An anti-human platelet collagen receptor GP-VI antibody or an antigen-binding fragment thereof and its application
By developing anti-human platelet collagen receptor GP-VI antibodies or their antigen-binding fragments, using recombinantly expressed single-chain variable region fragments (scFvs) or fusion proteins with human serum albumin, the problem that existing antithrombotic drugs cannot distinguish between normal hemostasis and pathological thrombosis is solved, effectively inhibiting platelet activation and thrombosis, and reducing the risk of reperfusion injury.
Patent Information
- Application Number
- CN202211710050.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-29
- Publication Date
- 2025-06-10
- Estimated Expiration
- 2042-12-29
AI Technical Summary
Existing antithrombotic drugs cannot effectively distinguish between normal physiological hemostasis and pathological thrombosis, which can easily lead to side effects of internal bleeding and have limited effect on blocking thrombosis.
An anti-human platelet collagen receptor GP-VI antibody or its antigen-binding fragment is developed to specifically inhibit the activation of collagen on the collagen-covered surface by designing recombinantly expressed single-chain variable region fragments (scFvs) or fusion proteins with human serum albumin.
Effectively block collagen receptor GP-VI, inhibit platelet activation, adhesion aggregation and thrombosis, reduce reperfusion injury, and reduce the risk of myocardial ischemia and brain injury.
Smart Images

Figure CN115991780B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical fields of biomedicine and molecular biology, and particularly relates to an anti-human platelet collagen receptor GP-VI antibody or an antigen-binding fragment thereof and its application. Background Art
[0002] The information disclosed in the background art of the present invention is only intended to increase the understanding of the overall background of the present invention, and is not necessarily regarded as an admission or an implication in any form that this information constitutes the prior art already known to those of ordinary skill in the art.
[0003] The adhesion, activation and aggregation of platelets at the damaged site of blood vessels will ultimately lead to thrombus formation and bleeding cessation, which can avoid excessive blood loss. This is one of the physiological protection mechanisms of normal people. However, in the case of vascular lesions, the thrombus formed by platelet activation will block blood vessels, causing ischemia or even necrosis of downstream tissues, and diseases such as myocardial infarction or stroke will occur. Therefore, antithrombotic therapy has a very wide application in medicine. For example, it is used for the prevention of thrombus formation caused by vascular endothelial damage, such as the use of drugs during coronary dilation, before and during cardiac valve replacement, or in combination with thrombolytic therapy drugs after stroke caused by myocardial infarction or cerebral embolism.
[0004] Generally, the activation and aggregation process of platelets is divided into two stages. The early stage is the stage of specific binding with some activation factors, and in the late stage, a series of chain reactions will occur within platelets, leading to the activation of the common pathway and the formation of irreversible thrombus ( Figure 1 ). At present, there are many drugs used clinically in medicine for anti-platelet activation factors, but there are also many problems with them. For example, although aspirin can inhibit the formation of thromboxane TXA 2 , the effect is too slow; Clopidogrel is used to inhibit the ADP receptor on platelets, and the effect is not satisfactory, because ADP is only one of the multiple endogenous platelet activators and is a relatively weak one; anti-TXA 2 receptor drugs will cause the side effect of hypotension; antithrombin peptide can not only prevent thrombus formation, but also anticoagulate, which makes it unable to be used in clinical medicine. There is a blocking drug REOPRO (an anti-platelet GPIIbIIIa monoclonal chimeric antibody) for the late common signal transduction pathway of platelet activation, and its effect of blocking thrombus formation is better, but it cannot distinguish normal physiological hemostasis and thrombus formation under pathological conditions, so it is very easy to cause unexpected internal bleeding in clinical use. Nevertheless, it has to be used in many clinical treatments, especially during coronary dilation, because there is no better drug to replace it in the prior art.
[0005] Collagen binds to its receptor on the platelet surface - the collagen receptor, which is the most potent substrate for activating platelets. One of the collagen receptors, "glycoprotein-6" (GP-VI or GP6), is only expressed on the platelet surface( Figure 2 ). When the vascular endothelium is damaged, the subendothelial collagen is exposed. Common causes of vascular endothelial damage and exfoliation leading to exposure of the vascular basement membrane include rupture of atherosclerotic plaques in the coronary arteries, carotid arteries, and cranial arteries, or microsurgical removal. The exposed collagen can activate platelets by binding to its receptor and lead to thrombosis and clotting, forming a situation that blocks blood flow, ultimately causing serious diseases such as myocardial ischemia (angina and myocardial infarction) and cerebral blood circulation disorders (stroke). In the case where drugs such as anti-TXA 2 receptor, anti-ADP receptor, and antithrombin receptor drugs do not meet the clinical use requirements, the research on anti-platelet collagen receptor antibodies has become a hot topic in the research of anti-platelet drugs today.
[0006] Collagen has the characteristics of large molecules and complex structures after aggregation (collagen fibers). Small molecule chemical drugs cannot block its binding to its receptor and the resulting activation of platelets and thrombosis. Monoclonal antibodies, due to their strong affinity and high specificity for the target, and their large molecular weight which can play an effective blocking role, and because they are less likely to cause the production of neutralizing antibodies and side effects after humanization, are therefore recognized as the best choice for blocking the collagen receptor "glycoprotein-6" and the first object to be developed. People first carried out molecular cloning of the platelet collagen receptor "glycoprotein-6", which can be used as an immune target and for the screening of monoclonal antibodies in the next step. After years of efforts, several laboratories have now obtained multiple monoclonal antibodies with blocking effects (Matsumoto et al. Thrombosis Res. 119:319-329, 2007. Masberg et al. JEM 197:41-49, 2002. Lecut et al. J Throm Haemosta 1:2653-2662, 2003. Moroi et al Throm Haemosta 89:996-1004, 2003. Chen et al JBC 277:3011-3019, 2002). These monoclonal antibodies not only differ in the amino acid sequence and affinity of the polypeptide, but also have different binding sites (recognition on the antigen) on the collagen receptor "glycoprotein-6". Two laboratories have also obtained mice with gene knockout of the collagen receptor "glycoprotein-6" (Kato et al. Blood 102:1701-1707, 2003. Lockyer et al. Thrombosis Res., 118:371-380, 2006). Whether using monoclonal antibodies or gene knockout mice, in vitro (including human and animal) and in vivo (including monkey) experiments have confirmed that the collagen receptor "glycoprotein-6" is a good target for anti-thrombotic drugs: it is effective but does not cause an extended bleeding time (different from REOPRO); and it has also been confirmed that monoclonal antibodies are effective blockers of the collagen receptor "glycoprotein-6". Therefore, monoclonal antibodies that can block the activation of platelets by collagen by blocking the collagen receptor "glycoprotein-6" are expected to become anti-thrombotic drugs with broad clinical application value.
[0007] In the prior art, the method for generating monoclonal antibodies is as follows: First, an antigen (such as a cell line expressing the human collagen receptor "glycoprotein-6" or purified recombinant human collagen receptor "glycoprotein-6") is injected into a mouse for immunization; then, B lymphocytes are extracted from its spleen and fused with myeloma cells to obtain hybridoma cells; after screening, a single clone that can secrete anti-collagen receptor "glycoprotein-6" is further screened from the surviving hybridoma single-cell beads. Finally, through functional analysis tests of platelet activation or using cells expressing recombinant human collagen receptor "glycoprotein-6", monoclonal antibodies with blocking effects and high affinity for the collagen receptor "glycoprotein-6" and the hybridoma cell line producing this antibody are identified. Since intact anti-collagen receptor "glycoprotein-6" antibodies or F(ab) 2 bivalent fragments can activate platelets (possibly because these bivalent antibodies or fragments bring two collagen receptors "glycoprotein-6" on the platelet surface together for "cross-linking" at close range to activate downstream signaling pathways, thereby activating platelets), so in clinical applications, only Fab or scFv (monovalent) can be developed into blocking drugs. In fact, before clinical application, this murine monoclonal antibody needs to be humanized to make its protein sequence as close as possible to the human-derived antibody, and to minimize the immune neutralization reaction in the patient's body caused by the injected exogenous protein drug. Therefore, the nucleotide sequence of the monoclonal antibody needs to be first cloned from the hybridoma cells, humanized, and then produced using recombinant protein expression technology and mammalian cells. Finally, it can be used for the treatment of patients after purification and virus inactivation. The technologies required for the entire process are very complex and the preparation cost is high.
[0008] In 1987, Professor Minoru Okuma in Japan isolated an antibody (polyclonal) with anti-platelet function from the serum of one of his patients with thrombocytopenic purpura (Sugiyama et al., Blood 69:1712-20 1987. Moroi et al., J.Clin.Invest.84:1440-45, 1989. Ryo et al., Am.J.Hematol.39:25-31, 1992. Arai et al., Brit.J.Haematol.89:124-130, 1995). Using this antibody, multiple laboratories not only detected and confirmed that the protein with a molecular weight of 62 kDa on the platelet membrane was the collagen receptor "glycoprotein-6", but also confirmed that the attachment of platelets to the collagen surface and collagen-induced activation could be blocked by this antibody (Nakamura et al. J.Biol.Chem.273:4338-4344, 1998). Since this polyclonal antibody was obtained from the serum of a patient and was limited in quantity and unable to be industrially produced, these research results clearly indicated that an antibody against the collagen receptor "glycoprotein-6" could become a drug to block collagen activation of platelets and could also be used to prevent the formation of thrombi.
[0009] Direct screening of anti-GP-VI antibodies: Nucleated white blood cells (B lymphocytes) with affinity for platelets were further combined with primers for the heavy and light chains of human immunoglobulin IgG using reverse transcription-polymerase chain amplification reaction (RT-PCR) to clone the sequences of the variable region fragments of the light and heavy chains of the anti-GP-VI monoclonal antibody. Finally, it was expressed, secreted, purified in the form of single-chain (scFv) in other mammalian cells or yeast, and then, after functional screening, an scFv that could block the binding of human GP-VI to collagen was found. Moreover, it only inhibited the activation of platelets in human platelet-rich plasma (platelets-rich plasma or PRP) and whole blood induced by collagen, but had no effect on activators such as adenosine diphosphate (ADP), U46619, epinephrine, arachidonic acid, and thrombin (for washed platelets). This scFv also inhibited the attachment of human platelets to the collagen surface.
[0010] Due to the small molecular weight of scFv, it easily passes through the intercellular space and enters tissues, and its residence time (half-life) in the blood circulation is very short. To overcome this drawback and increase the concentration in the blood, it is necessary to design a fusion protein with other polypeptides such as human serum albumin. Serum albumin is the main protein component in plasma. The fusion protein bound to serum albumin not only doubles the molecular weight but also increases the solubility in the aqueous phase to avoid aggregation (it is known that the aggregated anti-GP-VI antibody fragment Fab itself can cause platelet activation). Without affecting the affinity between the antibody and GP-VI, the space occupied by its serum albumin has the potential to increase the antibody's blocking of the binding of GP-VI on platelets to collagen fibers, thus playing a more effective role in anti-platelet activation and anti-thrombosis.
[0011] Acute cardiovascular and cerebrovascular diseases caused by atherosclerosis are generally accompanied by platelet activation and thrombosis, which in turn lead to blood vessel blockage. Due to blood vessel obstruction, long-term ischemia and hypoxia, the downstream vascular endothelium is damaged and shed, resulting in the exposure of the vascular basement membrane (collagen fibers). After thrombolytic therapy, the blocked blood vessel becomes unobstructed again, and a large amount of blood and platelets enter the downstream blood vessels. Due to the exposure of the basement membrane, more platelets are activated, causing further myocardial or brain damage (the so-called "reperfusion injury"). The blocked coronary artery can be reopened through angioplasty and / or thrombolytic therapy, resulting in reperfusion of the previously ischemic muscle. Although reperfusion is crucial for saving ischemic muscle, reperfusion itself may cause secondary platelet activation and thrombosis, causing additional damage to the muscle. Ideally, the treatment of a heart attack includes minimizing myocardial infarction during the attack. However, since it is usually difficult to predict the occurrence of a heart attack, it is unlikely to perform preventive treatment. Therefore, angioplasty and / or thrombolytic therapy, combined with treatment to reduce reperfusion injury (for example, administered in an ambulance or emergency room) may be more practical. Treatment to reduce reperfusion injury may improve the recovery from a heart attack / ischemia and limit the possibility of developing heart failure. Treatment to reduce myocardial infarction is expected to save lives. It can also shorten the hospital stay, improve the quality of life, and reduce the overall medical cost for high-risk patients. Unfortunately, there is currently no such treatment method. Various treatments have been tried, but they all seem to have failed (see the review by Downey and Cohen, Prog Cardiovasc Dis., 48:363-371, 2006). Currently, aspirin, clopidogrel, and Anti-thrombotic interventions such as these are used to prevent coronary artery occlusion / re-occlusion. However, they do not directly protect against reperfusion injury. In fact, aspirin may interfere with certain endogenous cardioprotective pathways and may increase infarction (Gross et al., Journal of Pharmacological Experiments, 310:185-191, 2004). Anti-GP-VI antibodies (Fab or scFv or fusion proteins of scFv with serum albumin) are expected to achieve a therapeutic effect of avoiding or reducing reperfusion injury by inhibiting platelet activation caused by collagen in the subendothelium of blood vessels exposed during reperfusion. Summary of the Invention
[0012] In view of the above prior art, the object of the present invention is to provide an anti-human platelet collagen receptor GP-VI antibody or its antigen-binding fragment and its application. The present invention designs from the gene sequence of the monoclonal antibody or various permutations and combinations with the human serum albumin sequence, and finally prepares an scFv or a macromolecular fusion protein with a blocking effect, and its application as a drug for the treatment and prevention of thrombotic cardio-cerebrovascular diseases.
[0013] In order to achieve the above technical object, the technical solution provided by the present invention is as follows:
[0014] In the first aspect of the present invention, there is provided an anti-human platelet collagen receptor GP-VI antibody or its antigen-binding fragment, wherein the antibody at least comprises (a) an antibody element targeting GP-VI, and the antibody element targeting GP-VI can be an anti-GP-VI single-chain antibody (scFv), which can effectively block GP-VI. The anti-GP-VI single-chain antibody at least comprises 3 heavy-chain variable region HV sequences and 3 light-chain variable region LV sequences, and their amino acid sequences are respectively the sequences shown in SEQ ID NOs: 18-23, or sequences having ≥80% sequence identity with the sequences shown in SEQ ID NOs: 18-23, or amino acid sequences having one or more conservative amino acid mutations compared with the sequences shown in SEQ ID NOs: 18-23.
[0015] The anti-human platelet collagen receptor GP-VI antibody may further comprise: (b) a human immunoglobulin Fc region and / or human serum albumin (HSA) or a fragment thereof, a domain binding serum albumin, polyethylene glycol, a polyethylene glycol-liposome complex, or a combination thereof.
[0016] It should be noted that the "antigen-binding fragment" of the antibody of the present invention is a part of the antibody, that is, a molecule corresponding to a part of the structure of the antibody of the present invention. These antigen-binding fragments can also be called functional fragments of the antibody, and such fragments exhibit the same or substantially the same antigen-binding specificity and affinity for the antigen.
[0017] In a second aspect of the present invention, there is provided a polynucleotide capable of encoding the above-mentioned anti-human platelet collagen receptor GP-VI antibody or an antigen-binding fragment thereof.
[0018] In a third aspect of the present invention, there is provided a recombinant expression vector comprising the above-mentioned isolated polynucleotide.
[0019] In a fourth aspect of the present invention, there is provided a host cell comprising the above-mentioned expression vector, or comprising the above-mentioned polynucleotide integrated into the genome of the host cell; alternatively, the host cell expresses the above-mentioned anti-human platelet collagen receptor GP-VI antibody or an antigen-binding fragment thereof.
[0020] In a fifth aspect of the present invention, there is provided a method for producing an anti-human platelet collagen receptor GP-VI antibody or an antigen-binding fragment thereof, comprising the steps of:
[0021] (I) culturing the above-mentioned host cell under conditions suitable for antibody production to obtain a culture containing the anti-human platelet collagen receptor GP-VI antibody or an antigen-binding fragment thereof; and
[0022] (II) isolating or recovering the anti-human platelet collagen receptor GP-VI antibody or an antigen-binding fragment thereof from the culture.
[0023] In a sixth aspect of the present invention, there is provided a recombinant polypeptide conjugate comprising the anti-human platelet collagen receptor GP-VI antibody or an antigen-binding fragment thereof of the present invention, and a conjugate moiety, wherein the conjugate moiety is a detectable label, a drug, a toxin, a cytokine, a viral capsid protein, a VLP, or the like.
[0024] In a seventh aspect of the present invention, there is provided a kit comprising the above-mentioned anti-human platelet collagen receptor GP-VI antibody or an antigen-binding fragment thereof, and / or the above-mentioned conjugate; the kit can be used to detect the presence or concentration of human platelet collagen receptor GP-VI in a sample.
[0025] In an eighth aspect of the present invention, there is provided a pharmaceutical composition comprising the above-mentioned anti-human platelet collagen receptor GP-VI antibody or an antigen-binding fragment thereof, or the above-mentioned immunoconjugate.
[0026] In a ninth aspect of the present invention, there is provided the use of the above-mentioned anti-human platelet collagen receptor GP-VI antibody or an antigen-binding fragment thereof, immunoconjugate or pharmaceutical composition in the preparation of a product for preventing and / or treating thrombotic cardio-cerebrovascular diseases including reperfusion injury.
[0027] More specifically, the product has at least the following functions:
[0028] (a) Block the human platelet collagen receptor GP-VI;
[0029] (b) Inhibit platelet activation, adhesion, aggregation, and thrombus formation;
[0030] (c) Inhibit reperfusion injury or post-infarct reperfusion injury to reduce infarction or mitigate the adverse effects on organ function.
[0031] In a tenth aspect of the present invention, there is provided a method for preventing and / or treating thrombotic cardio-cerebrovascular diseases, the method comprising: administering to the subject the above-mentioned anti-human platelet collagen receptor GP-VI antibody or its antigen-binding fragment, immunoconjugate, or pharmaceutical composition.
[0032] The beneficial technical effects of the above one or more technical solutions:
[0033] The above technical solution specifically inhibits the activation of human platelets by collagen and blocks the attachment of human platelets to the collagen-coated surface by designing a recombinant expressed single-chain variable region fragment (scFv) or a fusion fragment with human serum albumin. At the same time, it provides the design and large-scale production of scFv antibody-derived fragments or fusion recombinant proteins with human serum albumin, and its reduction of myocardial ischemia or reperfusion-induced brain tissue injury in the heart after ischemia by inhibiting platelet activation, thereby being useful for the treatment and prevention of thrombosis and other cardio-cerebrovascular diseases, and thus having good practical application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0034] The specification drawings forming a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention.
[0035] Figure 1 : Schematic diagram of platelet activation and thrombus formation, showing that GP-VI plays an extremely important role in platelet activation and thrombus formation;
[0036] Figure 2 : Molecular structure of platelet membrane protein receptor GP-VI and dimer functional structure formed with FcRgamma;
[0037] Figure 3 : Plasmid structure and sites after importing synthetic GP-VI HSA-scFv nucleotide double-strands;
[0038] Figure 4 : Structure of Pichia expression vector, import sites, and orientation;
[0039] Figure 5: Base sequence near the import site of the Pichia expression vector, insertion site, and schematic diagram of the insertion of the GP-VI scFv fragment;
[0040] Figure 6 : SDS-PAGE (Coomassie blue staining): Recombinant protein expression and molecular size identification. The 16th lane at the far right is the protein molecular size standard, and the size of each band is marked on the right. Lanes 1-7 are HSA-scFv (VH-VL), lanes 8-14 are HSA-scFv (VL-VH), and lane 15 is scFv (VH-VL);
[0041] Figure 7 : Adhesion and binding inhibition assay of GP-VI to collagen. a, The first Fab (OM-2, murine anti-GP-VI monoclonal antibody Fab, concentration 3 μg / ml) was used as a valid positive control; B1-1 was the negative control; B1-2 to 4 and 8 to 10 were HSA-scFv (I) (VH-VL), showing a blocking effect; B1-5 to 7 were HSA-scFv (II) (VL-VH) which were ineffective; B2-9 and 2-13 were scFv (I) (VH-VL). All expressed supernatants were diluted 1:100, and the dilution was carried out using the binding solution for the adhesion and binding inhibition assay (0.2% BSA in 1 mM EDTA-PBS, pH 7.4). b, Concentration gradient inhibition assay, scFv (I) (VH-VL) and HSA-scFv (I) (VH-VL) showed an inhibitory effect parallel to the dilution, and OM-2 (murine anti-GP-VI monoclonal antibody Fab concentration 3 μg / ml) was used as the positive control;
[0042] Figure 8 : Comparison of myocardial infarction areas in wild-type and GP-VI gene knockout mice is shown. After 30 minutes of ischemia and 24 hours of reperfusion, the myocardial infarction in GP-VI gene knockout mice was significantly smaller than that in wild-type mice. Each open circle represents the infarction area of a single mouse, and the closed circle represents the group mean ± SD. Data were analyzed using the t-test, and p < 0.05 was considered statistically significant;
[0043] Figure 9: a, Comparison of P-selectin expression in the myocardium of wild-type and GP-VI gene knockout mice after ischemia and reperfusion is shown. Representative fluorescence images from the endocardium and the mid-myocardium are shown. P-selectin expression in the myocardium of GP-VI gene knockout mice was reduced as shown in green (or bright white in the black and white image) (dark background fluorescence was due to myocardial autofluorescence). Similar results were obtained in 5 hearts from wild-type mice and 5 hearts from GPVI gene knockout mice, respectively. b, Quantification of the area with high P-selectin expression is shown. The P-selectin level in GP-VI gene knockout (KO) mice was significantly lower than that in wild-type (WT) mice (n = 5), indicating that GP-VI plays an important role in inducing platelet activation and myocardial aggregation;
[0044] Figure 10 : Collagen exposure in the hearts of wild-type mice due to reperfusion after ischemia is shown. The left image shows a representative section of the heart reperfused for 15 minutes after 30 minutes of ischemia. Green (or bright white in the black and white image) represents the exposed collagen (dark background fluorescence was due to myocardial autofluorescence). Similar results were obtained in 3 additional animals. The right image shows a representative section of the heart exposed to ischemia for 30 minutes but without subsequent reperfusion. There was no obvious green fluorescence (or no bright white in the black and white image), indicating no collagen exposure. Similar results were obtained from 2 additional animals. Collectively, these data indicate that endothelial injury occurs during reperfusion;
[0045] Figure 11 : a shows the infarct-reducing effect of recombinant anti-GP-VI HAS-scFv(I) (VH-VL) in monkeys. The figure shows a scatter plot of the risk area versus the infarct area, and regression lines were plotted for each designated treatment group. The infarct in the control group of monkeys was linearly correlated with the size of the risk area. Since all data points were below the regression line of the control group (p < 0.05), monkeys treated with a single or double dose of the recombinant fusion antibody fragment had reduced myocardial infarction. In addition, the reduction in monkeys treated with a single or double dose was similar, indicating that the protective effect occurred during reperfusion. Infarct data were analyzed by analysis of variance (ANOVA). Figure b shows the inhibitory effect of the antibody on platelet aggregation in the blood of monkeys. Blood samples were taken from monkeys before administration (before dosing) and after administration (4 hours after dosing) (2 mg / kg). Collagen-induced platelet aggregation was measured in vitro using a whole blood aggregometer. b shows the measurement results of collagen-induced platelet aggregation. Collagen-induced platelet aggregation was completely inhibited in the whole blood of animals receiving the recombinant antibody fusion fragment. Detailed Description of the Invention
[0046] It should be noted that the following detailed description is illustrative only and is intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the technical field to which the present invention pertains.
[0047] It should be noted that the terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular forms are also intended to include the plural forms. In addition, it should be understood that when the terms "comprises" and / or "comprising" are used in this specification, they specify the presence of the stated features, steps, operations, devices, components, and / or combinations thereof.
[0048] The present invention will be further described in conjunction with specific examples below. The following examples are only for explaining the present invention and do not limit its content. If the specific experimental conditions are not indicated in the examples, they are usually in accordance with conventional conditions or the conditions recommended by the reagent company; the reagents, consumables, etc. used in the following examples can be obtained from commercial sources without special instructions.
[0049] To make the present disclosure easier to understand, certain terms are first defined. As used in this application, unless otherwise expressly specified herein, each of the following terms shall have the meaning given below. Other definitions are set forth throughout the application.
[0050] The term "antibody" or "immunoglobulin" is used herein as a general term to include full-length antibodies, their individual chains, and all parts, domains or fragments thereof (including but not limited to antigen-binding domains or fragments, such as VHH domains or VH / VL domains respectively), whether referring to heavy-chain antibodies or conventional four-chain antibodies. In addition, the term "sequence" as used herein (such as in terms like "immunoglobulin sequence", "antibody sequence", "single variable domain sequence", "VHH sequence" or "protein sequence") should generally be understood to include both the relevant amino acid sequence and the nucleic acid sequence or nucleotide sequence encoding said sequence, unless a more restrictive interpretation is required herein.
[0051] The term "domain" (of a polypeptide or protein) refers to a folded protein structure that can maintain its tertiary structure independently of the rest of the protein. Generally, a domain is responsible for a single functional property of the protein, and in many cases can be added, removed or transferred to other proteins without loss of the function of the rest of the protein and / or the domain.
[0052] The term "single-chain antibody scFv" is formed by directly connecting the variable region of the heavy chain of an antibody and the variable region of the light chain, or by connecting them through a linker. The scFv can better retain its affinity activity against antigens and has characteristics such as a small molecular weight, strong penetrability, and weak antigenicity.
[0053] "Sequence identity" between two polypeptide sequences indicates the percentage of identical amino acids between the sequences. "Sequence identity" indicates the percentage of amino acids with identical amino acid substitutions. Methods for evaluating the degree of sequence identity between amino acids or nucleotides are known to those skilled in the art. For example, amino acid sequence identity is usually measured using sequence analysis software. For example, the BLAST program of the NCBI database can be used to determine identity.
[0054] An "effective amount" of an agent refers to the amount necessary to cause a physiological change in a cell or tissue to which it is administered.
[0055] A "therapeutically effective amount" of an agent, such as a pharmaceutical composition, refers to the amount that is effective in achieving the desired therapeutic or prophylactic result at the required dose and time period. A therapeutically effective amount of an agent, for example, eliminates, reduces, delays, minimizes, or prevents the adverse effects of a disease.
[0056] An "individual" or "subject" can be a mammal. Mammals include, but are not limited to, domesticated animals (such as cows, sheep, cats, dogs, and horses), primates (such as humans and non-human primates like monkeys), rabbits, and rodents (such as mice and rats). Preferably, the individual or subject is a human.
[0057] The term "pharmaceutical composition" refers to a preparation in a form such that the biological activity of the active ingredient contained therein is effective and that does not contain other ingredients that are unacceptably toxic to the subject to which the composition is to be administered.
[0058] The term "treatment / prevention" refers to an attempt to alter the natural course of a disease in a treated individual and can be a clinical intervention carried out for prophylaxis or during the course of clinical pathology. Desired effects of treatment include, but are not limited to, preventing the occurrence or recurrence of a disease, relieving symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the rate of disease progression, improving or alleviating the disease state, and obviating or improving the prognosis. In some embodiments, the antibodies of the present invention are used to delay the formation of a disease or slow the progression of a disorder.
[0059] In a typical specific embodiment of the present invention, an anti-human platelet collagen receptor GP-VI antibody or an antigen-binding fragment thereof is provided. The antibody at least comprises (a) an antibody element targeting GP-VI, and the antibody element targeting GP-VI can be a single-chain antibody against GP-VI (scFv), which can effectively block GP-VI. The single-chain antibody against GP-VI at least comprises 3 heavy-chain variable region HV sequences and 3 light-chain variable region LV sequences, and their amino acid sequences are respectively the sequences shown in SEQ ID NOs: 18-23, or sequences having ≥80% (preferably 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, more preferably 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) sequence identity with the sequences shown in SEQ ID NOs: 18-23, or amino acid sequences having one or more (preferably 1, 2 or 3) conservative amino acid mutations (preferably substitution, insertion or deletion) compared with the sequences shown in SEQ ID NOs: 18-23.
[0060] The polypeptide amino acid polypeptide sequence is specifically as follows:
[0061] HV region 1: DYYLS (SEQ ID NO.18)
[0062] HV region 2: WISTGDGNTRYPQKFQG (SEQ ID NO.19)
[0063] HV region 3: SADIYFRYFDV (SEQ ID NO.20)
[0064] LV region 1: RASQGISSYLA (SEQ ID NO.21)
[0065] LV region 2: NASILQS (SEQ ID NO.22)
[0066] LV region 3: QHFWTAPFN (SEQ ID NO.23)
[0067] Structurally, the N-terminus of the heavy-chain variable region can be directly connected to the C-terminus of the light-chain variable region or connected through a linker, or the N-terminus of the light-chain variable region can be directly connected to the C-terminus of the heavy-chain variable region or connected through a linker. The linker is preferably a polypeptide chain composed of alanine and / or serine and / or glycine, and the length of the linker peptide is preferably 3-30 amino acids, having certain elasticity and protease resistance.
[0068] An "antigen-binding fragment" of an antibody of the present invention is a part of the antibody, i.e., a molecule corresponding to a part of the structure of the antibody of the present invention. These antigen-binding fragments can also be referred to as functional fragments of the antibody, and such fragments exhibit the same or substantially the same antigen-binding specificity and affinity for the antigen.
[0069] The anti-human platelet collagen receptor GP-VI antibody may independently comprise one or more (such as 1-3) antibody elements targeting GP-VI; preferably, it may independently comprise 1 or 2 antibody elements targeting GP-VI.
[0070] The anti-human platelet collagen receptor GP-VI antibody may further comprise: (b) a human immunoglobulin Fc region and / or serum albumin or a fragment thereof, a domain that binds serum albumin, polyethylene glycol, a polyethylene glycol-liposome complex, or a combination thereof;
[0071] Furthermore, the antibody may comprise one or more (such as 1-3) human immunoglobulin Fc regions and / or serum albumin (such as human HSA) or a fragment thereof, a domain that binds serum albumin (such as an anti-serum albumin antibody, including a nanobody), polyethylene glycol, a polyethylene glycol-liposome complex, or a combination thereof.
[0072] In the anti-human platelet collagen receptor GP-VI antibody, the (a) and (b) may be directly linked or linked through a linker; the linker is preferably a polypeptide chain composed of alanine and / or serine and / or glycine, and the length of the linker peptide is preferably 3 to 30 amino acids.
[0073] Structurally, the C-terminus of the (a) may be directly (or through a linker) linked to the N-terminus of the (b), or the C-terminus of the (b) may be directly (or through a linker) linked to the N-terminus of the (a).
[0074] In another specific embodiment of the present invention, a polynucleotide is provided, and the polynucleotide is capable of encoding the above-mentioned anti-human platelet collagen receptor GP-VI antibody or its antigen-binding fragment.
[0075] In another specific embodiment of the present invention, a recombinant expression vector is provided, which comprises the above-mentioned isolated polynucleotide.
[0076] Specifically, the recombinant expression vector is obtained by effectively linking the above-mentioned polynucleotide with an expression vector, and the expression vector may be selected from: DNA, RNA, viral vectors, plasmids, transposons, other gene transfer systems, or a combination thereof; preferably, the expression vector includes viral vectors, such as lentivirus, adenovirus, AAV virus, retrovirus, or a combination thereof.
[0077] In yet another specific embodiment of the present invention, a host cell is provided, which comprises the above expression vector, or comprises the above polynucleotide integrated into the genome of the host cell; alternatively, the host cell expresses the above anti-human platelet collagen receptor GP-VI antibody or its antigen-binding fragment.
[0078] The host cells include cells derived from prokaryotes and eukaryotes. Among them, the prokaryote is preferably Escherichia coli, and the eukaryotes include yeast (Pichia pastoris), plants (or cells), insects (or cells), and mammals (or cells), and the mammalian cells include CHO, NS0, HEK293, PERC6, etc., and CHO cells are preferred.
[0079] In yet another specific embodiment of the present invention, a method for producing an anti-human platelet collagen receptor GPVI antibody or its antigen-binding fragment is provided, comprising the steps of:
[0080] (I) Culturing the above host cells under conditions suitable for antibody production to obtain a culture containing the anti-human platelet collagen receptor GP-VI antibody or its antigen-binding fragment; and,
[0081] (II) Separating or recovering the anti-human platelet collagen receptor GP-VI antibody or its antigen-binding fragment from the culture.
[0082] In yet another specific embodiment of the present invention, a recombinant polypeptide conjugate is provided, which comprises the anti-human platelet collagen receptor GP-VI antibody or its antigen-binding fragment of the present invention, and a conjugate moiety, wherein the conjugate moiety is a detectable label, a drug, a toxin, a cytokine, a viral capsid protein, or a VLP, etc.
[0083] Among them, the detectable label includes a radioisotope, a fluorescent substance, a chemiluminescent substance, a colored substance, or an enzyme.
[0084] The drug can be a cytotoxic drug, such as an anti-tubulin drug, a DNA minor groove binder, a DNA replication inhibitor, an alkylating agent, an antibiotic, a folic acid antagonist, an antimetabolite, a chemotherapy sensitizer, a topoisomerase inhibitor, a vinca alkaloid, etc.
[0085] The toxin can be auristatins, chlortetracycline, maytansinol, ricin, ethidium bromide, mitomycin, diphtheria toxin, abrin, gelonin, maytansine, restrictocin, phenomycin, curcin, croton toxin, calicheamicin, glucocorticoid, etc.
[0086] The recombinant polypeptide conjugate contains a multivalent (such as divalent) anti-human platelet collagen receptor GP-VI antibody as described in the present invention. The multivalent means that the amino acid sequence of the recombinant polypeptide conjugate contains multiple repeats of the anti-human platelet collagen receptor GP-VI antibody as described in the present invention.
[0087] In another specific embodiment of the present invention, a kit is provided, which includes the above-mentioned anti-human platelet collagen receptor GP-VI antibody or its antigen-binding fragment, and / or the above-mentioned conjugate; the kit can be used to detect the presence or concentration of human platelet collagen receptor GP-VI in a sample.
[0088] Preferably, the kit further includes a second antibody that specifically recognizes the above-mentioned antibody; optionally, the second antibody further includes a detectable label, such as a radioactive isotope, a fluorescent substance, a chemiluminescent substance, a colored substance, or an enzyme.
[0089] In another specific embodiment of the present invention, a pharmaceutical composition is provided, which includes the above-mentioned anti-human platelet collagen receptor GP-VI antibody or its antigen-binding fragment, or the above-mentioned recombinant polypeptide conjugate.
[0090] The pharmaceutical composition may further contain at least one pharmaceutically inactive ingredient.
[0091] The pharmaceutically inactive ingredient may be a carrier, excipient, diluent, etc. commonly used in pharmacy. Moreover, according to the usual methods, it can be made into dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, sprays, etc., for oral administration, external use, suppositories, and sterile injection solutions.
[0092] The carrier, excipient, diluent, etc., which can be included, are well-known in the art, and those of ordinary skill in the art can determine that they meet clinical standards.
[0093] In another specific embodiment of the present invention, the carrier, excipient, and diluent include, but are not limited to, lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, arabic gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl paraben, propyl paraben, etc.
[0094] In yet another specific embodiment of the present invention, the pharmaceutical composition of the present invention can be administered into the body by known methods. For example, it can be delivered systemically via intravenous injection or locally injected into the tissue of interest. Optionally, it can be administered via intravenous, transdermal, intranasal, mucosal or other delivery methods. Such administration can be carried out via a single dose or multiple doses. Those skilled in the art understand that the actual dose to be administered in the present invention can vary to a large extent depending on various factors, such as platelets, target cells, biological types or their tissues, the general condition of the subject to be treated, the route of administration, the mode of administration, and so on.
[0095] In yet another specific embodiment of the present invention, there is provided the use of the above-mentioned anti-human platelet collagen receptor GP-VI antibody or its antigen-binding fragment, recombinant polypeptide conjugate or pharmaceutical composition in the preparation of a product for the prevention and / or treatment of thrombotic cardiovascular and cerebrovascular diseases.
[0096] More specifically, the product has at least the following functions:
[0097] (a) Block the human platelet collagen receptor GP-VI;
[0098] (b) Inhibit platelet activation, adhesion, aggregation and thrombus formation;
[0099] (c) Inhibit reperfusion injury or post-infarction reperfusion injury to reduce infarction or reduce the adverse effects on organ function.
[0100] In yet another specific embodiment of the present invention, there is provided a method for preventing and / or treating thrombotic cardiovascular and cerebrovascular diseases, the method comprising: administering to the subject the above-mentioned anti-human platelet collagen receptor GP-VI antibody or its antigen-binding fragment, recombinant polypeptide conjugate or pharmaceutical composition.
[0101] The present invention will be further explained and illustrated by the following examples, but this does not constitute a limitation to the present invention. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The test methods without specific conditions noted in the following examples are generally carried out under conventional conditions.
[0102] Examples
[0103] 1. Use normal human platelets as the antigen source (immunogen) of the collagen receptor "glycoprotein-6", and use patients with thrombocytopenic purpura (lacking the platelet collagen receptor "glycoprotein-6") as the immune receptor to prepare B lymphocytes expressing anti-GP-VI antibodies in the patients, and extract nucleotides therefrom:
[0104] (1) Patient screening: Collaborate with the hematology department of the hospital. After obtaining the consent of the patient and their family members, for patients with thrombocytopenic purpura, use sodium citrate as an anticoagulant to draw 15 ml of blood. Obtain the supernatant by low-speed centrifugation (platelets-rich plasma or PRP, specific method refer to Sun, B et al. J. Cardiovascular Pharmacol. 40:557 - 585, 2002). Take 400 μl of the obtained supernatant and preheat it on a platelet aggregometer at 37 °C. Then use 10 or 20 μmol (μM) of adenosine diphosphate (ADP) to confirm that the platelets of this patient can aggregate under stirring (1000 revolutions per minute). Then add type I fibrillar collagen from horse tendon (1 - 2 μg / ml) to induce platelet aggregation. For patients with no response, further confirm whether they have a history of blood transfusion. Next, screen whether there are autoantibodies against the collagen receptor "glycoprotein-6" in the patient's blood. The method used is also platelet aggregation because intact anti-collagen receptor "glycoprotein-6" antibodies or F(ab) 2 fragments can trigger platelet activation through receptor cross-linking. Add the patient's serum (200 μl) to the preheated platelet-rich plasma (PRP) of normal people (who have an aggregation response to collagen). Observe whether platelet aggregation is induced within one hour. Use this method to screen patients whose platelets have no response to collagen. Use platelet-rich plasma to perform aggregation tests stimulated by collagen, adenosine diphosphate (ADP), U46619 (thromboxane TXA 2 receptor activator), and arachidonic acid (ararchidonic acid or AA). The test results are shown in Table 1. It can be seen from this table that the patient's platelets have no response to the stimulation of collagen, but have a normal response to other activators. The patient's serum can cause mild platelet activation and aggregation in others (because the patient had a history of blood transfusion, resulting in autoantibodies against the collagen receptor "glycoprotein-6"). Further separate and detect the patient's platelets by protein gel electrophoresis (SDS-PAGE) and Western blotting, and confirm that the patient's platelets do not express the collagen receptor "glycoprotein-6" at all (i.e., there is no protein band of 62 kDa).
[0105] Table 1
[0106] Activator Platelet aggregation rate (% of light transmission) Number of trials 1 μg / mL collagen 1.3+ / -0.1 3 10 μM adenosine diphosphate 75.4+ / -4.4 3 3 μM U46619 85.2+ / -5.6 3 400 μM arachidonic acid 77.8+ / -3.9 3
[0107] (2) Isolate the patient's B lymphocytes expressing antibodies against the collagen receptor "glycoprotein-6": With the patient's consent, 50 ml of the patient's blood was drawn one week after 200 ml of normal human blood (i.e., expressing the collagen receptor "glycoprotein-6" on platelets) was transfused for his routine treatment. After centrifugation, the white blood cells at the interface between the plasma and red blood cells were collected, washed with phosphate buffered saline (pH 7.4) and centrifuged again. The cells obtained were suspended in 5 ml of phosphate buffered saline. At the same time, cover slips (20 mm x 20 mm) were washed with 70% alcohol and distilled water and dried. 300 ml of normal human platelet-rich plasma was evenly dropped onto this glass cover slip and incubated at room temperature for one hour to allow platelet adhesion (the glass itself can activate platelets to make them adhere to the glass surface). After washing with phosphate buffered saline, it was placed at the bottom of a specially made perfusion chamber (the production method is described in the reference Sun B, et al. J. Physiol. 1996, 495:65-82), and then clamped and sealed. After connecting to a perfusion pump, air bubbles were first removed with phosphate buffered saline, and then the above-prepared white blood cell suspension was used to start slow perfusion (flow rate about 0.1 ml per minute); then 2 ml of phosphate buffered saline was used to wash at the same speed. Finally, the taken-out cover slip was gently immersed in phosphate buffered saline and immediately taken out. Finally, the attached cells (i.e., the patient's B lymphocytes) were pipetted and collected in 0.5 ml of phosphate buffered saline, and sub-packed onto a 96-well PCR plate. After centrifugation, the cells were lysed and nucleotides (total RNA) were extracted.
[0108] 2. Amplify and clone the variable regions of the heavy and light chains of the antibody cDNA by RT-PCR:
[0109] According to the nucleotide sequences of the conserved regions of human IgG cDNA, two pairs of degenerate primers targeting the conserved regions of the heavy and light chains were designed. Using Invitrogen's single-cell RT-PCR kit, and then through two rounds of 45-cycle PCR and RACE-PCR amplification, the final product was cloned into Invitrogen's TA cloning vector plasmid. After transfection of bacteria, the transfected strains with fragment insertion were first screened using the primers on both sides of the cloning site on the TA cloning vector plasmid and colony-PCR. After small-scale purification of the plasmid containing the cloned fragment, DNA sequencing and analysis were performed on the fragment of the expected size. After three rounds of screening, the complete sequences of the variable regions of the heavy and light chains were finally obtained by DNA sequencing, including the sequences of the heavy chain variable region and light chain variable region described above.
[0110] 3. Prepare the antibody HSA-scFv fusion fragment of recombinant monoclonal anti-human platelet collagen receptor "glycoprotein-6":
[0111] The human serum albumin sequence is derived from GenBank: CAA23754.1 - serum albumin [Homo sapiens], which consists of 609 amino acids (SEQ ID NO.1), including a secretion signal peptide (pre) and a propeptide (pro). After the human serum albumin is expressed and secreted, the signal peptide (aa1 - 18) and the propeptide (aa19 - 24) are excised, and the mature peptide of human serum albumin is 585 amino acids (aa25 - 609).
[0112] If Pichia pastoris is used for expression and production, the antibody part of the fusion protein of human serum albumin and anti - G - VI6 antibody is a single - chain antibody against GP - VI (GP - VIscFv), which is composed of the variable regions of the heavy chain and the light chain (VH, VL) of a humanized anti - GP - VI monoclonal antibody and a linker peptide connecting VH and VL. The structure of GP - VIscFv(I) is VH - linker peptide - VL (SEQ ID NO.2), and the linker peptide is: TSGSGKPGSGEGSTKG. The structure of GP - VIscFv(II) is VL - linker peptide - VH (SEQ ID NO.3), and the linker peptide is: GSTSGSGKPGSGEGSTKG. GP - VIscFv(I) and (II) are linked to the C - terminus of human serum albumin containing the signal peptide and the propeptide through a short linker peptide (GSGGS) to form preproHSA - GP - VI(I), SEQ IDNO.4 and preproHSA - GP - VI(II), SEQ ID NO.5. According to the codon preference of Pichia pastoris, the amino acid sequences of preproHSA - GP - VI(I) and preproHSA - GP - VI(II) are reverse - translated into nucleotide sequences respectively. After further optimizing the reverse - translated sequences and removing the sequences that affect gene stability, a TTC GAA ACC sequence (Sfu I endonuclease and ribosome binding site) and a TAA GAA TTC sequence (stop codon and EcoRI endonuclease site) are added at the 5' - end and 3' - end respectively to construct the nucleic acid sequences for expressing the fusion protein of human serum albumin and anti - GP6 antibody, nHSA - GP - VI(I) (SEQ IDNO.6) and nHSA - GP - VI(II) (SEQ ID NO.7).
[0113] The nucleic acid sequences for expressing the fusion protein of human serum albumin and anti - GP - VI antibody were synthetically prepared by GenScript. After gene synthesis, the whole sequence was inserted into the Eco Rv site of the pUC57 plasmid, and then amplified by the bacterium E.coli to obtain the pUC57 - nHSA - GP - VI(I) and (II) plasmids ( Figure 3 ).
[0114] Construction of expression plasmid of human serum albumin and anti-GP-VI antibody fusion protein: After double digestion of pUC57-nHSA-GP-VI(I) and (II) plasmids with Sfu I and Eco RI, the nucleic acid sequences expressing human serum albumin-anti-GP-VI antibody fusion protein, nHSA-GP-VI(I) (SEQ ID NO.6) and nHSA-GP-VI(II) (SEQ ID NO.7), were isolated and inserted into the corresponding restriction enzyme sites of the Pichia pastoris expression vector pYL(His), constructing the expression plasmids pYL(His)-nHSA-GP-VI(I) and (II). pYL(His) was derived by modifying the pPIC9 plasmid (Invitrogen / Thermo Fisher). Compared with pPIC9, pYL(His) removed the 3'AOX1 DNA fragment to ensure that the expressed gene was inserted into the desired site on the Pichia pastoris genome, and all the clones obtained after Pichia pastoris gene transfer were of the mut+ (methanol utilization) phenotype. At the same time, another Sfu I restriction enzyme site in the plasmid sequence was also removed.
[0115] After being ligated to pYL(His) digested with Sfu I and Eco RI, the AOX1 (alcohol oxidase) transcriptional promoter was in front of the 5' end of nHSA-GP-VI(I) and nHSA-GP-VI(II), and the terminator (AOX1 transcription termination region, TT) was behind the 3' end ( Figure 4 and Figure 5 ). The protein sequences secreted after transcription, translation in Pichia pastoris host cells were: pHSA-GP-VI(I), SEQ ID NO.8 and pHSA-GP-VI(II), SEQ ID NO.9. After amplifying the expression plasmids pYL(His)-nHSA-GP-VI(I) and (II) through the bacterium E. coli, plasmid isolation and purification were carried out to obtain a large amount of plasmid DNA.
[0116] Transformation of Pichia pastoris: Pichia pastoris is a methylotrophic yeast that can use methanol metabolism as its sole carbon source. The first step of methanol metabolism is to oxidize methanol to formaldehyde through the action of alcohol oxidase. Pichia pastoris has two alcohol oxidases, encoded by the AOX1 and AOX2 genes respectively, and the product of the AOX1 gene accounts for the main part of the alcohol oxidase activity in the cell. The AOX1 gene is highly expressed under the strict regulation and induction of methanol, usually reaching more than 30% of the total soluble protein. Therefore, in the Pichia pastoris expression system, the AOX1 promoter is used to drive the expression of foreign genes.
[0117] We selected the Pichia pastoris strain GS115 as the expression strain. GS115 is a auxotrophic strain with a mutation in its histidine dehydrogenase gene (HIS4), which makes it unable to synthesize histidine. Therefore, before gene transformation, GS115 cannot grow on minimal medium without histidine. After transformation, the wild HIS4 gene carried by the expression plasmid complements the mutant his4 of the host, restoring the histidine synthesis function and enabling it to grow on selective medium lacking histidine.
[0118] The transformation process of Pichia pastoris is as Figure 4 shown. The expression plasmids pYL(His)-nHSA-GP-VI (I) and (II) are digested with StuI to become linear DNA, and then enter the nucleus of Pichia pastoris GS115 through electroporation. In the nucleus, the linear pYL(His)-nHSA-GP-VI (I) and (II) DNA integrates with the host cell genome through homologous recombination and inserts into its His4 locus.
[0119] Strain (clone) screening: The successfully electrotransformed GS115 yeast can grow on medium lacking histidine due to the integration of pYL(His)-nHSA-GP-VI into the genome. Therefore, after electroporation, the GS115 yeast cells are spread on Yeast Synthetic Drop-out Agar Medium without Histidine for culture. After culturing at 30 °C for 3 to 4 days, single yeast colonies (clones) are picked from the medium plate and streaked on a yeast histidine-deficient synthetic agar medium plate, and then cultured at 30 °C for 3 to 4 days to remove the contamination of untransformed GS115 yeast cells. After two rounds of selective culture screening, the selected yeast colony cells are inoculated into liquid medium for culture, and then induced with methanol to establish an expression strain of the human serum albumin and anti-GP-VI antibody fusion protein.
[0120] Induced expression and detection: In Pichia pastoris cells, the expression of the AOX1 gene is strictly regulated. It is highly expressed under the induction of methanol but completely inhibited in the presence of glucose. Therefore, to avoid the inhibitory effect of glucose as a carbon source, before induced expression, yeast cells are grown in a growth medium containing glycerol and then transferred to an induction medium containing methanol to grow and express the protein driven by the AOX1 gene promoter.
[0121] Growth medium formulation (volume percentage, autoclaved):
[0122] Yeast extract 1%
[0123] Peptone 2%
[0124] Glycerol 1%
[0125] Induced expression medium formulation (volume percentage, autoclaved):
[0126] Yeast extract 1%
[0127] Peptone 2%
[0128] 100 mM potassium phosphate, pH 7.0
[0129] Yeast nitrogen base (YNB) 1.34%
[0130] Biotin 1.34%
[0131] Methanol anhydrous 0.5%
[0132] Using an inoculation loop, transfer yeast cells from the yeast colonies grown on a histidine-deficient synthetic agar medium plate to 3 ml of the growth medium. Incubate at 30 °C on a shaker (200 rpm) for 24 hours, then centrifuge at room temperature (23 °C) at 3000 x g for 10 minutes to remove the culture medium. Resuspend the yeast cells in 1.5 ml of the induced expression medium and incubate at 25 °C on a shaker for 48 hours. Add methanol at 0.5% of the medium volume at 12, 24, and 36 hours of induced culture, respectively. After 48 hours of methanol-induced expression, centrifuge at 3000 x g for 10 minutes, collect the liquid culture medium (supernatant), add ethylenediaminetetraacetic acid (EDTA) solution to a final concentration of 5 mM, and then store at 4 °C.
[0133] Expression of anti-GP-VI single-chain antibody (scFv) in Pichia pastoris: To secrete and express GP-VI scFv in Pichia pastoris, a secretion signal peptide needs to be added to the N-terminus of scFv or the scFv sequence needs to be fused behind the signal peptide (C-terminus) carried by the expression vector. We chose to fuse GP-VI scFv behind the yeast α-mating factor signal peptide and prepropeptide (alpha-factor prepro) carried by the expression vector pYL(His), and inserted the DNA fragment carrying GP6 scFv into the XhoI and EcoR I of the vector plasmid (as Figure 5 shown). The DNA sequence of GP-VI scFv was obtained by PCR amplification using the expression plasmids pYL(His)-nHSA-GP-VI(I) and (II) of human serum albumin-anti-GP-VI antibody fusion protein as templates. Corresponding to HSA-GP-VI scFv(I) and (II), the structure of GP-VI scFv(l) is VH-linker-VL, while GP-VI scFv(lI) is arranged as VL-linker-VH.
[0134] The primers used for PCR amplification of GP-VIscFv(l) are: 5’GP-VIscFv(I), SEQ ID NO.10 and 3’GP-VIscFv(I), SEQ ID NO.11; while the primers for amplifying GP-VIscFv(lI) are: 5’GP-VIscFv(II), SEQ ID NO.12 and 3’GP-VIscFv(II), SEQ ID NO.13. The 3’ primers (SEQ ID NO.11 and SEQ ID NO.13) in the two pairs of primers are reverse complement sequences, which are respectively derived from the 33 bases at the 3’ end of the two sequences nHSA-GP-VI(I), SEQ ID NO.6 and nHSA-GP-VI(II), SEQ ID NO.7, plus two bases used to protect the terminal EcoRI restriction site. The two 5’-end primers (SEQ ID NO.10 and SEQ ID NO.12) are both composed of the 5’ sequence of GP-VIscFv and an additional sequence: the 5’ sequence of GP-VIscFv is taken from the base positions 1852 to 1876 of the nHSA-GP-VI(I), SEQ ID NO.6 sequence and the 1852 to 1877 fragment of the nHSA-GP-VI(II), SEQ ID NO.7 sequence respectively. The additional sequence of the two 5’ primers is: GCCGCTCGAGAAGAGAGCT. It includes the Xho I restriction site CTCGAG and the downstream AAGAGAGCT sequence. The downstream sequence part encodes lysine (Lys), arginine (Arg) and alanine (Ala). These two basic amino acids (Lys and Arg) are the signal peptide propeptide cleavage sites, while Ala is used to improve the cleavage efficiency. After cleavage from the signal peptide propeptide, Ala will remain at the N-terminus of GP6scFv. Therefore, after expression and secretion, there is an additional Ala at the N-terminus of both GP-VIscFv(I) and (II). The four bases GCCG in front of the Xho I restriction site are used to protect the Xho I restriction site and improve the restriction efficiency. The DNA sequences of GP-VIscFv(I) and (II) after PCR amplification are listed as SEQ ID NO.14 and SEQ ID NO.15 respectively. After expression and secretion, the final recombinant scFv protein sequences are pGP-VIscFv(I), SEQ ID NO.16 and pGP-VIscFv(II), SEQ ID NO.17 respectively.
[0135] Sample preparation: Before detecting biological activity, the culture medium after methanol-induced expression is first passed through Centrifuged through a Millipore filter to remove components with a molecular weight less than 30 Kd from the culture medium and replace the sample buffer solution. Pipette 0.5 ml of the culture medium after methanol induction into a centrifugal filter, centrifuge at 4°C (14,000 x g) for 15 - 20 minutes, and discard the filtrate. Then add a phosphate-buffered saline (PBS) containing 0.1% BSA, 0.02% Tween-20, and 1 mM EDTA to the filter and centrifuge for washing twice. Finally, add the washing buffer solution to a volume of 250 ml in the filter and store at 4°C. The culture medium after methanol induction was analyzed by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) to detect the expression of the anti-GP-VI antibody scFv, human serum albumin, and the fusion proteins pHSA-GP-VI(I) and pHSA-GP-VI(II) of the anti-GP-VI antibody ( Figure 6 ).
[0136] If mammalian cells such as DG44 CHO cells are used to express and produce recombinant proteins, the cloned gene fragments are ligated in the following manner. The Kozak (GCCACC) sequence is added before the protein synthesis initiation signal ATG, the secretion signal sequence of the monoclonal antibody Herceptin (GAGACCGACACCCTGCTGCTGTGGGTGCTGCTGCTGTGGGTGCCCGGCAGCACCGGC) is added before the heavy chain variable region or human serum albumin, a peptide chain composed of 16 Ser and Gly (SGGGGSGGGSGGGSGG) is added between the light chain and the heavy chain variable regions, 8 histidines are added at the end of the peptide chain for the purification of the recombinant protein scFv, and the protein synthesis termination signal TAA is added at the end of the expression unit. First, optimize the nucleotide sequence of the above sequence, and then synthesize the entire sequence by chemical synthesis. Insert this complete sequence downstream of the CMV promoter of the expression vector plasmid by molecular biological methods. Infect CHO cells and perform limited dilution to screen for single clones. Finally, amplify and collect the supernatant of the serum-free cell culture medium and obtain high-expression single clones by SDS-PAGE. The supernatant obtained from small-scale culture can be purified by a Nick affinity column to obtain the recombinant scFv or fusion protein fragment.
[0137] 4. Conduct functional tests on the obtained products:
[0138] The function of the antibody fragment to block GP-VI was detected by platelet aggregation assays using platelet-rich plasma (PRP) and whole blood. In addition, the blocking effect was further verified by the adhesion assay of washed platelets on the collagen surface.
[0139] (1) Screening and confirmation of high-expression strains of scFv or fusion proteins that can block the binding of human collagen receptor "glycoprotein-6" to collagen (artificial adhesion test) through functional tests, and determination of the effective framework (VH-VL or VL-VH). Figure 7 a and 7b).
[0140] (2) Platelet aggregation test of platelet-rich plasma (PRP): After obtaining the consent of the blood donor, 30 ml of blood was drawn using sodium citrate as an anticoagulant. The supernatant (platelet-rich plasma) was obtained by low-speed centrifugation (the specific method can refer to the literature Sun, B et al. J. Cardiovascular Pharmacol. 40: 557-585, 2002). Then, 400 μl was taken and preheated on a platelet aggregometer at 37 °C for two minutes. First, type I collagen from horse tendon (1 to 2 μg / ml) was used to induce platelet aggregation to confirm that the platelets of this blood donor could aggregate under stirring (1000 revolutions per minute), and the degree of this aggregation (light transmittance) was used as the baseline without the effect of inhibitors. In other tests, the antibody fragment was incubated with PRP for two minutes, and then collagen was added for stimulation. For antibody fragments with inhibitory effects, 10 μM adenosine diphosphate (ADP), 3 μM U46619, and 400 μM arachidonic acid were further used to detect whether the antibody fragment had an inhibitory effect. The detection results of this antibody scFv fragment are shown in Table 2. It can be seen from Table 2 that this scFv fragment selectively inhibits platelet aggregation induced by collagen, and its inhibitory effect is proportional to the concentration of the antibody fragment. However, it has no effect on platelet aggregation induced by other activators.
[0141] Table 2
[0142] Activator (anti-GP-VI fragment concentration) Platelet aggregation rate (% of control) Standard deviation Number of trials 1 μg / mL collagen (0.1 μg / mL 90.3 3.8 3 1 μg / mL collagen (0.3 μg / mL 73.2 4.4 3 1 μg / mL collagen (1 μg / mL) 45.5 4.5 3 1 μg / mL collagen (3 μg / mL) 25.8 4.6 3 1 μg / mL collagen (10 μg / mL) 9.1 4.7 3 10 μM adenosine diphosphate (10 μg / mL) 98.4 8.6 3 3 μM U46619 (10 μg / mL) 99.5 4.7 3 400 μM AA (10 μg / mL) 101.3 3.3 3
[0143] (3) Whole blood platelet aggregation test: After obtaining the consent of the blood donor, 10 ml of blood is drawn using heparin as an anticoagulant. 500 μl of blood and 500 μl of Tyrode-HEPES buffer are placed into a dedicated aggregation test tube, and then preheated at 37 °C for 5 minutes on a platelet aggregometer. First, type I collagen from horse (1 to 2 μg / ml) is used to induce platelet aggregation to confirm that the platelets of this blood donor can aggregate (increase in resistance) under stirring (1000 revolutions per minute), and the degree of this aggregation is used as the baseline without the action of inhibitors. For other tests, the antibody fragment is first incubated with PRP for two minutes, and then collagen is added for stimulation. For antibody fragments with inhibitory effects, further detection is carried out with 3 μM U46619 to check whether the antibody fragment has an inhibitory effect. Among them, the detection results of this antibody are shown in Table 3. It can be seen from Table 3 that this HSA-scFv (VH-VL) fragment selectively inhibits platelet aggregation induced by collagen, and its inhibitory effect is proportional to the concentration of the antibody fragment. However, it has no effect on platelet aggregation induced by the activator U46619.
[0144] Table 3
[0145] Activator (anti-GP-VI fragment concentration) Platelet aggregation rate (% of control) Standard deviation Number of trials 1 μg / mL collagen (1 μg / mL) 55.5 4.5 3 1 μg / mL collagen (10 μg / mL) 11.5 2.5 3 3 μM U46619 (10 μg / mL) 99.4 3.9 3
[0146] (4) Platelet adhesion test (for the detailed steps of this test, refer to the literature Tandon, NN et al. Br. J. Haematol. 89: 124 - 130, 1995). After obtaining the consent of the blood donor, 30 ml of blood is drawn using sodium citrate as an anticoagulant. The supernatant (platelet-rich plasma) is obtained by low-speed centrifugation. Then, PRP is collected into a 15-ml centrifuge tube to prepare washed platelets. After adding prostaglandin E1 (0.8 μg / 4 ml PRP) and citrate buffer (pH 6.0, 100 μl / 5 ml PRP), centrifuge at 2400 revolutions per minute for a total of 20 minutes. The separated platelets are rinsed once with citrate buffer and finally resuspended in 1 ml of Tyrode-HEPES buffer. One day before the test, the 96-well plate is incubated with 100 μl of collagen (1 μg / ml) per well overnight at 4 °C. After washing with Tyrode-HEPES buffer, add the platelet suspension (4x10 8 / ml), and antibody fragments or an equal amount of buffer were added at the same time or in advance as a non-inhibitor control. One hour later, the unattached platelets were washed off, and the attached platelets were dissolved with Triton-X100. Finally, a color reaction was used to detect the LDH released by the platelets, so as to quantify the attached platelets and calculate the inhibitory effect of the antibody fragment. The test results of the antibody are shown in Table 4, from which it can be seen that the HSA-scFv (VH-VL) fragment selectively inhibits the platelet adhesion caused by collagen, and its inhibitory effect is proportional to the concentration of the antibody fragment. However, non-specific antibodies have no inhibitory effect on the platelet adhesion caused by collagen.
[0147] Table 4
[0148] Blocker Platelet adhesion rate (% of control) Standard deviation Number of trials Anti-GP-VI fragment (0.1 μg / mL) 16.4 2.5 3 Anti-GP-VI fragment (0.3 μg / mL) 12.1 3.4 3 Anti-GP-VI fragment (1 μg / mL) 5.1 2.5 3 Anti-GP-VI fragment (3 μg / mL) 2.2 2.5 3 Anti-GP-VI fragment (10 μg / mL) 0.3 1.9 3 Non-specific IgG (10 μg / mL) 96.3 5.6 3
[0149] 5. Mouse experiments show that GP-VI knockout has a protective effect on the myocardium
[0150] Age-matched wild-type and GP-VI knockout mice were anesthetized with 1-1.5% isoflurane, intubated through the trachea, and connected to a pressure-controlled ventilator. The animals were ventilated with room air supplemented with 100% oxygen (4:1 by volume). Before starting the surgery, mice were injected with gentamicin (0.7 mg / kg IM). Body temperature was carefully monitored with a rectal probe connected to a digital thermometer and maintained between 37 and 37.5°C using a heating pad and heating lamp throughout the experiment. In preliminary studies, a catheter was inserted into the carotid artery to measure blood pressure and analyze blood gases. This was to ensure that the mice were able to maintain physiological hemodynamics using these experimental procedures.
[0151] With the aid of a dissecting microscope, the chest cavity is opened through a left thoracotomy. Using a tapered needle, 8-0 nylon suture (Ethicon, Inc., Johnson & Johnson Co., Somerville, NJ) is passed under the left anterior descending coronary artery, 2-3mm from the tip of the left auricle, and the end of the suture passes through a plastic tube. Coronary artery occlusion is caused by pulling the suture onto the catheter. The successful performance of coronary artery occlusion and reperfusion is verified by visual inspection during ischemia (i.e., noting that a light red color appears in the distal myocardium when the suture is pulled, and bright red is restored due to post-deflation hyperemia) and the disappearance after reperfusion. Ischemia lasts for 30 minutes. After occlusion is relieved, the chest is closed in layers with sutures. A certain dose of ketofen (2.5mg / kg, IM) is injected. After obtaining spontaneous respiration, the mice are removed from the ventilator and placed in a temperature / humidity control device with oxygen-enriched air. After the mice obtain normal posture ability, they are put back in the cage for 24 hours.
[0152] At the end of the study (day 2), mice were given heparin (1 U / g IP), followed by anesthesia with sodium pentobarbital (100 mg / kg IP). The heart was excised and perfused with Krebs-Henseleit solution using a Langendorf apparatus via aortic cannulation (23-gauge needle). To delineate the area of occlusion followed by reperfusion (risk area), the coronary artery was ligated at the previously occluded site, and the aortic root was perfused with a 1% solution of fluorescent particles (1-10 μm in diameter, Duke Scientific, Palo Alto, CA) in saline (1 ml, 3 minutes). As a result of this procedure, the portion of the left ventricle (LV) supplied by the previously occluded coronary artery (risk area) was not fluorescent under ultraviolet light, while the remainder of the left ventricle (LV) was stained dark blue. The heart was frozen for 20 minutes and then cut into 5-7 transverse sections. To delineate viable myocardial infarction, the heart sections were incubated in a 1% solution of triphenyltetrazolium chloride (TTC) in phosphate buffer (pH 7.4, 37°C) for 20 minutes. The sections were then fixed in 10% neutral buffered formalin and photographed after 24 hours. The boundaries of the infarct, ischemia-reperfusion (risk area), and non-ischemic areas were traced. The corresponding areas were measured by computer planimetry, and the percentage of infarct area to risk area was calculated based on these measurements.
[0153] The size of the risk area was similar in wild-type and GP-VI knockout mice (0.020 ± 0.004 cm 3 and 0.022 ± 0.005 cm 3 ), respectively). The infarct area (infarct size) in wild-type mice was on average 45 ± 18% of the risk area. The infarct area (infarct size) in GP-VI knockout mice was significantly smaller, averaging 22 ± 8% of the risk area. These data are summarized in Figure 8 .
[0154] 6. Reduced P-selectin expression in the myocardium of GP-VI knockout mice
[0155] Activation of platelets is determined by the expression of P-selectin (selectin) stored in platelet alpha-granules, which can be rapidly transferred to the platelet surface upon activation. The expression of P-selectin was detected by immunohistology.
[0156] In vivo mouse cardiac ischemia / reperfusion: Mouse cardiac ischemia and reperfusion were performed as described in the previous example. GP-VI gene knockout and wild-type mice underwent 30 minutes of left anterior descending coronary artery (LAD) occlusion, followed by 15 minutes of reperfusion. Fifteen minutes after LAD reperfusion, the hearts were removed, washed with DPBS, and then cut into two short-axis sections and immediately placed in 4% paraformaldehyde and 0.1 M phosphate buffer to fix the tissues. After 2 hours, the tissues were transferred to 25% sucrose overnight.
[0157] Immunofluorescence detection of P-selectin: On the second day, the cardiac tissues were cut into 20-μm cross-sections and allowed to dry for approximately 30 minutes. The sections on each slide were ringed with a PAP pen and allowed to dry for approximately 10 minutes. The slides were rinsed in 0.01 M PBS-0.1% Triton (PBST) and incubated with normal donkey serum (10% NDS, PBST) at room temperature for 30 - 60 minutes. P-selectin was detected using a rabbit anti-mouse P-selectin polyclonal antibody (Chemicon International), and visualization was performed using FITC anti-rabbit IgG (Jackson ImmunoResearch Laboratories).
[0158] Fluorescent images: Fluorescent images were obtained using a Zeiss confocal microscope (LSM510) or a conventional fluorescence microscope. The fluorescence excitation wavelength was 488 nm, and the detection wavelength was 540 nm. High levels of P-selectin were detected in the myocardium (endocardium and mid-myocardium) of wild-type mice after 30 minutes of ischemia and 15 minutes of reperfusion ( Figure 9 a). The expression of P-selectin in the myocardium of GP-VI gene knockout mice was significantly reduced. To quantify the expression level, the size of the area with strong green fluorescence within the ischemic region was measured. The data showed that the total area of the P-selectin expression region in the hearts of GP-VI gene knockout mice was significantly smaller compared to wild-type mice ( Figure 9 b).
[0159] 7. Vascular endothelial injury during reperfusion
[0160] In a normal heart with a healthy vascular system, the tight endothelium prevents collagen in the extracellular matrix of the vessel wall from coming into contact with circulating blood components. If endothelial cells are damaged and shed, such as during ischemia and reperfusion, subendothelial collagen may be exposed. Since GP-VI selectively binds to collagen, GPVI was used to study endothelial reperfusion injury in vivo. For this purpose, recombinant sGP-VI was labeled with FITC (sGP-VI-FITC), and sGP-VI-FITC was injected intravenously into mice. The injected sGP-VI-FITC binds to the collagen exposed due to endothelial injury. The level of sGP-VI-FITC binding to the exposed collagen can be histologically determined under a fluorescence microscope and provides a measure of endothelial injury.
[0161] Ten minutes (30 minutes) before the onset of myocardial ischemia, wild-type mice were injected with sGP-VI FITC (2 mg / kg). In some animals, reperfusion was performed after ischemia (15 minutes). In the hearts that received reperfusion, significant labeling of the vascular system was observed ( Figure 10 ), indicating significant damage to endothelial cells and subsequent exposure of collagen to circulating blood components. In contrast, in the hearts without reperfusion, sGP-VI FITC labeling of the vascular system was not observed ( Figure 10 ). These data indicate that reperfusion of ischemic heart tissue results in endothelial damage.
[0162] 8. Anti-GP-VI antibody has a protective effect on ischemic reperfused myocardium
[0163] Cynomolgus monkeys from China, weighing 2.0 - 2.5 kg, were used. One monkey selected as the experimental subject was fasted overnight and sedated with ketamine (10 mg / kg IM). In addition, atropine (0.05 mg / kg IM) was injected. An intravenous catheter was inserted into the leg vein. Sodium pentobarbital (10 - 15 mg / kg IV) was used for anesthesia, and additional doses were given throughout the experiment. The trachea was exposed through a midline incision in the neck, and an endotracheal tube was inserted. The animals were ventilated with a small animal ventilator and a 40% O 2 / 60% N 2 mixed gas. A carotid artery catheter was used to measure blood pressure and collect arterial blood samples. Then a left thoracotomy was performed in the fourth intercostal space to expose the heart. The left anterior descending coronary artery was occasionally visible but was usually obscured by the overlying fat. In the interventricular groove as close as possible to the origin of the artery, a 2-0 suture on a needle was blindly passed under the vascular bundle. The end of the suture was passed through a short polyethylene catheter to form a snare. When the snare was withdrawn for 10 seconds, cyanosis and cessation of contraction of the anterior wall of the heart were observed, and then when the snare was released, tissue congestion and recovery of contraction were confirmed, indicating successful snaring. A catheter was inserted into the left atrial appendage for microsphere injection. Additional ECG leads were used to measure heart rate and QRS morphology. The monkeys were heated to 38 degrees (rectal measurement) with a heating pad.
[0164] After completion of the surgical preparation and equilibration for at least 20 minutes, baseline heart rate, blood pressure, and ECG were recorded, and the coronary artery was occluded for 90 minutes. ECG, heart rate, and blood pressure were continuously monitored, recorded every 5 minutes for 10 minutes, and then every 10 minutes until the end of occlusion. At the end of the occlusion period, the snare was released and the coronary artery was reperfused. Again, electrocardiogram, heart rate, and blood pressure were recorded every minute for 5 minutes, 10 minutes, and then every 10 minutes until the end of the 4-hour reperfusion period. If ventricular fibrillation occurred, a defibrillator was used to convert the heart rhythm to sinus rhythm.
[0165] After 4 h of reperfusion, the heart was removed and suspended by the aortic root on a perfusion apparatus. Normal saline was perfused retrogradely to wash the blood from the coronary arteries and the heart, and then 2–9-μm green fluorescent microspheres (Microgenics Corp., Freemont, CA) were added to the perfusate after coronary artery occlusion was re-established. Thus, the fluorescent microspheres entered only the myocardium perfused by the non-occluded coronary artery, and the area at risk (or area at risk) was demarcated as the myocardial area that did not contain fluorescent microspheres. The heart was frozen on dry ice and then sectioned perpendicular to its long axis into 2–3-mm slices. The slices were incubated in 1% triphenyltetrazolium chloride (TTC) (GFSChemicals, Powell, OH), heated to 37 °C for 8–10 min, and then placed in 10% formalin to preserve the tissue and enhance the color contrast between the TTC-stained and non-stained tissues. Normal perfused tissue stained with TTC had intact NADH, stored brick red, while infarcted tissue that had released and cleared this cofactor was not stained, and myocardial hemorrhage was white or black. The slices were compressed between plastic plates spaced 2 mm apart. The size of the area at risk determined under ultraviolet illumination and the infarct area determined under white light illumination were traced on the plastic overlay. The area was measured by planimetry, and the volume was calculated by multiplying the area by 2 mm.
[0166] Control animals received coronary artery occlusion (90 min) and reperfusion (4 h) without anti-GP-VI antibody. In one of the anti-GP-VI antibody treatment groups, animals received two doses of recombinant fusion HSA-scFv(I) fragment (2 mg / kg each), the first dose being administered 10 min before ischemia and the second dose being administered before reperfusion. Since the immunofluorescence data (see Figure 8 - 10 ) supported a role for GP-VI during reperfusion, in the second anti-GP-VI antibody treatment group, animals received a single dose of antibody (2 mg / kg) before reperfusion. Myocardial infarction was analyzed by analysis of variance.
[0167] Infarct area was plotted against area at risk rather than percentage. This was because the infarct area / area at risk plot for control animals did not pass through the origin. When infarct area was compared with area at risk, the recombinant fusion scFv fragment (double or single dose) showed significant cardioprotection, with the regression line shifting to the right ( Figure 11 a). This shift indicated that for the same size of area at risk, the infarct area was smaller in antibody-treated monkeys. The degree of protection was similar in monkeys receiving double or single doses of antibody, which was consistent with the concept that platelet–collagen interaction induces reperfusion injury via GP-VI and that inhibition of this interaction provides cardioprotection.
[0168] To study whether the antibody inhibits platelet activation in these monkeys, blood samples were taken before and after dosing. Whole blood aggregometry (Chronolog Corporation, PA) was then used to measure collagen-induced platelet aggregation in vitro. The blood was diluted 1:1 (v / v) with saline and incubated in the aggregometer at 37 °C for 5 - 10 minutes before aggregation was initiated with collagen (0.5 μg / mL; Horm, Nycomed, Germany). Aggregation was monitored for 10 minutes as the electrical impedance of the blood sample increased (Aggrolink v 4.75, Chronolog).
[0169] Figure 11 Panel b shows representative measurements of collagen-induced whole blood platelet aggregation in blood samples taken before dosing (pre-dosing) and 4 hours after dosing (4 hrs post dosing). The data indicate that administration of the recombinant fusion HSA-scFv(I) fragment (2 mg / kg) to monkeys prior to reperfusion completely inhibited collagen-induced platelet aggregation, as measured in vitro. Administration at a dose of 0.4 mg / kg showed a similar inhibitory effect (data not shown).
[0170] Matters not covered by this invention are well-known techniques.
Claims
1. An anti-GP-VI single-chain antibody, characterized in that, the structure of the GP-VI single-chain antibody is VH-linker-VL. The anti-GP-VI single-chain antibody contains 3 heavy-chain variable region HVR-H1-3 sequences, and their amino acid sequences are respectively shown in SEQ ID NOs: 18-20. The anti-GP-VI single-chain antibody contains 3 light-chain variable region HVR-L1-3 sequences, and their amino acid sequences are respectively shown in SEQ ID NOs: 21-23.
2. A fusion protein, characterized in that, the fusion protein is composed of (a) an anti-GP-VI single-chain antibody, (b) human serum albumin and a linker fragment. The structure of the GP-VI single-chain antibody is VH-linker-VL. The anti-GP-VI single-chain antibody contains 3 heavy-chain variable region HVR-H1-3 sequences, and their amino acid sequences are respectively shown in SEQ ID NOs: 18-20. The anti-GP-VI single-chain antibody contains 3 light-chain variable region HVR-L1-3 sequences, and their amino acid sequences are respectively shown in SEQ ID NOs: 21-23; in the fusion protein, (a) and (b) are connected by a linker fragment; the linker fragment is selected from GSGGS; structurally, the C-terminus of (b) is connected to the N-terminus of (a) through a linker fragment.
3. A polynucleotide, characterized in that, the polynucleotide encodes the anti-GP-VI single-chain antibody according to claim 1 or the fusion protein according to claim 2.
4. A recombinant expression vector, characterized in that, it contains the polynucleotide according to claim 3.
5. A host cell, characterized in that, it contains the recombinant expression vector according to claim 4, or contains the polynucleotide according to claim 3 integrated into the genome of the host cell; or, the host cell expresses the anti-GP-VI single-chain antibody according to claim 1 or the fusion protein according to claim 2.
6. A method for producing an anti-human platelet collagen receptor GP-VI antibody or its antigen-binding fragment, characterized in that, it includes the steps of: (I) culturing the host cell according to claim 5 under conditions suitable for antibody production, thereby obtaining a culture containing the anti-human platelet collagen receptor GP-VI antibody or its antigen-binding fragment; and, (II) separating or recovering the anti-human platelet collagen receptor GP-VI antibody or its antigen-binding fragment from the culture.
7. A recombinant polypeptide conjugate, characterized in that, it includes the anti-GP-VI single-chain antibody according to claim 1 or the fusion protein according to claim 2, and a conjugate part, wherein the conjugate part is a detectable label.
8. A kit, characterized in that, it includes the anti-GP-VI single-chain antibody according to claim 1 or the fusion protein according to claim 2, and / or the recombinant polypeptide conjugate according to claim 7; the kit is used for detecting the presence or concentration of human platelet collagen receptor GP-VI in a sample.
9. A pharmaceutical composition, characterized in that, It includes the anti-GP-VI single-chain antibody described in claim 1, the fusion protein described in claim 2, or the recombinant polypeptide conjugate described in claim 7.
10. Use of the anti-GP-VI single-chain antibody described in claim 1, the fusion protein described in claim 2, the recombinant polypeptide conjugate described in claim 7, or the pharmaceutical composition described in claim 9 in the preparation of an anti-thrombotic product.
11. Use of the anti-GP-VI single-chain antibody described in claim 1, the fusion protein described in claim 2, the recombinant polypeptide conjugate described in claim 7, or the pharmaceutical composition described in claim 9 in the preparation of a product for treating ischemia-reperfusion injury.
Citation Information
Patent Citations
Novel antagonist antibodies and their Fab fragments against GPVI and uses thereof
CN102725309A
Methods for selecting antibodies that specifically bind glycosylated immune checkpoint proteins
CN109071636A