A high-throughput drug screening method against neuropathogenic viruses

Abstract

The application discloses a ssDNA aptamer for detecting a nerve necrosis virus, and the sequence of the ssDNA aptamer is tggttgtgggggagg tccgtcttgcagtgctggctacgcttcgggtagag or a derivative thereof. The ssDNA aptamer can be applied to detecting an anti-nerve necrosis virus or screening a drug for resisting a nerve necrosis virus infection. This is beneficial to rapidly detecting an anti-fish nerve necrosis virus and screening a drug for resisting a nerve necrosis virus infection, and lays a foundation for preventing and treating a nerve necrosis virus disease in seawater fish culture.

Description

Technical Field

[0001] This invention belongs to the field of biology, specifically relating to a high-throughput drug screening method for anti-neural necrosis virus. Background Technology

[0002] Under high-density, intensive aquaculture conditions, the frequent outbreaks of various aquaculture diseases in marine economic fish species have caused huge economic losses.

[0003] Nervous necrosis virus (NNV) is one of the most serious infectious pathogens in marine fish farming, characterized by rapid infection and high mortality, particularly affecting fry and juvenile fish during the seedling stage, where the mortality rate can reach 100%. Currently, there are no commercially available effective antiviral drugs for NNV, leaving marine fish farming in a predicament of drug scarcity. To further reduce the risk of NNV to my country's aquaculture industry, a highly efficient and rapid detection method is needed for the prevention and treatment of NNV in marine fish farming.

[0004] Systematic Evolution of Ligands by Exponential Enrichment technology (SELEX) is a biological library screening technique that uses libraries with capacities up to 10^65 ligands. 14 ~10 15 Random oligonucleotide libraries are used to obtain single-stranded oligonucleotides, or nucleic acid aptamers, that can specifically recognize target substances through multiple rounds of in vitro screening. Nucleic acid aptamers have many advantages, such as easy screening and acquisition, low cost, easy modification, high stability, and high specificity in recognizing and binding to target substances. They have now developed into a new type of detection and treatment tool that has attracted much attention, and they also show broad application prospects in the fields of biomedical basic research and disease diagnosis of major diseases. Summary of the Invention

[0005] The purpose of this invention is to provide a high-throughput drug screening method for anti-neural necrosis virus, so as to improve the detection level of neural necrosis virus and effectively improve the efficiency of researchers in preventing and treating neural necrosis virus.

[0006] According to a first aspect of the present invention, an ssDNA aptamer for detecting neuronecrosis virus is provided, named LYNV1, comprising the following sequence: a DNA sequence as shown in SEQ ID NO.1 and a derivative thereof, wherein the derivative is formed by phosphorylation, thiolation, methylation, amination or isotopization of at least one base on the DNA sequence shown in SEQ ID NO.1.

[0007] Preferably, the ssDNA aptamer is labeled with a marker, which is selected from one or more of luminescent substances, biotin, and enzymes.

[0008] Preferably, the marker is a luminescent substance selected from one or more of hydroxyfluorescein, fluorescein isothiocyanate, and carboxytetramethylrhodamine.

[0009] Preferably, the marker includes hydroxyfluorescein.

[0010] According to a second aspect of the present invention, the application of the above-described ssDNA nucleic acid aptamer in the detection of anti-neural necrosis virus is provided.

[0011] Preferably, the ssDNA aptamer is labeled with a marker; the sample to be tested is incubated with host cells, then the ssDNA aptamer is incubated with host cells, the host cells are washed, and finally the marker signal of the host cells is detected. The intensity of the marker signal is used to determine whether the sample to be tested contains anti-neural necrosis virus.

[0012] Preferably, the ssDNA aptamer is incubated with the host cell for 30 minutes.

[0013] The method for detecting anti-neurone necrosis virus provided in this protocol is simple to operate, convenient to use, and the complete detection process takes less than 1 hour, providing rapid results. In contrast, the existing detection technology RT-qPCR is cumbersome and takes up to 12 hours. This protocol only requires 1 / 12 of the detection time of RT-qPCR to obtain results, which has significant experimental value for researchers to efficiently detect neuronecrosis virus and carry out prevention and treatment.

[0014] According to a third aspect of the present invention, a kit for detecting anti-neural necrosis virus is provided, the kit comprising the above-described ssDNA nucleic acid aptamer.

[0015] According to a fourth aspect of the present invention, the use of the above-described ssDNA nucleic acid aptamer in screening drugs against neuronecrosis virus infection is provided.

[0016] Preferably, the ssDNA aptamer is labeled with a marker; the test drug is mixed with the neuronecrosis virus, the resulting mixture is incubated with host cells, then the ssDNA aptamer is incubated with the host cells, the host cells are washed, and finally the marker signal of the host cells is detected, and the anti-neuralnecrosis virus ability of the test drug is evaluated based on the intensity of the marker signal.

[0017] Compared with existing technologies, the advantages of this invention are:

[0018] ① The nucleic acid aptamer provided by this invention has high sensitivity to neuronecrosis virus and higher affinity and specificity compared with existing protein antibodies. It also has characteristics that protein antibodies do not have: no immunogenicity; short preparation cycle and good reproducibility; small molecular weight, which is convenient for in vitro chemical synthesis; easy labeling; easy to modify and replace different parts of the nucleic acid aptamer; and stable sequence, which is easy to transport and preserve.

[0019] ② The high-throughput rapid screening technology for anti-fish nerve necrosis virus drugs based on nucleic acid aptamers (LYNV1-AHTS) of this invention is simple, rapid, and time-efficient, providing accurate detection results. It can be combined with ELISA readers, flow cytometry, fluorescence microscopy, etc., to develop related rapid drug screening kits. This is of great significance for the rapid screening of anti-fish nerve necrosis virus drugs and their application in the prevention and treatment of nerve necrosis virus disease in marine fish aquaculture. Attached Figure Description

[0020] Figure 1 In this embodiment of the invention, a multifunctional microplate reader was used to detect the binding of LYNV1 labeled with hydroxyfluorescein (FAM) to cells infected with grouper nerve necrosis virus. The control group was the binding of LYNV1 labeled with hydroxyfluorescein (FAM) to cells not infected with grouper nerve necrosis virus.

[0021] Figure 2 This is a real-time quantitative PCR (RT-qPCR) test to detect the infection status of grouper nerve necrosis virus-infected cells. The control group consists of uninfected grouper nerve necrosis virus-infected cells.

[0022] Figure 3 In this embodiment of the invention, LYNV1-AHTS analysis was used to evaluate the antiviral activity of 11 medicinal plant components. Control group 1: the binding of LYNV1 labeled with hydroxyfluorescein (FAM) to uninfected grouper nerve necrosis virus cells; Control group 2: the binding of LYNV1 labeled with hydroxyfluorescein (FAM) to grouper nerve necrosis virus-infected cells.

[0023] Figure 4 The antiviral activity of 11 medicinal plant components was evaluated by real-time quantitative PCR analysis. Control group 1: GS cells not infected with NNV virus; Control group 2: GS cells infected with NNV virus. Detailed Implementation

[0024] To enable those skilled in the art to better understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments.

[0025] Grouper spleen cells (GS) are preserved in our laboratory and are available to the public from the applicant for use only to replicate the experiments of this invention.

[0026] The grouper nerve necrosis virus (NNV) (Guangxi strain, from hybrid grouper cultured in Guangxi) was isolated and identified from pathogenic microorganisms in grouper cultured in net cages in the nearshore waters of Guangxi. The virus is stored in our laboratory and is available to the public from the applicant. It is used solely for replicating experiments of this invention. In the following examples, the NNV virus was diluted to 10 g / L in cell culture medium before use. 6 TCID 50 / mL.

[0027] SEQ ID NO.1 labeled with hydroxyfluorescein (FAM):

[0028] 5'-FAM-TGGTTGTGGGGGAGGTCCGTCTTGCAGTGCTGGCTACGCTTCGGGTAGAG-3', the aptamer was synthesized by Shanghai Sangon Biotech.

[0029] Primers for the Major Capsid Protein (CP) gene of grouper nerve necrosis virus:

[0030] The forward primer (qCP-F) is 5'-GCACGCTTCTCTCACCTTCA-3', and the reverse primer (qCP-R) is 5'-AACGGCAACGGGAGCACTA-3'. The primers were synthesized by Shanghai Sangon Biotech.

[0031] Primers for the internal reference gene β-actin:

[0032] The forward primer (β-actin-F) is 5'-CAACTGACAACGATCACACCTTC-3', and the reverse primer (β-actin-R) is 5'-AAATGAGCCCCAGCCTTCTC-3'. The primers were synthesized by Shanghai Sangon Biotech.

[0033] Example 1. Monitoring NNV infection at different infection times using the nucleic acid aptamer LYNV1

[0034] GS cell culture: GS cells were introduced into 96-well plates at a rate of 8000 cells / well and cultured at 28°C for 18 hours.

[0035] Treatment Group ①: A portion of the GS cells cultured in this embodiment were taken and infected with NNV virus (MOI=0.4). Samples were taken at 0, 6, 12, 24, and 48 h after infection. The ssDNA aptamer FAM-LYNV1 labeled with hydroxyfluorescein (FAM) (FAM-LYNV1 was denatured at 90℃ for 5 min before use and then annealed on ice for 5 min) was added to the above GS cells at a dose of 200 nM. FAM-LYNV1 and the above GS cells were co-incubated on ice for 30 min. After incubation, the cells were gently washed three times with PBS and then collected.

[0036] Control group ①: A portion of the GS cells cultured in this embodiment were taken and placed in a static state. Samples were taken at 0, 6, 12, 24, and 48 h. The ssDNA aptamer FAM-LYNV1 labeled with hydroxyfluorescein (FAM) (FAM-LYNV1 was denatured at 90°C for 5 min before use and then annealed on ice for 5 min) was added to the above GS cells. The dosage of FAM-LYNV1 added was 200 nM. FAM-LYNV1 and the above GS cells were co-incubated on ice for 30 min. After incubation, the cells were gently washed three times with PBS and then collected.

[0037] Test method: The binding effect and specificity of FAM-LYNV1 on NNV-infected cells were analyzed using a multi-functional microplate reader.

[0038] Experimental results:

[0039] The detection results of this embodiment are as follows: Figure 1 As shown: When GS cells in treatment ① were incubated with FAM-LYNV1, the fluorescence intensity significantly increased with prolonged incubation time of GS cells and NNV virus. However, when GS cells in control treatment ① were incubated with FAM-LYNV1, the fluorescence intensity showed little change with prolonged resting time. This indicates that FAM-LYNV1 has high specificity for recognizing NNV-infected GS cells.

[0040] Example 2. RT-PCR monitoring of NNV infection at different infection times

[0041] GS cells were divided into 6.4 × 10⁻⁶ cells. 5 The cells were transferred to 12-well plates at a rate of 1 cell per well, incubated at 28°C for 18 hours, and then infected with NNV virus (MOI = 0.4).

[0042] Test method:

[0043] For the GS cells cultured in this embodiment, samples were taken at 0, 6, 12, 24 and 48 h of NNV virus infection time. RNA was extracted from the sampled cells and culture medium and reverse transcribed into cDNA. Using cDNA as a template and β-actin gene as an internal reference gene, the expression of the grouper nerve necrosis virus capsid protein CP gene was detected by RT-qPCR.

[0044] Experimental results:

[0045] The RT-qPCR detection results in this embodiment are as follows: Figure 2 As shown, no expression of the grouper nerve necrosis virus capsid protein CP gene was detected in GS cells sampled at 0h of NNV virus infection. With prolonged co-culture time of GS cells and NNV virus, the relative expression level of the grouper nerve necrosis virus capsid protein CP gene detected in GS cells showed a continuously increasing trend. These results are consistent with those shown in Example 1, thus confirming the reliability of using the nucleic acid aptamer LYNV1 to monitor NNV infection at different infection times in Example 1.

[0046] Example 3. LYNV1-AHTS technology analysis and evaluation of the antiviral activity of 11 medicinal plant components.

[0047] GS cell culture: GS cells were introduced into 96-well plates at a rate of 8000 cells / well and cultured at 28°C for 18 hours.

[0048] Treatment Group ②: The tested medicinal plant components and NNV virus (MOI = 0.4) were added to the GS cells cultured in this example. In this example, there were 11 kinds of tested medicinal plant components. The GS cell mixture obtained above was incubated at 28°C for 48 h. The ssDNA aptamer FAM-LYNV1 labeled with hydroxyfluorescein (FAM) (FAM-LYNV1 was denatured at 90°C for 5 min before use, and then annealed on ice for 5 min) was added to the above GS cell mixture at a dose of 200 nM. FAM-LYNV1 and GS cells were co-incubated on ice for 10 min. After incubation, the cells were gently washed three times with PBS and then collected.

[0049] Control treatment ② Group A: A portion of the GS cells cultured in this example were taken and incubated for 48 hours. The ssDNA aptamer FAM-LYNV1 labeled with hydroxyfluorescein (FAM) (FAM-LYNV1 was denatured at 90°C for 5 min before use, and then annealed on ice for 5 min) was added to the above GS cells at a dose of 200 nM. FAM-LYNV1 and the above GS cells were co-incubated on ice for 10 min. After incubation, the cells were gently washed 3 times with PBS and then collected.

[0050] Control treatment ② Group B: A portion of the GS cells cultured in this example were infected with NNV virus (MOI = 0.4) at a time of 48 h. The ssDNA aptamer FAM-LYNV1 (denoised at 90°C for 5 min and then annealed on ice for 5 min before use) labeled with fluorescein (FAM) was added to the GS cells at a dose of 200 nM. The cells were then co-incubated on ice for 10 min. After incubation, the cells were gently washed three times with PBS and collected.

[0051] Test method: The binding effect and specificity of FAM-LYNV1 on NNV-infected cells were analyzed using a multi-functional microplate reader.

[0052] Experimental results:

[0053] The detection results of this embodiment are as follows: Figure 3 As shown: Control treatment ②A, as the negative control group, had a fluorescence intensity below 5000. Control treatment ②B, as the positive control group, had a fluorescence intensity close to 35000, significantly higher than that of control treatment ②A. In treatment ② of this embodiment, the inhibitory effects of 11 tested medicinal plant components on NNV virus-infected GS cells were investigated, such as... Figure 3 As shown, compared with control group ②B, the introduction of these tested medicinal plant components significantly reduced the fluorescence intensity of the experimental system. This indicates that all 11 tested medicinal plant components can significantly inhibit NNV virus infection of GS cells.

[0054] Example 4. RT-qPCR technology analysis and evaluation of the antiviral activity of 11 medicinal plant components.

[0055] GS cells were divided into 6.4 × 10⁻⁶ cells. 5 The number of cells / well was transferred into a 12-well plate and incubated at 28°C for 18 hours.

[0056] Treatment group ③: The tested medicinal plant components and NNV virus (MOI=0.4) were added to the GS cells cultured in this example. In this example, there are 11 kinds of tested medicinal plant components. The GS cell mixture obtained above was incubated at 28°C for 48 hours.

[0057] Control treatment ③ Group A: Take a portion of the GS cells cultured in this example and let them stand for 48 hours.

[0058] Control treatment ③ Group B: A portion of the GS cells cultured in this example were infected with NNV virus (MOI=0.4) for 48 hours.

[0059] Test method:

[0060] RNA was collected from GS cells and culture medium from treatment group ③, control group ③A, and control group ③B, and reverse transcribed into cDNA. Using cDNA as a template and β-actin gene as an internal reference gene, the expression of the capsid protein CP gene of grouper nerve necrosis virus was detected by RT-qPCR.

[0061] Experimental results:

[0062] The RT-qPCR detection results in this embodiment are as follows: Figure 4 As shown: Control treatment ③A, as the negative control group, showed no detectable expression of the grouper nerve necrosis virus capsid protein CP gene in this control group; control treatment ③B, as the positive control group, showed a detection of grouper nerve necrosis virus capsid protein CP gene expression levels exceeding 60,000 in this control group; and in treatment ③ of this embodiment, the inhibitory effects of 11 tested medicinal plant components on NNV virus-infected GS cells were investigated, such as... Figure 4 As shown, compared with treatment group ③B, the introduction of these tested medicinal plant components significantly reduced the expression level of the grouper nerve necrosis virus capsid protein CP gene in the experimental system. The reduction magnitude of different drugs was similar to the change in fluorescence intensity in treatment group ② in Example 3, indicating that the RT-qPCR detection results are similar to those of LYNV1-AHTS. Furthermore, in terms of ease of operation, RT-qPCR is cumbersome and takes up to 12 hours, while LYNV1-AHTS is simple and takes less than 2 hours.

[0063] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. An ssDNA aptamer for detecting neuronecrosis virus, characterized in that, The nucleotide sequence of the ssDNA aptamer is shown in SEQ ID NO.

1.

2. The ssDNA aptamer for detecting neural necrosis virus as described in claim 1, characterized in that: The ssDNA aptamer is labeled with a marker, which is selected from one or more of luminescent substances, biotin, and enzymes.

3. The ssDNA aptamer for detecting neural necrosis virus as described in claim 2, characterized in that: The marker is a luminescent substance, which is selected from one or more of hydroxyfluorescein, fluorescein isothiocyanate, and carboxytetramethylrhodamine.

4. The ssDNA aptamer for detecting neural necrosis virus as described in claim 3, characterized in that: The marker is selected from hydroxyfluorescein.

5. The use of the ssDNA aptamer as described in any one of claims 1 to 4 in the detection of neuronecrosis virus, wherein the use does not include its use in disease diagnosis.

6. The application of the ssDNA aptamer as described in claim 5 in the detection of neural necrosis virus, characterized in that: The ssDNA aptamer is labeled with a marker; The sample to be tested is incubated with host cells, then the ssDNA aptamer is incubated with the host cells, the host cells are washed, and finally the host cells are subjected to the labeling signal detection of the marker. The intensity of the labeling signal is used to determine whether the sample to be tested contains neuronecrosis virus.

7. A kit for detecting nerve necrosis virus, characterized in that: The kit includes the ssDNA nucleic acid aptamer as described in any one of claims 1 to 4.

Images