Sulfonylurea herbicide-resistant rapeseed gene, protein, primer set, recombinant expression vector, engineered bacteria and their applications
By introducing mutant genes BnALS1m1, BnALS1m2, BnALS3m1 and BnALS3m2 into rapeseed, the problem of rapeseed's insufficient resistance to sulfonylurea herbicides was solved, rapeseed was given high tolerance and resistance to herbicides, and efficient breeding and yield increase were promoted.
Patent Information
- Application Number
- CN202310116521.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-09
- Publication Date
- 2025-09-12
- Estimated Expiration
- 2043-02-09
AI Technical Summary
Existing technologies make it difficult to quickly and effectively screen rapeseed mutants that are resistant to sulfonylurea herbicides, resulting in difficulties in improving rapeseed's resistance to these herbicides, affecting crop yield and cost control.
The invention provides rapeseed genes BnALS1m1, BnALS1m2, BnALS3m1 and BnALS3m2 that are resistant to sulfonylurea herbicides. The tolerance of rapeseed to sulfonylurea herbicides is improved by nucleotide sequence mutation. These genes are expressed in rapeseed using primer sets and recombinant expression vectors to enhance its resistance.
By expressing mutant genes in rapeseed, the tolerance and resistance of rapeseed to sulfonylurea herbicides are improved, which assists in breeding new crop varieties with high resistance to sulfonylurea herbicides, reduces the number of drug applications, reduces prevention and control costs, and increases yields.
Smart Images

Figure CN115992155B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular relates to a sulfonylurea herbicide-resistant rapeseed gene, protein, primer set, recombinant expression vector, engineered bacteria and applications thereof. Background Art
[0002] Weeds in fields compete with crops for water, nutrients, and light, impacting crop growth and reducing yield and quality. They also increase labor and costs for field management. In modern agricultural production, relying on chemical herbicides for weed control is a common practice. Rapeseed is my country's largest oilseed crop, with a cultivated area remaining stable at around 100 million mu (approximately 166 acres), producing approximately 14 million tons. Weed damage can typically reduce rapeseed yield by 15%, with severe losses exceeding 50%. Weeds in rapeseed fields are typically grasses and broadleaf weeds. Because rapeseed is a broadleaf plant, broadleaf weeds pose a key bottleneck in weed control. Bensulfuron-methyl, a broadleaf herbicide, is effective against weeds in wheat fields. Breeding rapeseed varieties resistant to bensulfuron-methyl and combining bensulfuron-methyl with existing monocotyledon herbicides for rapeseed fields offers a new approach for effective weed control. Therefore, cultivating and promoting rapeseed varieties resistant to bensulfuron-methyl herbicide can effectively control broadleaf weed pests, reduce the number of drug applications, lower prevention and control costs, increase rapeseed yields, and increase benefits.
[0003] Bensulfuron-methyl is a sulfonylurea selective systemic herbicide developed by DuPont in the United States. Since its official registration in my country in 1988, it has been widely used to control broadleaf weeds in wheat fields. Bensulfuron-methyl is a selective systemic herbicide that is absorbed by weed roots and leaves and transported throughout the plant. It inhibits the activity of acetolactate synthase (ALS), thereby affecting the biosynthesis of branched-chain amino acids (such as leucine, isoleucine, and valine). Damaged plants exhibit necrosis of growing points, chlorosis of leaf veins, severe growth inhibition, dwarfing, and ultimately, plant death. Sensitive weeds immediately cease growth after absorption and die within 1-3 weeks. In my country, a 75% bensulfuron-methyl dosage of 0.9-1.4 g (ai) per acre is used, which translates to an effective concentration of approximately 20-30 mg / L. Acetolactate synthase (ALS) catalyzes the first step in the biosynthesis of branched amino acids such as valine, leucine, and isoleucine. Herbicides developed with ALS as their target enzyme inhibit the activity of the ALS enzyme in plant cells, hindering the biosynthesis of branched-chain amino acids and, consequently, suppressing plant cell division and growth. In 1961, DuPont first reported the inhibitory effect of pyrimidine compounds on the ALS enzyme in plants and successfully developed the first sulfonylurea herbicide, chlorsulfuron, in 1982. Since then, numerous international chemical companies have developed herbicides such as imidazolinones, sulfonamides, and pyrimidine salicylates targeting ALS. Herbicides developed with ALS as their target enzyme offer advantages such as strong selectivity, high activity, and low toxicity to mammals.
[0004] Treating seeds with chemical mutagenesis or other methods can induce base mutations in the plant's ALS gene, resulting in amino acid changes that render it insensitive to herbicides. To date, amino acid substitutions at eight sites in the ALS gene (Ala122, Pro197, Ala205, Asp376, Arg377, Trp574, Ser653, and Gly654, where the values are based on the amino acid sequence of the ALS protein in the model plant Arabidopsis thaliana) have been found to confer resistance to the corresponding herbicides. For example, replacing alanine with valine at site 122 of the ALS enzyme protein confers resistance to imidazolinone herbicides; replacing proline at site 197 with histidine, threonine, arginine, leucine, isoleucine, serine, alanine, or glutamic acid confers resistance to sulfonylurea herbicides.
[0005] Currently, few ALS gene mutation sites have been reported in rapeseed, with only three sites showing amino acid substitutions: Pro197, Trp574, and Ser653. These substitutions were obtained using chemical mutagens. However, using chemical mutagens to screen rapeseed seeds for herbicide-resistant mutants requires screening large quantities of seeds, which is time-consuming and labor-intensive. Although in vitro mutagenesis of genes and verification of the effectiveness of the mutation sites using transgenic methods is currently a rapid method for screening mutation sites and obtaining mutant genes, obtaining effective mutation sites and genes is subject to contingency and uncertainty, making them difficult to obtain. Furthermore, there are currently no reports of ALS mutant genes in rapeseed that are resistant to sulfonylurea herbicides obtained through in vitro mutagenesis. Summary of the Invention
[0006] The present invention aims to provide a sulfonylurea herbicide-resistant rapeseed gene, protein, primer set, recombinant expression vector, engineered bacteria and their applications. The sulfonylurea herbicide-resistant rapeseed gene can improve the tolerance and resistance of crops to sulfonylurea herbicides and assist in the breeding of new varieties of crops with high sulfonylurea herbicide resistance.
[0007] The present invention provides a sulfonylurea herbicide-resistant rapeseed gene, which comprises one or more of BnALS1m1, BnALS1m2, BnALS3m1 and BnALS3m2; the nucleotide sequences of BnALS1m1, BnALS1m2, BnALS3m1 and BnALS3m2 are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, respectively.
[0008] The present invention also provides a sulfonylurea herbicide-resistant rapeseed protein encoded by the sulfonylurea herbicide-resistant rapeseed gene described in the above technical solution, wherein the sulfonylurea herbicide-resistant rapeseed protein includes one or more of BnALS1m1 protein, BnALS1m2 protein, BnALS3m1 protein and BnALS3m2 protein, and the amino acid sequences of the BnALS1m1 protein, BnALS1m2 protein, BnALS3m1 protein and BnALS3m2 protein are shown as SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, respectively.
[0009] The present invention also provides a primer set for cloning the sulfonylurea herbicide-resistant rapeseed gene described in the above technical solution, comprising one or more of a first primer set for cloning the BnALS1m1, a second primer set for cloning the BnALS1m2, a third primer set for cloning the BnALS3m1, and a fourth primer set for cloning the BnALS3m2;
[0010] The first primer set includes: ALS primers for amplifying the ALS1 gene of Brassica napus and p3301-ALS-F, ALS-RM1, ALS-FM1 and p3301-ALS-R for amplifying BnALS1m1;
[0011] The second primer set includes: ALS primers for amplifying the ALS1 gene of Brassica napus and p3301-ALS-F, ALS-RM2, ALS-FM2 and p3301-ALS-R for amplifying BnALS1m2;
[0012] The third primer set includes: ALS primers for amplifying the ALS3 gene of Brassica napus and p3301-ALS-F, ALS-RM1, ALS-FM1 and p3301-ALS-R for amplifying BnALS3m1;
[0013] The fourth primer set includes: ALS primers for amplifying the ALS3 gene of Brassica napus and p3301-ALS-F, ALS-RM2, ALS-FM2 and p3301-ALS-R for amplifying BnALS3m2;
[0014] The nucleotide sequences of the forward primer ALS-F and the reverse primer ALS-R of the ALS primer are shown in SEQ ID NO.9 and SEQ ID NO.10, respectively;
[0015] The nucleotide sequences of p3301-ALS-F and p3301-ALS-R are shown in SEQ ID NO.11 and SEQ ID NO.12, respectively;
[0016] The nucleotide sequences of ALS-FM1 and ALS-RM1 are shown in SEQ ID NO.13 and SEQ ID NO.14, respectively;
[0017] The nucleotide sequences of ALS-FM2 and ALS-RM2 are shown in SEQ ID NO.15 and SEQ ID NO.16, respectively.
[0018] The present invention also provides a recombinant expression vector, comprising the sulfonylurea herbicide-resistant rapeseed gene described in the above technical solution or the sulfonylurea herbicide-resistant rapeseed gene cloned using the primer set described in the above technical solution and an initial vector.
[0019] Preferably, the initial vector includes the plant binary expression vector Pcambia3301.
[0020] Preferably, the sulfonylurea herbicide-resistant rapeseed gene described in the above technical solution or the sulfonylurea herbicide-resistant rapeseed gene cloned using the primer set described in the above technical solution is inserted between Bgl II and Pml I of the plant binary expression vector Pcambia3301.
[0021] The present invention also provides an engineered bacterium, comprising the sulfonylurea herbicide-resistant rapeseed gene described in the above technical solution, the sulfonylurea herbicide-resistant rapeseed gene cloned using the primer set described in the above technical solution, or the recombinant expression vector described in the above technical solution and Agrobacterium.
[0022] The present invention also provides the use of the sulfonylurea herbicide-resistant rapeseed gene, sulfonylurea herbicide-resistant rapeseed protein, primer set, recombinant expression vector or engineered bacteria described in the above technical solution in improving the resistance of crops to sulfonylurea herbicides and / or in breeding crops with high sulfonylurea herbicide resistance.
[0023] Preferably, the crop includes rapeseed, wheat or corn.
[0024] The present invention also provides a method for cultivating crops with high resistance to sulfonylurea herbicides, comprising: increasing the expression level of the sulfonylurea herbicide-resistant rapeseed protein described in the above technical solution in the target plant.
[0025] Beneficial effects:
[0026] The present invention provides a sulfonylurea herbicide-resistant rapeseed gene, comprising one or more of BnALS1m1, BnALS1m2, BnALS3m1, and BnALS3m2; the nucleotide sequences of BnALS1m1, BnALS1m2, BnALS3m1, and BnALS3m2 are shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, and SEQ ID NO. 4, respectively. Compared with the ALS1 gene of Brassica napus, the 544th to 546th bases of the nucleotide sequence of BnALS1m1 are mutated from CCT to AAC, resulting in a mutation of the 182nd amino acid of the encoded protein from proline (Pro) to asparagine (Asn); the 544th to 546th bases of the nucleotide sequence of BnALS1m2 are mutated from CCT to GAA, resulting in a mutation of the 182nd amino acid of the encoded protein from proline (Pro) to glutamic acid (Glu). Compared to the ALS3 gene of Brassica napus, the bases 535 to 537 of the BnALS3m1 nucleotide sequence mutate from CCT to AAC, resulting in a mutation of the amino acid 179 of the encoded protein from proline (Pro) to asparagine (Asn); the bases 535 to 537 of the BnALS3m2 nucleotide sequence mutate from CCT to GAA, resulting in a mutation of the amino acid 179 of the encoded protein from proline (Pro) to glutamic acid (Glu). Transgenic expression of the sulfonylurea herbicide-resistant rapeseed gene of the present invention in crops can improve the tolerance and resistance of crops to sulfonylurea herbicides, thereby assisting in the breeding of new crop varieties with high resistance to sulfonylurea herbicides. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.
[0028] Figure 1 Schematic diagram of the mutation sites of BnALS1m1 and BnALS1m2 as well as BnALS1m1 protein and BnALS1m2 protein of the present invention;
[0029] Figure 2 Schematic diagram of the mutation sites of BnALS3m1 and BnALS3m2 as well as BnALS3m1 protein and BnALS3m2 protein of the present invention;
[0030] Figure 3 These are agarose gel amplified bands of the ALS1 gene and the ALS3 gene in Example 1 of the present invention;
[0031] Figure 4These are the upstream and downstream amplified bands of BnALS1m1 and BnALS3m1 in Example 1 of the present invention;
[0032] Figure 5 These are the upstream and downstream amplified bands of BnALS1m2 and BnALS3m2 in Example 1 of the present invention;
[0033] Figure 6 Schematic diagram of the construction of the plant expression vector in Example 1 of the present invention;
[0034] Figures 7-10 The PCR identification results of BnALS1m1-OE, BnALS1m2-OE, BnALS3m1-OE and BnALS3m2-OE rapeseed plants in Example 1 of the present invention are shown in order;
[0035] Figure 11 The results of the identification of herbicide resistance of the transgenic rapeseed lines in Example 1 of the present invention are as follows;
[0036] Figure 12 The results of in vitro ALS enzyme activity determination in the transgenic BnALS1m1 rapeseed line and the transgenic BnALS3m1 rapeseed line in Example 1 of the present invention are as follows;
[0037] Figure 13 These are the results of in vitro ALS enzyme activity assays in the transgenic BnALS1m2 rapeseed line and the transgenic BnALS3m2 rapeseed line in Example 1 of the present invention. DETAILED DESCRIPTION
[0038] The present invention provides a sulfonylurea herbicide-resistant rapeseed gene, which comprises one or more of BnALS1m1, BnALS1m2, BnALS3m1 and BnALS3m2; the nucleotide sequences of BnALS1m1, BnALS1m2, BnALS3m1 and BnALS3m2 are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, respectively.
[0039] The sulfonylurea herbicide-resistant rapeseed gene of the present invention preferably includes BnALS1m1, BnALS1m2, BnALS3m1 or BnALS3m2.
[0040] Figure 1 The accession number of the Brassica napus ALS1 gene of the present invention in the BnTIR (http: / / yanglab.hzau.edu.cn / BnTIR) database is BnaC01T0284600ZS.
[0041] Figure 1 shown.
[0042] Figure 2 The accession number of the Brassica napus ALS3 gene of the present invention in the BnTIR database is BnaA01T0223300ZS.
[0043] Figure 2 shown.
[0044] The present invention also provides a primer set for cloning the sulfonylurea herbicide-resistant rapeseed gene described in the above technical solution, comprising one or more of a first primer set for cloning the BnALS1m1, a second primer set for cloning the BnALS1m2, a third primer set for cloning the BnALS3m1, and a fourth primer set for cloning the BnALS3m2;
[0045] The first primer set includes: ALS primers for amplifying the ALS1 gene of Brassica napus and p3301-ALS-F, ALS-RM1, ALS-FM1 and p3301-ALS-R for amplifying BnALS1m1;
[0046] The second primer set includes: ALS primers for amplifying the ALS1 gene of Brassica napus and p3301-ALS-F, ALS-RM2, ALS-FM2 and p3301-ALS-R for amplifying BnALS1m2;
[0047] The third primer set includes: ALS primers for amplifying the ALS3 gene of Brassica napus and p3301-ALS-F, ALS-RM1, ALS-FM1 and p3301-ALS-R for amplifying BnALS3m1;
[0048] The fourth primer set includes: ALS primers for amplifying the ALS3 gene of Brassica napus and p3301-ALS-F, ALS-RM2, ALS-FM2 and p3301-ALS-R for amplifying BnALS3m2;
[0049] The nucleotide sequences of the forward primer ALS-F and the reverse primer ALS-R of the ALS primer are shown in SEQ ID NO.9 and SEQ ID NO.10, respectively;
[0050] The nucleotide sequences of p3301-ALS-F and p3301-ALS-R are shown in SEQ ID NO.11 and SEQ ID NO.12, respectively;
[0051] The nucleotide sequences of ALS-FM1 and ALS-RM1 are shown in SEQ ID NO.13 and SEQ ID NO.14, respectively;
[0052] The nucleotide sequences of ALS-FM2 and ALS-RM2 are shown in SEQ ID NO.15 and SEQ ID NO.16, respectively.
[0053] The primer set of the present invention preferably includes a first primer set for cloning the BnALS1m1, a second primer set for cloning the BnALS1m2, a third primer set for cloning the BnALS3m1, or a fourth primer set for cloning the BnALS3m2.
[0054] In the present invention, the nucleotide sequences shown in SEQ ID NO.9 to 16 are specifically as follows from 5' to 3': ALS-F: ATGG CGGCGGCAACATCGTCT (SEQ ID NO.9); ALS-R: TCAGTACTTAGTGCGACCAT (SEQ ID NO.10); p3301-ALS-F: GGGGGACTCTTGACCATGGTAATGGCGGCGGCAACATCGTCT (SEQ ID NO.11); p3301-ALS-R: GTCACCTGTAATTCACACGTGTCAGTACTTAGTGCGACCAT (SEQ ID NO.12); ALS-FM1: CAGGTCAACCGCCGGATGAT (SEQ ID NO.13); ALS-FM2: ATCAT CCGGCGGTTGACCTG (SEQ ID NO.14); ALS-FM3: CAGGTCGAACGCCGGATGAT (SEQ ID NO.15); ALS-RM2: ATCATCCGGCGTTCGACCTG (SEQ ID NO.16).
[0055] The present invention also preferably provides a method for cloning the sulfonylurea herbicide-resistant rapeseed gene using the primer set, which is illustrated by cloning BnAL S1m1 as an example, comprising the following steps:
[0056] The cDNA of Zhongshuang No. 11 rapeseed was used as a template and PCR amplified using ALS primers to obtain a PCR amplification product.
[0057] The PCR amplification product was cloned into the pClone007 vector to obtain the pClone007-ALS1 plasmid cloned with the ALS1 gene;
[0058] Using the pClone007-ALS1 plasmid cloned with the ALS1 gene as a template, p3301-ALS-F as an upstream primer and ALS-RM1 as a downstream primer, overlapping PCR amplification was performed to obtain the upstream fragment of BnALS1m1; using ALS-FM1 as an upstream primer and p3301-ALS-R as a downstream primer, overlapping PCR was performed to obtain the downstream fragment of BnALS1m1;
[0059] The upstream fragment and the downstream fragment were connected to obtain the BnALS1m1.
[0060] The present invention preferably uses the cDNA of Zhongshuang No. 11 rapeseed as a template and uses ALS primers to perform PCR amplification on the cDNA to obtain a PCR amplification product. The present invention does not specifically limit the system and procedure of the PCR amplification, and any system and procedure capable of performing the PCR amplification falls within the scope of protection of the present invention.
[0061] After obtaining the PCR amplification product, the present invention preferably clones the PCR amplification product into the pClone007 vector to obtain a pClone007-ALS1 plasmid containing the ALS1 gene. The present invention preferably clones the PCR amplification product into the pClone007 vector. The present invention does not particularly limit the cloning process; conventional cloning methods in the art can be used. The pClone007 vector of the present invention is preferably purchased from Beijing Qingke Biotechnology Co., Ltd. The pClone007 vector utilizes Vaccinia topoisomerase I to enable instant ligation reactions and is compatible with both TA cloning and blunt-end cloning.
[0062] After obtaining the pClone007-ALS1 plasmid containing the ALS1 gene, the present invention preferably uses the pClone007-ALS1 plasmid containing the ALS1 gene as a template, p3301-ALS-F as a forward primer, and ALS-RM1 as a reverse primer to perform overlapping PCR amplification to obtain the upstream fragment of BnALS1m1; and uses ALS-FM1 as a forward primer and p3301-ALS-R as a reverse primer to perform overlapping PCR amplification to obtain the downstream fragment of BnALS1m1. The present invention does not specifically limit the system and procedure for the overlapping PCR; any system and procedure capable of performing the overlapping PCR amplification falls within the scope of the present invention.
[0063] After obtaining the upstream and downstream fragments of BnALS1m1, the present invention preferably ligates the upstream and downstream fragments to obtain BnALS1m1. The present invention preferably utilizes one-step cloning for the ligation. The present invention does not particularly limit the specific steps of the one-step cloning method; any reagent or kit capable of one-step cloning in the art may be used. For example, the ClonExpress MultiS One Step Cloning Kit purchased from Novozymes is used in the Examples.
[0064] The method for cloning the BnALS1m2 of the present invention is preferably the same as the method for cloning the BnALS1m1, the difference being that when performing the overlapping PCR amplification, the forward primer and reverse primer for amplifying the upstream fragment of the BnALS1m2 are p3301-ALS-F and ALS-RM2, respectively; the forward primer and reverse primer for amplifying the downstream fragment of the BnALS1m2 are ALS-FM2 and p3301-AL SR, respectively.
[0065] The method for cloning the BnALS3m1 of the present invention is preferably the same as the method for cloning the BnALS1m1, with the difference being that the pClone007-ALS3 plasmid cloned with the ALS3 gene is used as a template during the overlapping PCR amplification.
[0066] The method for cloning the BnALS3m2 of the present invention is preferably the same as the method for cloning the BnALS1m2, except that the pClone007-ALS3 plasmid cloned with the ALS3 gene is used as a template during the overlapping PCR amplification.
[0067] The present invention also provides a recombinant expression vector comprising the sulfonylurea herbicide-resistant rapeseed gene described in the above technical solution, or the sulfonylurea herbicide-resistant rapeseed gene cloned using the primer set described in the above technical solution, and an initial vector. The initial vector of the present invention preferably comprises the plant binary expression vector Pcambia3301. The present invention preferably inserts the sulfonylurea herbicide-resistant rapeseed gene between Bgl II and Pml I of the plant binary expression vector Pcambia3301. The present invention does not specifically limit the construction process of the recombinant expression vector; conventional construction processes in the art can be used.
[0068] The present invention also provides an engineered bacterium comprising the sulfonylurea herbicide-resistant rapeseed gene described in the above technical solution, the sulfonylurea herbicide-resistant rapeseed gene cloned using the primer set described in the above technical solution, or the recombinant expression vector described in the above technical solution, and Agrobacterium. The Agrobacterium described in the present invention preferably comprises Agrobacterium tumefaciens GV3101 or LBA4404, more preferably Agrobacterium tumefaciens GV3101. The engineered bacterium is obtained by transferring the recombinant expression vector into the Agrobacterium. The present invention does not specifically limit the transfer process; conventional transfer processes and steps described in the present invention may be used.
[0069] The present invention also provides the use of the sulfonylurea herbicide-resistant rapeseed gene, sulfonylurea herbicide-resistant rapeseed protein, primer set, recombinant expression vector, or engineered bacteria described in the above technical solution for improving crop resistance to sulfonylurea herbicides and / or breeding crops with high sulfonylurea herbicide resistance. The crops described in the present invention preferably include rapeseed, wheat, or corn, and more preferably rapeseed. The present invention enhances crop tolerance to sulfonylurea herbicides by increasing the expression of the sulfonylurea herbicide-resistant rapeseed gene and the expression of the sulfonylurea herbicide-resistant rapeseed protein in the crop.
[0070] The present invention also provides a method for cultivating crops with high resistance to sulfonylurea herbicides, comprising: increasing the expression level of the sulfonylurea herbicide-resistant rapeseed protein described in the above technical solution in the target plant.
[0071] In the present invention, the method for increasing the expression level of the sulfonylurea herbicide-resistant rapeseed protein in the target plant preferably comprises: promoting the expression of the sulfonylurea herbicide-resistant rapeseed gene described in the above technical solution or the sulfonylurea herbicide-resistant rapeseed gene cloned using the primer set described in the above technical solution in the target crop. The method of promoting the expression of the sulfonylurea herbicide-resistant rapeseed gene in the target crop of the present invention preferably comprises introducing the sulfonylurea herbicide-resistant rapeseed gene or the recombinant expression vector described in the above technical solution into the target crop. The sulfonylurea herbicide-resistant rapeseed gene of the present invention is preferably transferred into the target crop in the form of the recombinant expression vector, so that the sulfonylurea herbicide-resistant rapeseed gene is expressed in the target crop; the method of transfer preferably comprises genetic transformation, and the specific steps of the genetic transformation are not particularly limited, and conventional steps in the art can be used.
[0072] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0073] Example 1
[0074] 1. Cloning of ALS1 and ALS3 genes in Brassica napus
[0075] Using the Zhongshuang 11 rapeseed cDNA library as a template, primers ALS-F and ALS-R and high-fidelity DNA polymerase were used to amplify the Brassica napus ALS gene. The amplification system is shown in Table 1:
[0076] Table 1 Amplification system of ALS gene in Brassica napus
[0077] Components concentration Volume (μL) 5×SF Buffer Contains 10mM MgSO4 10 dNTP Mix The concentrations of dATP, dGTP, dCTP, and dTTP were all 10 mM 1 ALS-F 10 μM 2 ALS-R 10 μM 2 cDNA - 2 Phanta Super-Fidelity DNA Polymerase - 1 <![CDATA[ddH2O]]> - 32
[0078] The amplification program was as follows: 95°C, 3 min; 95°C, 30 sec, 58°C, 30 sec, 72°C, 1 min, 35 cycles; 72°C, 10 min. The PCR amplification product was detected by agarose gel electrophoresis, and the band size was approximately 2000 bp ( Figure 3 ).
[0079] The PCR amplification product was purified by gel recovery and cloned into the pClone007 vector purchased from Qingke Biotechnology. The specific steps were as follows: 2 μL of 5× pClone007 Versatile Simple Vector Mix, 1 μL of PCR purified product (100 ng / μL), and ddH2O was added to 10 μL. The 2 kb PCR amplification product was ligated with pClone007 and then transformed into Trelief. TM 5αChemically Competent Cell.
[0080] Transformed single clones were identified by colony PCR using primers ALS1-WF / M13R and ALS3-WF / M13R. Agarose gel electrophoresis was then performed to distinguish the ALS1 and ALS3 genes. Colonies identified as positive by colony PCR were inoculated with the remaining bacterial suspension into liquid LB medium containing appropriate antibiotics and cultured overnight for next-generation sequencing. Sequencing confirmed that the pClone007-ALS1 plasmid harboring the ALS1 gene and the pClone007-ALS3 plasmid harboring the ALS3 gene were obtained. The nucleotide sequence of primer M13R is 5'-CAGGAAACAGCTATGACC-3' (SEQ ID NO. 17).
[0081] 2. Overlap PCR introduces base mutations
[0082] 1) Using the pClone007-ALS1 plasmid containing the ALS1 gene as a template, primers p3301-ALS-F / ALS-RM1 and ALS-FM1 / p3301-ALS-R were used to amplify the ALS1m1 upstream fragment (557 bp) and ALS1m1 downstream fragment (1431 bp), respectively.
[0083] 2) Using the pClone007-ALS3 plasmid containing the ALS3 gene as a template, primers p3301-ALS-F / ALS-RM1 and ALS-FM1 / p3301-ALS-R were used to amplify the ALS3m1 upstream fragment (548 bp) and ALS3m1 downstream fragment (1431 bp), respectively.
[0084] 3) Using the pClone007-ALS1 plasmid containing the ALS1 gene as a template, primers p3301-ALS-F / ALS-RM2 and ALS-FM2 / p3301-ALS-R were used to amplify the ALS1m2 upstream fragment (557 bp) and ALS1m2 downstream fragment (1431 bp), respectively.
[0085] 4) Using the pClone007-ALS3 plasmid containing the ALS3 gene as a template, primers p3301-ALS-F / ALS-RM2 and ALS-FM2 / p3301-ALS-R were used to amplify the ALS3m2 upstream fragment (548 bp) and ALS3m2 downstream fragment (1431 bp), respectively.
[0086] The amplification system and amplification procedure are the same as step 1. The PCR amplification product is recovered and purified by gel recovery. The results are as follows Figures 4-5 shown.
[0087] 3. Construction of plant expression vector
[0088] The plant binary expression vector Pcambia3301 was selected. Its prokaryotic resistance is kanamycin resistance, the selection marker is phosphinothricin (Bar), and the reporter gene GUS is used. The reporter gene GUS sequence is removed and the vector is linearized using the restriction endonucleases Bgl II and PmL I on the vector. The vector and upstream and downstream fragments are recombined using the ClonExpress MμLtiS One Step Cloning Kit (Novozyme). Figure 6 As shown, the specific recombination reaction is as follows: prepare the reaction system on ice: linearized vector (100 ng / μL) 1 μL, upstream fragment (30 ng / μL) 1 μL, downstream fragment (50 ng / μL) 1 μL, 5× CE MμLtiS Buffer 2 μL, Exnase MμLtiS 1 μL, and add ddH2O to 10 μL; use a pipette to mix gently (do not vortex to mix), briefly centrifuge to collect the reaction solution at the bottom of the tube; react at 37°C for 30 min, then cool on ice.
[0089] The recombinant product was transformed into Escherichia coli DH5α, and several clones on the recombination reaction transformation plate were picked for colony PCR identification. The ALS1 mutant gene was amplified and identified using the amplification primers ALS1-WF / NOS, and the ALS3 mutant gene was amplified and identified using the amplification primers ALS3-WF / NOS. The primer sequences of ALS1-WF, ALS3-WF, and NOS were: ALS1-WF: 5'-TGTCGCACCTCCTTCCCCTG-3' (SEQ ID NO. 18), ALS3-WF: 5'-CCGTCAATGTCGCACCTGAA-3' (SEQ ID NO. 19), and NOS: 5'-GATAATCATCGCAAGACCGG-3' (SEQ ID NO. 20), respectively.
[0090] Identification system: 10 μL of 2× Es Taq MasterMix (Dye), 0.8 μL of Forward Primer (10 μM), 0.8 μL of Reverse Primer (10 μM), 1 μL of DNA template, and ddH2O to 20 μL. Amplification program: 95°C for 4 min; 35 cycles of 95°C for 30 sec, 58°C for 30 sec, and 72°C for 1 min; 72°C for 5 min. Colonies identified as positive by colony PCR can be inoculated into liquid LB medium containing appropriate antibiotics and cultured overnight for next-generation sequencing. After sequencing, the resulting ALS1 mutant genes were named BnALS1m1 and BnALS1m2, and their binary expression vectors were named p3301-BnALS1m1 and p3301-BnALS1m2. The ALS3 mutant genes were named BnALS3m1 and BnALS3m2, and their binary expression vectors were named p3301-BnALS3m1 and p3301-BnALS3m2. The target plasmids were extracted and transformed into Agrobacterium tumefaciens GV3101.
[0091] 4. Rapeseed transformation, screening and identification
[0092] 1) Agrobacterium transformation of rapeseed
[0093] Zhongshuang No. 11 seeds were soaked in 70% by volume ethanol solution for 1 minute and mercuric chloride (HgCl2) for 13-15 minutes, washed 5 times with ddH2O, and then spread on MS culture medium (pH 5.8) with an agar concentration of 0.8% to obtain a sowing culture medium; the sowing culture medium was cultured in the dark at 24°C for 5-6 days.
[0094] Agrobacterium tumefaciens GV3101 containing BnALS1m1, BnALS1m2, BnALS3m1 and BnALS3m2, respectively, was inoculated on solid culture medium LB. Two days later, a single colony was picked and cultured in 50 mL of LB liquid medium (containing 25 mg / L rifampicin, 50 mg / L gentamicin and 50 mg / L kanamycin).
[0095] Use sterile forceps and razor blades to cut the hypocotyls of seedlings 6 days after sowing, each 0.8-1.0 cm long. 600 = about 0.8) and then collected by centrifugation with an equal volume of suspension medium (MS + 3 wt.% sucrose + 100 uM acetosyringone). After further centrifugation, the cells were resuspended with an equal volume of suspension medium to obtain bacterial solutions containing BnALS1m1, BnALS1m2, BnALS3m1, and BnALS3m2, respectively.
[0096] Explants were placed in the bacterial suspension containing BnALS1m1, BnALS1m2, BnALS3m1, and BnALS3m2 for 30 minutes. Gently shake the explants during this time, then remove the bacterial suspension and remove any remaining liquid with sterile filter paper. The explants were then cultured in a co-culture medium (MS + 0.2 mg / L 6-benzyladenine (6-BA) + 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D) + 200 μM acetosyringone (AS), pH 5.8) for 2-3 days.
[0097] After co-cultivation, the explants were transferred to a differentiation medium containing penicillin (Car) but no Kan (MS + 3wt.% sucrose + 18g / L Mannitol + 1.0mg / L 2,4-D + 0.3mg / L KT + 300mg / L TMT + 2mg / L trans-Zeatin + 400mg / L Car) and sterilized and cultured in a dark greenhouse for 5-7 days. The explants were then subcultured to a selective medium supplemented with Bar selection pressure (MS + 3mg / L 6-BA + 0.1mg / L α-naphthylacetic acid (NAA) + 5mg / L silver nitrate + 400mg / L Car + 15mg / L Bar; pH 5.8) for selection, awaiting differentiation of regenerated green shoots. When the regenerated buds reach 1 cm in length, they are cut and transferred to a rooting medium (MS + 0.2 mg / L NAA + 10 mg / L Bar + 400 mg / L Car; pH 5.8). Screening is then performed using a solid MS medium supplemented with Car and Bar. When the green seedlings develop a relatively well-developed root system (including a taproot and well-developed lateral roots) in the rooting medium, they can be transferred to soil for growth. Before transfer to soil, they need to undergo a bud hardening phase, which involves opening the lid of the flask and growing them for a few days. After transfer to soil, they also need to be covered with a bag and grown for two or three days to acclimate.
[0098] 2) Nucleic acid analysis-PCR identification of transformed plants
[0099] The transformed plants were screened by applying the herbicide Bar (Liberty, Invitrogen) to their leaves, and DNA was extracted and identified by PCR. Finally, positive plants were confirmed to have been transfected with the gene.
[0100] PCR identification process: To extract total DNA from transformed plants for PCR, wash leaves with 70% ethanol by volume and weigh approximately 100 mg. Add 600 μL of extraction buffer (0.2 M Tris-Cl, 0.25 mM NaCl, 25 mM EDTA, 0.5% SDS, pH 7.5) and rapidly grind at room temperature. Vortex mix in a 1.5 mL Ependorff tube for 5-10 seconds. Centrifuge at 12,000 rpm for 25 minutes at room temperature. Remove the supernatant, add an equal volume of isopropanol, and precipitate overnight at -20°C. Centrifuge at 12,000 rpm for 15 minutes at room temperature. Wash the DNA pellet with 200 μL of 70% ethanol by volume. Centrifuge at 12,000 rpm for 15 minutes at room temperature. Remove the ethanol. Invert onto a paper towel to allow the ethanol to evaporate. Dissolve the crude DNA pellet in 100 μL of sterile water. Measure its concentration using a spectrophotometer or estimate it by electrophoresis; perform PCR using total DNA as a template.
[0101] The amplification primers were ALS1-WF / NOS (used to amplify BnALS1m1 or BnALS1m2) or ALS3-WF / NOS (used to amplify BnALS3m1 or BnALS3m2), the reaction system was: 2×Es Taq MasterMix (Dye) 10 μL, forward primer (10 μM) 0.8 μL, reverse primer (10 μM) 0.8 μL, DNA template 1 μL, supplemented with ddH2O to 20 μL; amplification program: 95°C, 4 min; 95°C, 30 sec, 58°C, 30 sec, 72°C, 1 min, 35 cycles; 72°C, 5 min.
[0102] Test results such as Figures 7-10 As shown in the figure, the plasmid positive control and most transformed plants were able to amplify the expected size electrophoresis band (about 2000bp), while the wild type control did not, indicating that the transgenic rapeseed genome already contained foreign gene DNA fragments; Figures 7-10 Among them, the rapeseed plants transformed with BnALS1m1 were named BnALS1m1-OE, the rapeseed plants transformed with BnALS1m2 were named BnALS1m2-OE, the rapeseed plants transformed with BnALS3m1 were named BnALS3m1-OE, and the rapeseed plants transformed with BnALS3m2 were named BnALS3m2-OE.
[0103] 5. Resistance effect of transgenic rapeseed sprayed with bensulfuron-methyl herbicide
[0104] Resistance evaluation was performed on transgenic rapeseed lines BnALS1m1, BnALS1m2, BnALS3m1, and BnALS3m2. Three lines of each transgenic type were selected. In a greenhouse pot experiment, seedlings were sown and grown to 2-3 leaves. Bensulfuron-methyl solution was applied to the leaves evenly using a small hand sprayer. Different concentrations of Bensulfuron-methyl solution (50 mg / L and 100 mg / L) were applied uniformly to the leaves. Clear water was used as a control. A spray volume of 25 mL was applied to each pot. Seven days after spraying, the rapeseed's growth was observed.
[0105] The results are as follows Figure 11 As shown, compared with the wild-type control, the transgenic rapeseed lines BnALS1m1, BnALS1m2, BnALS3m1, and BnALS3m2, after being sprayed with 50 mg / L and 100 mg / L of bensulfuron-methyl solutions, respectively, showed growth comparable to that of the rapeseed sprayed with water, indicating that the transgenic rapeseed had significantly higher resistance to bensulfuron-methyl than the wild-type rapeseed. Furthermore, the resistance to bensulfuron-methyl was 2-3 times higher than the recommended concentration for use in wheat fields, far exceeding the concentration required for the control. These results demonstrate that the mutation sites screened for high sulfonylurea herbicide resistance in rapeseed are reliable and effective.
[0106] 6. In vitro activity determination of transgenic rapeseed ALS
[0107] The following operations were performed on the transgenic rapeseed lines of BnALS1m1, BnALS1m2, BnALS3m1 and BnALS3m2 and the wild-type rapeseed line:
[0108] 1) Extraction of ALS enzyme activity from rapeseed
[0109] a. Weigh 2g of frozen rapeseed plant material, add liquid nitrogen to a dry, pre-cooled mortar and quickly grind it into a fine powder, and place the mortar on ice;
[0110] b. After the liquid nitrogen evaporated, add 10 mL of homogenization buffer [0.1 M phosphate buffer (pH 7.5), 0.5 mM MgCl2, 0.5 mM TPP, 10 μM FAD, 10 mM sodium pyruvate, 10% glycerol, 1 mM DDT, 1 mM PMSF, 0.5% PVP40], grind rapidly, and filter the mixture through a nylon mesh into a pre-chilled 50 mL centrifuge tube;
[0111] c. Centrifuge at 12000 g for 15 min at 4°C;
[0112] d. Transfer the supernatant to a 50 mL centrifuge tube, add an equal volume of saturated ammonium sulfate dropwise, and stir on ice for 30 min.
[0113] e. The enzyme solution precipitated with saturated ammonium sulfate was centrifuged at 12000 g for 30 min at 4°C;
[0114] f. Discard the supernatant and add 3 mL of resuspension buffer [0.1 M phosphate buffer (pH 7.5), 0.5 mM MgCl2, 0.5 mM TPP, 10 μM FAD, 10 mM sodium pyruvate, 10% glycerol, 1 mM DDT, 1 mM PMSF] to dissolve the precipitate.
[0115] 2) Desalination of crude enzyme solution
[0116] Using Thermo Scientific TM Slide-A-Lyzer TMRemove ammonium sulfate from the crude enzyme solution using a mini dialysis cup (10K MWCO, 2 mL). Add crude enzyme solution to the dialysis cup. Add dialysis buffer (50 mM Hepes, pH 7.5, 200 mM sodium pyruvate, 20 mM MgCl2, 2 mM TPP, 10 μM FAD, trace DDT) to a 50 mL conical tube, ensuring the bottom of the dialysis cup is immersed in the dialysis buffer. Place the tube on a decolorizing shaker at 4°C, 250 rpm, and shake for 2-3 hours. Remove the liquid from the conical tube, add fresh dialysis buffer, and centrifuge at 4°C, 250 rpm, for overnight dialysis. Collect approximately 3.5 mL of enzyme solution from the dialysis cup for in vitro ALS activity assay in rapeseed.
[0117] 3) In vitro enzyme activity detection of rapeseed ALS
[0118] a. Sample addition: Take several clean 1.5mL centrifuge tubes and add 100μL of bensulfuron-methyl solution (0, 10 -3 , 10 -2 , 10 -1 , 1, 10 and 100 μM), 40 μL of 6 mol / L H2SO4 was first added to the blank control centrifuge tube, and 100 μL of distilled water was added, and then 100 μL of crude enzyme solution was added to each centrifuge tube;
[0119] b. Reaction: Place all centrifuge tubes in a constant temperature water bath at 37°C for 30 min. Rapidly add 40 μL of 6 mol / L H2SO4 to terminate the reaction (except for the blank control). Return the reaction tubes to a constant temperature water bath at 60°C for 15 min.
[0120] c. Color development: 190 μL of each of a freshly prepared 5.5% α-naphthol (prepared with 5 mol / L NaOH) and a 0.55% creatine solution were added to each reaction centrifuge tube, mixed, and incubated in a 60°C water bath for 15 minutes for color development.
[0121] d. ALS enzyme activity assay: Cool to room temperature, centrifuge at 10,000 rpm for 1 min, take 200 μL of the supernatant from each centrifuge tube and transfer it to a 96-well microtiter plate to measure the OD 530 value.
[0122] Three biological replicates were set for each treatment, and the results were shown in Figures 12-13 As the herbicide concentration increased, the ALS enzyme activity of the transgenic rapeseed lines BnALS1m1, BnALS1m2, BnALS3m1, and BnALS3m2 decreased slowly. After treatment with 100 mM bensulfuron-methyl solution, the ALS enzyme activity remained above 90%, while that of the negative control rapeseed decreased to below 70%.
[0123] From the above examples, it can be concluded that the sulfonylurea herbicide-resistant rapeseed genes BnALS1m1, BnALS1m2, BnALS3m1 and BnALS3m2 of the present invention can improve the tolerance and resistance of crops to sulfonylurea herbicides, and assist in the breeding of new crop varieties with high resistance to sulfonylurea herbicides.
[0124] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. Application of sulfonylurea herbicide-resistant rapeseed genes, sulfonylurea herbicide-resistant rapeseed proteins, recombinant expression vectors or engineered bacteria in improving crop resistance to sulfonylurea herbicides and / or in breeding crops with high sulfonylurea herbicide resistance; The sulfonylurea herbicide-resistant rapeseed gene is BnALS1m1, BnALS1m2, BnALS3m1 or BnALS3m2; the nucleotide sequences of BnALS1m1, BnALS1m2, BnALS3m1 and BnALS3m2 are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, respectively; The sulfonylurea herbicide-resistant rapeseed protein is BnALS1m1 protein, BnALS1m2 protein, BnALS3m1 protein or BnALS3m2 protein, and the amino acid sequences of the BnALS1m1 protein, BnALS1m2 protein, BnALS3m1 protein and BnALS3m2 protein are shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, respectively; The recombinant expression vector includes the sulfonylurea herbicide-resistant rapeseed gene or the sulfonylurea herbicide-resistant rapeseed gene cloned using the primer set and an initial vector; The engineered bacteria include the sulfonylurea herbicide-resistant rapeseed gene, the sulfonylurea herbicide-resistant rapeseed gene cloned using the primer set, or the recombinant expression vector and Agrobacterium; The crop is rapeseed.
2. The use according to claim 1, characterized in that The initial vector includes the plant binary expression vector Pcambia3301.
3. The use according to claim 2, characterized in that The sulfonylurea herbicide-resistant rapeseed gene is inserted between Bgl II and Pml I of the plant binary expression vector Pcambia3301.
4. A method for cultivating crops with high resistance to sulfonylurea herbicides, characterized in that: include: Increase the expression of rapeseed protein resistant to sulfonylurea herbicides in target plants; The sulfonylurea herbicide-resistant rapeseed protein is BnALS1m1 protein, BnALS1m2 protein, BnALS3m1 protein or BnALS3m2 protein, and the amino acid sequences of the BnALS1m1 protein, BnALS1m2 protein, BnALS3m1 protein and BnALS3m2 protein are shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, respectively; The crop is rapeseed.
Citation Information
Patent Citations
Mutated acetohydroxyacid synthase genes in brassica
CN102405846A
AHAS mutants
CN104017816A
Sulfonylurea herbicide tribenuron-methyl resisting gene of brassica napus and application
CN106754997A