Microsatellite marker primers related to the feed conversion rate of turbot and their applications

Abstract

The present invention discloses a microsatellite marker primer related to the feed conversion rate of turbot, belonging to the field of fish DNA marker technology and application. The primer sequences are the forward sequence GTACAAGTACACAACAGCAGT and the reverse sequence ACCATTGAAGACAGAAGTGT. Using the primer to perform PCR amplification on the DNA of turbot individuals, individuals capable of amplifying a specific fragment size of 238bp are screened. Individuals with this genotype have a higher feed conversion rate. Using the primer in the breeding of turbot varieties with high feed conversion rate, compared with the conventional breeding method, this method can shorten the breeding years and improve the breeding efficiency.

Description

Technical Field

[0001] The present invention belongs to the field of fish DNA marker technology and its application, and specifically relates to a microsatellite marker primer related to the feed conversion rate of turbot and its application. Background Art

[0002] Turbot is an important economically cultured marine fish in China. The latest industrial development report mentions that among the breeding costs of turbot, the highest proportion is feed expenditure, accounting for 43.35% of the total cost. With the increase in feed prices in recent years, the feed expenditure has increased, seriously affecting the enthusiasm of farmers and the development of the turbot breeding industry. Feed conversion efficiency is an important economic and technical indicator to measure the high or low feed utilization efficiency of the cultured object. Selecting a turbot strain with high feed conversion rate can effectively reduce the breeding cost of turbot and increase the breeding profit.

[0003] Molecular marker-assisted breeding is to directly select and breed individuals with allelic genes or genotypes with trait advantages by means of molecular markers closely related to traits. Compared with traditional breeding methods, molecular marker-assisted selection has a large amount of information, is not easily affected by the environment, has a large selection intensity, and has high selection efficiency and accuracy. Among common molecular marker technologies, microsatellite molecular markers (simple sequence repeats, SSRs) are widely and randomly distributed in the genome, and have the advantages of codominant inheritance, high polymorphism, good stability, and simple operation, and have been widely used in the breeding of aquatic animals.

[0004] Using molecular marker-assisted breeding to cultivate turbot with high feed conversion rate traits is an important way to reduce costs and improve economic benefits. At present, the breeding of feed conversion rate mostly focuses on the livestock field, and there is very little research in aquaculture. There is no report at home and abroad on the molecular marker research of turbot feed conversion rate traits. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a microsatellite marker primer related to the feed conversion rate of turbot and its application.

[0006] The present invention is realized through the following technical solutions:

[0007] A microsatellite marker primer related to the feed conversion rate of turbot, the primer sequences are the forward sequence GTACAAGTACACAACAGCAGT and the reverse sequence ACCATTGAAGACAGAAGTGT.

[0008] The present invention also provides the application of the primer in the breeding of turbot varieties. The application method is to perform PCR amplification on the DNA of turbot individuals using the primer, and screen homozygous individuals capable of amplifying a specific fragment size of 238 bp as the basic parents to produce all heterozygous or homozygous individuals with this fragment, and the offspring have a higher feed conversion rate.

[0009] Furthermore, the PCR reaction system is 20 μL: 1 μL of DNA solution, 1 μL of upstream primer, 1 μL of downstream primer, 10 μL of 2x Taq PCR Mix, and 7 μL of sterilized double-distilled water.

[0010] Furthermore, the PCR amplification reaction conditions are as follows: pre-denaturation at 94 °C for 10 min; denaturation at 94 °C for 5 s, reaction at the actual annealing temperature of each pair of primers for 50 s, extension at 72 °C for 50 s, for a total of 35 cycles; extension at 72 °C for 10 min.

[0011] Furthermore, the PCR products are electrophoresed on a 5% non-denaturing polyacrylamide gel at a constant voltage of 360 V for 2 h, and the PAGE gel is stained using the rapid silver staining method.

[0012] Advantages of the present invention compared with the prior art:

[0013] The present invention obtains for the first time a molecular marker related to the feed conversion rate of turbot, and uses the primer in the breeding of turbot varieties with high feed conversion rate. Compared with the conventional breeding method, this method can shorten the breeding period and improve the breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Electrophoresis pattern of the band distribution of microsatellite markers in groups H and L (pooled individuals);

[0015] Figure 2 Electrophoresis pattern of the band distribution of microsatellite markers in groups H and L (all individuals);

[0016] Figure 3 Electrophoresis pattern of the amplification band pattern of YSKr148 in the DNA pools of 8 full-sib families;

[0017] Figure 4 Electrophoresis pattern of the amplification band pattern of YSKr148 in 20 individual family members. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0018] The technical solutions of the present invention will be further explained below through embodiments in conjunction with the drawings, but the protection scope of the present invention is not limited in any form by the embodiments. Unless otherwise specified, the experimental methods used in the embodiments are all conventional methods and techniques well-known to those skilled in the art, and the materials and reagents are obtained through commercial purchase.

[0019] Example 1

[0020] 1. Obtaining materials related to the feed conversion rate trait of turbot

[0021] The experimental fish were from Tianyuan Aquatic Products Co., Ltd. in Yantai Development Zone. 300 juvenile fish with no damage on the body surface and good vitality (body length 11.2 cm ± 0.5 cm, body weight 22.34 ± 2.25 g) were randomly selected and placed in a special 300-cage aquaculture system for individual culture. They were acclimated for 2 weeks before the measurement, with water temperature 20 ± 0.5 °C, salinity 30 ppt, and dissolved oxygen > 6.0 mg / L. After the acclimation, the weight of each fish was accurately weighed and recorded (denoted as the initial weight). The next day, commercial feed was fed, and the daily feeding number of each fish was kept consistent (each pellet weighed 16.85 mg on average). The experiment lasted for 60 days, during which the water temperature was kept at 20 ± 0.5 °C, salinity 30 ppt, and dissolved oxygen > 6.0 mg / L. After the experiment ended, feeding was stopped for 24 h, and all the experimental fish in the cages were fished out, accurately weighed and recorded (denoted as the final weight). The feed conversion rate of each individual was calculated using the formula:

[0022] Feed coefficient ratio (FCR, %) = (final weight - initial weight) / total dry matter weight of the input feed × 100%

[0023] After weighing, the caudal fin of each fish was cut and placed in absolute ethanol, then frozen in a -80 °C refrigerator for later use. 30 fish with the highest feed conversion rate were selected as the high-conversion rate group (Group H), and 30 fish with the lowest feed conversion rate were selected as the low-conversion rate group (Group L). The t-test was used to verify whether there was a significant difference between the two groups.

[0024] 2. Microsatellite primers

[0025] According to the microsatellite loci of turbot uploaded on NCBI, 40 microsatellite loci were selected, and primers were designed according to their flanking conserved sequences and synthesized by Shanghai Sangon Biotech Co., Ltd.

[0026] 3. Extraction and detection of genomic DNA

[0027] The TianGen Marine Animal DNA Extraction Kit was used to extract the caudal fin DNA of 30 fish in each of Group H and Group L of turbot. Agarose gel electrophoresis was used to detect the integrity of the extracted DNA, a UV spectrophotometer was used to measure the concentration, 1% agarose gel electrophoresis was used to measure the quality and integrity of the extracted DNA, a UV spectrophotometer was used for concentration determination, and it was diluted to 50 ng / μL with double-distilled water. The DNA was stored at -80 °C for later use.

[0028] 4. Establishment of BSA gene pools

[0029] Take 15 individuals from each of Group H and Group L, and take an equal amount of 5 μL DNA solution from each individual to respectively construct a high feed conversion rate gene pool (H pool) and a low feed conversion rate gene pool (L pool).

[0030] 4. Microsatellite marker screening

[0031] Select 15 samples with the highest feed conversion rate in Group H and 15 samples with the lowest feed conversion rate in Group L. Mix 5 μL DNA solution from each to construct the corresponding H pool and L pool. Use 40 pairs of microsatellite primers to perform PCR amplification on the two DNA pools respectively. PCR reaction system: 1 μL DNA solution, 1 μL upstream primer, 1 μL downstream primer, 10 μL 2×TaqPCR Mix, 7 μL sterilized double-distilled water. PCR amplification reaction conditions: Pre-denaturation at 94 °C for 10 min; denaturation at 94 °C for 5 s, react at the actual annealing temperature of each pair of primers for 30 s, extension at 72 °C for 30 s, a total of 35 cycles; extension at 72 °C for 10 min. Add 5 μL 6×Loading Buffer to the 20 μL amplified product, heat at 95 °C for 5 min, and immediately ice-bath for 10 min.

[0032] Perform 8% non-denaturing polyacrylamide gel electrophoresis on the PCR products. The sample loading volume is 4 μL, constant voltage is 100 v, and electrophoresis is carried out for 6 h. After electrophoresis, use the silver staining method to stain the PAGE gel on a shaker for 10 minutes, rinse with double-distilled water for 1 minute to reduce the background color, perform shaker development with the developer, stop the development immediately when light-colored bands appear, rinse with a large amount of double-distilled water for 1 minute, and then immediately take a photo under white light to save the electrophoresis results. By analyzing the PCR amplification of the DNA in the two gene pools, initially screen out 2 microsatellite loci that can amplify differential allele fragments in the two pools, as Figure 1 shown. Sequence the PCR products with differential bands to verify whether the differential band fragments are the corresponding microsatellite locus sequences.

[0033] 5. Preliminary verification of microsatellite markers

[0034] Use the technical means in Step 4 (PCR amplification and polyacrylamide gel electrophoresis) to analyze the differential band conditions of the 2 microsatellite markers in Group H and Group L, and perform Pearson test on the frequencies of the differential bands. Finally, obtain 1 microsatellite marker YSKr148 with significant differences. Forward primer: GTACAAGTACACAACAGCAGT, reverse primer: ACCATTGAAGACAGAAGTGT.

[0035] As Figure 2As shown in Table 1, the frequency of the 238bp fragment of this marker in group H was 9, and in group L was 1, and all 10 individuals were heterozygotes. Pearson correlation analysis showed that this fragment was extremely significantly correlated with the feed conversion rate of turbot. The specific statistical data and correlation analysis results are shown in Table 1.

[0036] Table 1 Statistics of the occurrence times of YSKr148 allele fragments in the amplified band patterns of individuals

[0037]

[0038] 7. Re-verification of family individuals

[0039] The corresponding primers of microsatellite locus YSKr148 were used to perform PCR amplification on the DNA pooled from 8 families, and PAGE gel electrophoresis was carried out. The results showed that only family 6 had the 238bp band of the YSKr148 locus ( Figure 3 ). SSR differential band analysis was performed on all individuals in family 6, and the amplification of the 238bp differential allele was counted ( Figure 4 ). According to the presence or absence of the 238bp band, the 20 individuals in this family were grouped, and the results are shown in Table 2. After T-test, the difference in feed conversion rate between the positive group and the negative group was extremely significant (P<0.01), further verifying that the microsatellite locus YSKr148 was extremely significantly correlated with the feed conversion rate of turbot. In addition, the feed conversion rate of the positive heterozygous group was higher than that of the positive homozygous group.

[0040] Table 2 Grouping results of family individuals and feed conversion rates of each group

[0041]

[0042] Example 2: Application of microsatellite markers for feed conversion rate in the selection and breeding of high feed conversion rate strains of turbot

[0043] Before the intensification of broodstock, a part of the caudal fin of the candidate parent was cut and fixed in 95% absolute ethanol for low-temperature preservation, which was used for genomic DNA extraction. The extraction and detection of DNA, the processes of PCR and polyacrylamide gel electrophoresis, and the analysis of gel results were as described in Example 1. Individuals with a genotype of having 238bp and being homozygous were selected as the basic parents for nutritional intensification to construct a core breeding population for further selection and breeding of high feed conversion rate strains.

Claims

1. Application of microsatellite marker primers related to the feed conversion rate of turbot in the breeding of turbot varieties, characterized in that, The application method is to use the microsatellite marker primers to perform PCR amplification on the DNA of turbot individuals, and screen out the homozygous individuals capable of amplifying a specific fragment of 238 bp as the basic parents to produce all heterozygous or homozygous individuals with this fragment, and the offspring have a higher feed conversion rate. The microsatellite marker primer sequences are the forward sequence GTACAAGTACACAACAGCAGT and the reverse sequence ACCATTGAAGACAGAAGTGT.

2. The application according to claim 1, characterized in that, The PCR reaction system is 20 μL, which includes 1 μL of DNA solution, 1 μL of upstream primer, 1 μL of downstream primer, 10 μL of 2x Taq PCR Mix, and 7 μL of sterilized double-distilled water.

3. The application according to claim 1, characterized in that, The PCR amplification reaction conditions are as follows: pre-denaturation at 94°C for 10 min; denaturation at 94°C for 5 s, reaction at the actual annealing temperature of each pair of primers for 50 s, extension at 72°C for 50 s, for a total of 35 cycles; extension at 72°C for 10 min.

4. The application according to claim 1, characterized in that, The PCR products are electrophoresed on a 5% non-denaturing polyacrylamide gel at a constant voltage of 360 V for 2 h, and the gel is stained using the rapid silver staining method.

Images