A primer composition for detecting lactobacillus rhamnosus x253 and application thereof
By designing specific primer compositions and qPCR technology, the problems of time-consuming and complex existing detection methods have been solved, enabling rapid and accurate qualitative and quantitative detection of Lactobacillus rhamnosus X253. This improves the sensitivity and repeatability of the detection and is suitable for quality control of Lactobacillus rhamnosus X253 in food.
Patent Information
- Application Number
- CN202210798933.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-06
- Publication Date
- 2025-12-23
- Estimated Expiration
- 2042-07-06
Smart Images
Figure 220706135303 
Figure 220706135305 
Figure 220706135307
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of bioengineering and relates to a primer composition for detecting probiotics, in particular a primer composition for detecting Lactobacillus rhamnosus X253 and application thereof. BACKGROUND
[0002] Lactobacillus rhamnosus belongs to gram-positive bacteria, is facultative anaerobic, is a heterofermentative lactic acid bacteria, and is widely distributed in the gastrointestinal tract, reproductive tract, dairy products and plant materials of animals. Nowadays, Lactobacillus rhamnosus is widely used in dairy products, health foods, animal feed and biological medicines, and embodies its high economic value. Lactobacillus rhamnosus X253 is isolated and screened from fermented milk in Xinjiang, and researches show that the bacteria have strong safety, strong tolerance to human gastrointestinal fluid, strong antioxidant capacity, good oral health and can relieve physical fatigue, and are a potential strain with good market prospect. However, when Lactobacillus rhamnosus X253 proliferates excessively in food, it will affect the immune function of the human body and the balance of intestinal flora; when the amount of Lactobacillus rhamnosus X253 is too low, the expected beneficial effect cannot be achieved. Therefore, the detection of Lactobacillus rhamnosus X253 is also an important link in the production and quality safety of food-related raw materials and food.
[0003] At present, the identification of probiotics mainly includes culture method and molecular biology method. The culture method mainly identifies through morphology, gram staining and biochemical test, which is very time-consuming and cannot distinguish strains of the same species. The molecular biology method mainly includes 16S rDNA, 16S-23S ITS gene sequence sequencing method, pulse field gel electrophoresis method, random amplified polymorphic DNA analysis or amplified length polymorphism analysis, and has the following disadvantages: (1) limitation in distinguishing closely related species and subspecies; (2) complex operation, poor repeatability, and need for professional skills or advanced hardware and software. Therefore, it is imperative to develop a simple, rapid and repeatable Lactobacillus rhamnosus X253 strain level identification and quantification method suitable for enterprises. SUMMARY
[0004] An object of the present application is to provide a primer composition for detecting Lactobacillus rhamnosus X253, so as to qualitatively and quantitatively detect Lactobacillus rhamnosus X253 in a sample.
[0005] Another object of the present application is to provide the application of the primer composition.
[0006] In order to achieve the above object, the technical scheme adopted by the present application is as follows:
[0007] A primer composition for detecting Lactobacillus rhamnosus X253, the primer composition comprising a primer pair and a probe; the primer pair, the nucleotide sequence of the upstream primer being ggttggtcgtttgccttatca, and the nucleotide sequence of the downstream primer being ttcagtatccaccagcccacta; the nucleotide sequence of the probe being actggcccatgctt.
[0008] The application further provides an application of the primer composition for detecting Lactobacillus rhamnosus X253, the application of the primer composition in qualitatively and / or quantitatively detecting Lactobacillus rhamnosus X253.
[0009] As a limitation of the application of the primer composition for detecting Lactobacillus rhamnosus X253, the method for qualitatively detecting Lactobacillus rhamnosus X253 comprises the following steps in sequence: collecting sample bacteria, extracting sample DNA, qPCR amplification, analysis, and determination.
[0010] The criterion for the determination comprises that the qPCR amplification product peaks and the Cq value is less than 35, and then the detection result of Lactobacillus rhamnosus X253 in the sample is positive.
[0011] As another limitation of the application of the primer composition for detecting Lactobacillus rhamnosus X253, the application of the primer composition for detecting Lactobacillus rhamnosus X253 according to claim 2, characterized in that the method for quantitatively detecting Lactobacillus rhamnosus X253 comprises the following steps in sequence:
[0012] S1. Preparation of a standard curve
[0013] A Lactobacillus rhamnosus X253 bacterial liquid standard is diluted in gradient, and the DNA of the bacterial liquid standard is extracted as a template for qPCR amplification, linear fitting, and establishment of a standard curve.
[0014] S2. Quantitative determination of Lactobacillus rhamnosus X253 in a sample
[0015] A sample containing Lactobacillus rhamnosus X253 is collected, and the DNA is extracted as a template for qPCR amplification, and the standard curve established in step S1 is used for reference to obtain the concentration of Lactobacillus rhamnosus X253 in the sample.
[0016] In the steps S1 and S2, the qPCR amplification adopts the primer composition according to claim 1.
[0017] Thanks to the above technical solution, the application has the following technical progress compared with the prior art:
[0018]
[0019] ②The primer composition provided by the present application has low detection limit, sensitive reaction and good repeatability when detecting Lactobacillus rhamnosus X253.
[0020] ③The method for detecting Lactobacillus rhamnosus X253 provided by the present application can more efficiently and accurately qualitatively and quantitatively determine Lactobacillus rhamnosus X253 in a sample compared with conventional culture method and molecular biology method, greatly shortens detection time and improves work efficiency.
[0021] In summary, the primer composition for detecting Lactobacillus rhamnosus X253 provided by the present application has good specificity, repeatability and sensitivity; the sample containing Lactobacillus rhamnosus X253 is more quickly and accurately identified and determined in strain when the primer composition is applied, which can effectively improve the strength and efficiency of quality safety monitoring of food raw materials, intermediates and finished products containing Lactobacillus rhamnosus X253.
[0022] The present application is suitable for qualitatively and quantitatively analyzing Lactobacillus rhamnosus X253 in food. BRIEF DESCRIPTION OF DRAWINGS
[0023] Figure 1 is a result graph of inter-specific specificity detection in embodiment 2 of the present application;
[0024] Figure 2 is a result graph of intra-specific specificity detection in embodiment 2 of the present application;
[0025] Figure 3 is a qPCR graph of fermented milk with different dilution degrees in embodiment 5 of the present application;
[0026] Figure 4 is a standard curve of Lactobacillus rhamnosus X253 bacterial liquid in embodiment 6 of the present application;
[0027] Figure 5 is a qPCR graph of bacterial powder sample in embodiment 6 of the present application. DETAILED DESCRIPTION
[0028] The present application will be further described in detail through specific embodiments. It should be understood that the described embodiments are only for explaining the present application and do not limit the present application.
[0029] The materials, reagents and the like used in the embodiments of the present application can be obtained from commercial channels unless otherwise specified.
[0030] The fluorescence quantitative qPCR instrument used in the embodiments of the present application is a Roche Light Cycler480 produced by Roche Diagnostics GmbH of Germany.
[0031] The experimental methods not specified in the embodiments are usually carried out according to the conventional conditions or the conditions recommended by the manufacturer.
[0032] Example 1 Screening of primer composition for detecting Lactobacillus rhamnosus X253
[0033] The Lactobacillus rhamnosus X253 of the present application is isolated from fermented milk in Xinjiang, and the strain has been preserved in the China General Microbiological Culture Collection Center on August 20, 2019, with the preservation number of CGMCC NO.18404. The screening process of the primer composition for detecting Lactobacillus rhamnosus X253 provided in the present embodiment is as follows:
[0034] (1) SNP analysis
[0035] After the preliminary screening, 29 Lactobacillus rhamnosus strains were selected, and the whole genome sequences of the selected 29 Lactobacillus rhamnosus strains were obtained from the NCBI database. The Lactobacillus rhamnosus X253 strain was used as a reference strain, and the strain information used for genome alignment is shown in Table 1.
[0036] Table 1 Strain information used for genome alignment
[0037]
[0038]
[0039] The simulated sequences were aligned to the reference sequence of Lactobacillus rhamnosus X253 by Bwa software, the alignment results were sorted by Samtools software, and the repetitive sequences were removed by Sambamba software. The SNP site set of Lactobacillus rhamnosus X253 was obtained by VarScan software analysis, and there were about 120000 SNP sites in the set. After data level-by-level screening and analysis, 4 specific SNP sites of the Lactobacillus rhamnosus X253 strain gene were finally obtained, which are shown in Table 2 as follows.
[0040] Table 2 SNP analysis results of Lactobacillus rhamnosus X253 and other 29 Lactobacillus rhamnosus strains
[0041]
[0042] (2) Selection of experimental strains
[0043] To avoid false positive in the future use of the designed primer composition, the inventors selected Lactobacillus rhamnosus X253 and 43 strains similar to Lactobacillus rhamnosus X253 in taxonomic status or close in gene sequence as experimental strains, and the details of the experimental strains are shown in Table 3.
[0044] Table 3 Experimental strains
[0045]
[0046]
[0047]
[0048] (3) DNA extraction
[0049] The experimental strains and sample DNA were extracted using a bacterial genomic DNA extraction kit (DP302) from Tiangen Biosciences Beijing Co., Ltd., and the method was performed according to the manufacturer's instructions. The extracted DNA samples were detected by 1.0% agarose gel electrophoresis, and the concentration, 260 / 280 ratio and 260 / 230 ratio of the DNA samples were determined before being stored in a -20°C refrigerator for standby use.
[0050] (4) Strain-specific primer design
[0051] According to the SNP site specific to Lactobacillus rhamnosus X253, combined with the number and position of the difference sites, Tm value, primer end stability, GC content, secondary structure and other parameters, Primer Express 3.0 software was used to design available primers and probes, and was synthesized by Shengong Bioengineering (Shanghai) Co., Ltd., wherein the fluorescent group of the four probes in this embodiment was selected as 5-FAM, and the quencher was selected as BHQ1.
[0052] According to the specific SNP sites of the four Lactobacillus rhamnosus X253 strain genes obtained in step (2) of this embodiment, primer pairs and probe sequences were designed, and the SNP sites, primer pairs and probe sequences and their amplification lengths are shown in Table 4.
[0053] Table 4 Primer and probe sequences
[0054]
[0055]
[0056] Example 2 Specificity test
[0057] (1) Inter-specific specificity test
[0058] Using Lactobacillus rhamnosus X253, 5 strains of Lactobacillus casei, 13 strains of Lactobacillus paracasei, and 16 other standard or commonly used food strains (i.e., strains numbered 1, 7-44 in Table 3) from step (2) of Example 1, interspecies specificity tests were performed. DNA was extracted from each selected strain, and the nucleic acid concentration was adjusted to 50 ng / μL. qPCR was performed using the primer combinations listed in Table 4.
[0059] The qPCR reaction system consisted of: 10 μL of 2×Takara Prober Taq mix, 1 μL of 5 μM upstream primer, 1 μL of 5 μM downstream primer, 1 μL of 10 μM probe, 1 μL of DNA template, and deionized water to a final volume of 20 μL.
[0060] The reaction procedure was as follows: first stage 95℃ for 2 min; second stage 95℃ for 5 sec, 52℃ for 35 sec, for a total of 40 cycles.
[0061] Each experiment was conducted in triplicate, with sterile water serving as a blank control.
[0062] Specificity testing was performed, and the results of three parallel experiments were as follows: Figure 1 As shown. By Figure 1 It was found that after qPCR amplification using primer pairs (SEQ ID NO:1 and SEQ ID NO:12) and probe (SEQ IN NO:3) designed using the SNP site on the holA gene, no effective amplification products were obtained for the selected non-Lactobacillus rhamnosus strains and the blank control, except for Lactobacillus rhamnosus X253. This indicates that the primer combination can effectively distinguish Lactobacillus rhamnosus X253 from 38 other non-Lactobacillus lactic acid bacteria, and the Cq values are all ≤20. However, the amplification products of the other three primer pairs could not effectively distinguish Lactobacillus rhamnosus X253 from other strains. The results show that the selected primer combination has good interspecies specificity.
[0063] (2) Intraspecificity test
[0064] Six strains of Lactobacillus rhamnosus (i.e., strains numbered 1-6 in Table 3) from step (2) of Example 1 were used for intraspecific testing. DNA was extracted from each selected strain, and the nucleic acid concentration was adjusted to 50 ng / μL. qPCR was performed using the primer combinations listed in Table 4.
[0065] The qPCR reaction system consisted of: 10 μL of 2×Takara Prober Taq mix, 1 μL of 5 μM upstream primer, 1 μL of 5 μM downstream primer, 1 μL of 10 μM probe, 1 μL of DNA template, and deionized water to a final volume of 20 μL.
[0066] The reaction procedure was as follows: first stage 95℃ for 2 min; second stage 95℃ for 5 sec, 52℃ for 35 sec, for a total of 40 cycles.
[0067] Each experiment was conducted in triplicate, with sterile water serving as a blank control.
[0068] Specific detection was performed, and the experimental results are as follows: Figure 2 As shown. By Figure 2 It can be seen that after qPCR amplification using primer pairs (SEQ ID NO:1 and SEQ ID NO:12) and probe (SEQ IN NO:3) designed using the SNP site located on the holA gene, except for *Lactobacillus rhamnosus* X253, no effective amplification products were obtained for the other five selected *Lactobacillus rhamnosus* strains and the blank control. This indicates that the primer composition can effectively distinguish *Lactobacillus rhamnosus* X253 from the other five *Lactobacillus rhamnosus* strains, and the Cq values are all ≤20. The amplification products of the other three primer pairs could not effectively distinguish *Lactobacillus rhamnosus* X253 from other strains. The results show that the selected primer composition has good intraspecific specificity. Therefore, this composition is determined as the primer composition for detecting *Lactobacillus rhamnosus* X253 in this invention. Specifically, the upstream primer nucleotide sequence is shown in SEQ ID NO:1, specifically GGTTGGTCGTTTGCCTTATCA; the downstream primer nucleotide sequence is shown in SEQ ID NO:2, specifically TTCAGTATCCACCAGCCCACTA; and the probe nucleotide sequence is shown in SEQ ID NO:1. As shown in NO:3, specifically ACTGGCCCATGCTT, the probe fluorescent group is 5-FAM and the quenching group is BHQ1.
[0069] Example 3: Limit of Detection Test of Primer Composition
[0070] This embodiment includes the detection limits for nucleic acid and bacterial concentration. For nucleic acid sensitivity, a 10 ng / μL nucleic acid solution was serially diluted and then subjected to qPCR amplification. For bacterial concentration sensitivity, the Lactobacillus rhamnosus X253 culture medium was serially diluted 10-fold, with each dilution factor being 10. 8 ~10 2 CFU / mL, extract 1 mL of nucleic acid from each concentration and perform qPCR detection. Each sample was repeated 3 times. Sterile water was used as a blank control.
[0071] To determine the detection limit of nucleic acid concentration, the 10 ng / μL nucleic acid solution was successively diluted to 1, 0.1, 0.01, 0.001, and 0.0001 ng / μL for qPCR amplification. The results are shown in Table 5.
[0072] Table 5. Detection Limits for DNA Concentration
[0073]
[0074] From Table 5, the detection limit of Lactobacillus rhamnosus X253 nucleic acid concentration is 0.001 ng / μL.
[0075] The DNA was extracted as a template by gradient dilution of Lactobacillus rhamnosus X253 fermentation broth. Each bacterial concentration was tested in triplicate, and the bacterial liquid was cultured and counted simultaneously. The experimental results are shown in Table 6.
[0076] Table 6 Bacterial liquid concentration detection limit
[0077]
[0078]
[0079] From Table 6, when the bacterial concentration is 10 3 CFU / mL, 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL, 10 7 CFU / mL, and 10 8 CFU / mL, the Cq value of each bacterial concentration is < 35, and the detection results are all positive; when the bacterial concentration is 10 2 CFU / mL, the Cq value is > 35, and the detection results are all negative. The above results show that the bacterial liquid concentration quantitative detection limit of the method is 10 3 CFU / mL.
[0080] Example 4 Reproducibility test
[0081] The reproducibility was determined by repeated tests in a short period of time. In this example, scheme one and scheme one were 7 days apart, and three different DNA concentrations were used for reproducibility testing, each test was repeated 6 times, and sterile water was used as a blank control sample. The experimental results are shown in Table 7.
[0082] Table 7 Reproducibility verification of Lactobacillus rhamnosus X253 strain horizontal detection
[0083]
[0084]
[0085] From Table 7, it can be seen that the RSD of Cq value is 0.39% when the DNA concentration is 10 ng / μL, the RSD of Cq value is 0.43% when the DNA concentration is 1 ng / μL, and the RSD of Cq value is 0.30% when the DNA concentration is 0.1 ng / μL. The test results show that the method has good repeatability.
[0086] Qualitative detection of Lactobacillus rhamnosus X253 in the sample of Example 5
[0087] The Lactobacillus rhamnosus X253 strain was cultured to 10 8 CFU / mL, and gradient dilution was performed on the Lactobacillus rhamnosus X253 bacterial body using a commercially available compound strain lactic acid bacteria fermented milk as a substrate. The dilution concentrations were 10 7 CFU / mL, 10 6 CFU / mL, 10 5 CFU / mL, 10 4 CFU / mL, and 10 3 CFU / mL, respectively. The original compound strain lactic acid bacteria fermented milk contained Lactobacillus plantarum, Lactobacillus bulgaricus, Streptococcus thermophilus, and Lactobacillus acidophilus.
[0088] 2 mL of the fermented milk sample at each dilution was centrifuged at 1000 rpm for 5 min to remove the protein and lipid impurities in the sample.
[0089] 1 mL of the supernatant after centrifugation was transferred to a new EP tube and centrifuged at 12000 rpm for 10 min to collect the precipitate, which was the bacterial body. The bacterial genomic DNA extraction kit (DP302) was used to extract the bacterial body DNA, which was used as a template for qPCR amplification. Sterile water was used as a blank control. The qPCR conditions were the same as those described in Example 4. The primer pair and the probe used in the amplification were the primer combination selected in Example 3. Each concentration was repeated three times.
[0090] The qPCR graphs of the fermented milk at different dilutions are shown in Figure 3 . The Cq values of the samples to be tested at Lactobacillus rhamnosus X253 concentrations of 10 3 -10 7 CFU / mL were all <35, and it was determined that Lactobacillus rhamnosus X253 was positive. The real-time fluorescent quantitative qPCR detection method established in the present application has strong anti-interference ability and is still feasible after adding other strains and substrates. It can realize the qualitative detection of simulated samples.
[0091] Quantitative detection of Lactobacillus rhamnosus X253 in the sample of Example 6
[0092] S1. Preparation of a standard curve
[0093] 1 mL of the supernatant after centrifugation was transferred to a new EP tube and centrifuged at 12000 rpm for 10 min to collect the precipitate, which was the bacterial body. The bacterial genomic DNA extraction kit (DP302) was used to extract the bacterial body DNA, which was used as a template for qPCR amplification. Sterile water was used as a blank control. The qPCR conditions were the same as those described in Example 4. The primer pair and the probe used in the amplification were the primer combination selected in Example 3. Each concentration was repeated three times.8 The bacterial liquid standard of Lactobacillus rhamnosus X253 with 108 CFU / mL was gradiently diluted, DNA was extracted using a bacterial genomic DNA extraction kit (DP302), and the extracted DNA was used as a template for qPCR;
[0094] The conditions of qPCR were the same as described in Example 3, and the primer pair and the probe were the primer composition selected in Example 2 during amplification, and each concentration was repeated 3 times;
[0095] The Cq values obtained by qPCR amplification were linearly fitted, the average Cq value was taken as the Y axis, and the logarithmic value of the different dilution multiples of the simulation sample was taken as the X axis to establish a standard curve, as shown in Figure 4 The linear equation was y = -3.433x + 46.32, R 2 = 0.9993.
[0096] S2. Quantitative determination of Lactobacillus rhamnosus X253 in a sample
[0097] 0.1 g of the complex bacterial powder containing Lactobacillus rhamnosus X253 and animal bifidobacterium Bb12 was weighed, 10 mL of purified water was added, and centrifugation was performed at a speed of 1000 rpm for 5 min;
[0098] 1 mL of the supernatant after centrifugation was transferred to a new EP tube, centrifugation was performed at a speed of 12000 rpm for 10 min, and the collected precipitate was the bacterial body; the bacterial genomic DNA extraction kit (DP302) was used to extract the bacterial body DNA, the DNA was used as a template for qPCR amplification, sterile water was used as a blank control, the conditions of qPCR were the same as described in Example 4, the primer pair and the probe were the primer composition selected in Example 2 during amplification, each concentration was repeated 3 times, and the amplification result is shown in Figure 5 .
[0099] According to the output result of the fluorescence quantitative qPCR instrument, the average Cq value of the measured sample was 25.18, the bacterial number of Lactobacillus rhamnosus X253 in the complex bacterial powder was 1.45 x 10 9 CFU / g was obtained by bringing the standard curve fitting equation, and the results showed that the established method was suitable for the bacterial powder sample containing a large amount of oligosaccharides and auxiliary materials.
[0100] The primer composition for detecting Lactobacillus rhamnosus X253 provided by the application can be used for, but is not limited to, qualitative and quantitative determination of Lactobacillus rhamnosus X253 in bacterial powder.
[0101] Obviously, the above embodiments of the present application are merely exemplary and are not intended to limit the embodiments of the present application. Based on the above description, other different forms of changes or variations can be made by those skilled in the art. Any obvious changes or variations derived from the technical solutions of the present application are still within the protection scope of the present application.
Claims
1. Use of a primer composition for detecting Lactobacillus rhamnosus X253, characterized in that The primer composition is applied to qualitative and / or quantitative detection of Lactobacillus rhamnosus X253 in dairy products; the primer composition comprises a primer pair and a probe; The nucleotide sequence of the upstream primer of the primer pair is ggttggtcgtttgccttatca; The nucleotide sequence of the downstream primer is ttcagtatccaccagcccacta; The nucleotide sequence of the probe is actggcccatgctt.
2. Use of a primer composition for detecting Lactobacillus rhamnosus X253 according to claim 1, characterized in that, The method for qualitatively detecting Lactobacillus rhamnosus X253 comprises the following steps: The standard for the determination comprises that the qPCR amplification product is peaked and the Cq value is less than 35, and then the detection result of Lactobacillus rhamnosus X253 in the sample is positive.
3. Use of a primer composition for detecting Lactobacillus rhamnosus X253 according to claim 1, characterized in that, The method for quantitatively detecting Lactobacillus rhamnosus X253 comprises the following steps performed in sequence: S1. Preparation of a standard curve Lactobacillus rhamnosus X253 liquid standard is taken, gradient dilution is performed, DNA of the liquid standard is extracted as a template for qPCR amplification, linear fitting is performed, and a standard curve is established; S2. Quantitative determination of Lactobacillus rhamnosus X253 in a sample A sample containing Lactobacillus rhamnosus X253 is collected, DNA is extracted as a template for qPCR amplification, and the standard curve established in step S1 is used for control to obtain the concentration of Lactobacillus rhamnosus X253 in the sample; In step S1 and step S2, the qPCR amplification adopts the primer composition of claim 1.