs. In this study, freshly extracted total RNA samples were treated with RNase R for 20 min, and the expression of hsa_circ_0005756 and linear RNA β-actin was detected by qPCR. Figure 5 As shown in the figure, the expression level of linear RNA β-actin was significantly decreased, while the expression level of hsa_circ_0005756 remained almost unchanged, indicating that hsa_circ_0005756 was more stable than linear RNA β-actin.

[0116] Example 2

[0117] Validation experiment of plasma exosome hsa_circ_0005756 as a diagnostic marker for gastric cancer

[0118] (1) The present invention included 56 gastric cancer patients who visited the Department of Gastrointestinal Surgery of the First Affiliated People's Hospital of Jiangsu University from July 2021 to June 2022, and 49 healthy subjects matched by age and gender, and tested the plasma exosome hsa_circ_0005756 in the above-mentioned populations. The two groups of samples were collected at the same time, and the sampling, packaging, and storage conditions were the same.

[0119] Table 5 Clinical sample test results

[0120]

[0121]

[0122]

[0123]

[0124]

[0125] Note: N represents normal people, and T represents gastric cancer patients.

[0126] (2) Data analysis: The experimental data were analyzed using a relative quantitative analysis method, with β-actin as the internal reference gene. The relative expression level (ΔCt) was calculated using formula I. The mean and standard deviation were analyzed and plotted using Graphpad Prism to compare the relative expression levels of hsa_circ_0005756 in gastric cancer, chronic atrophic gastritis, and their corresponding healthy subjects.

[0127] △Ct=CThsa_circ_0005756-CTβ-actin Formula I

[0128] -△Ct is the vertical coordinate.

[0129] (3) Result statistics:

[0130] This example is based on the relative expression of hsa_circ_0005756 in plasma exosomes from 49 healthy subjects and 56 gastric cancer patients. Figure 6 As shown in the figure, the mean values of the two groups of data are -2.69582 and -1.54395, respectively. Therefore, it can be considered that in the samples shown in this example, when the relative expression level of hsa_circ_0005756 in plasma exosomes is ≥ -1.54395, the sample may be from a gastric cancer patient. However, other possibilities cannot be ruled out and the specific judgment should be made in combination with the results of clinical pathological biopsy. Therefore, hsa_circ_0005756 can be used as a diagnostic marker for gastric cancer for early diagnosis.

[0131] To verify whether the expression level of plasma exosome hsa_circ_0005756 in gastric cancer can monitor prognosis, the present invention collected and tested plasma samples from 24 gastric cancer patients before and after surgery. Figure 8 As shown in the results, it was found that the expression level of hsa_circ_0005756 was significantly downregulated after surgery.

[0132] Based on the above results, a differentially expressed molecule hsa_circ_0005756 was screened in this sequencing through primer circularization verification and clinical plasma exosome sample verification.

[0133] Example 3

[0134] Method for detecting clinical unknown samples using hsa_circ_0005756 as a diagnostic marker for gastric cancer

[0135] Plasma exosomes were extracted from an unknown clinical sample, and the relative expression of hsa_circ_0005756 was detected. The detection result of the unknown sample was -0.6157, which was greater than the average relative expression of hsa_circ_0005756 in the plasma exosomes of the gastric cancer group patients in Example 2, which was -1.54395. Combined with the pathological biopsy results, it was found that the patient had moderately differentiated adenocarcinoma (flat type) in the gastric body, with a tumor size of 3×2.2×0.5 cm 3 , which meets the expected judgment criteria.

[0136] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting the expression level of hsa_circ_0005756 in preparing a kit for diagnosing gastric cancer; the nucleotide sequence of hsa_circ_0005756 is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that The source of hsa_circ_0005756 is exosomes.

3. The application according to claim 1, characterized in that The reagent for detecting the expression level of hsa_circ_0005756 is a primer pair for qPCR amplification of hsa_circ_0005756; The primer pair used for qPCR amplification of hsa_circ_0005756 is a forward primer with a nucleotide sequence such as SEQ ID NO: 2 and a reverse primer with a nucleotide sequence such as SEQ ID NO:

3.

4. The application according to claim 3, characterized in that The method for diagnosing gastric cancer comprises the following steps: Extracting exosomal circRNA molecules from the sample to be tested; The extracted exosome RNA molecules were reverse transcribed to obtain cDNA; The cDNA is used as a template, and the primer pair for qPCR amplification of hsa_circ_0005756 is used to perform qPCR amplification to obtain an amplification result; The risk of gastric cancer is determined based on the amplification results of the sample to be tested.

5. The application according to claim 4, characterized in that: The judgment method is that if the relative expression level of hsa_circ_0005756 in plasma exosomes is ≥-1.54395, the sample has a risk of coming from a gastric cancer patient, and a comprehensive judgment is made in combination with the results of clinical pathological biopsy.

Citation Information

Patent Citations

  • Serum exosome marker for gastric cancer diagnosis and application thereof, amplification primer pair and diagnostic kit

    CN113999909A