Use of a substance that inhibits the target Mysm1 gene in improving mitochondrial activity

By inhibiting Mysm1 gene expression in astrocytes and preparing recombinant astrocytes using recombinant lentiviruses, the problem of mitochondrial dysfunction was solved, enhancing the defense and repair capabilities of mitochondria and providing a material basis for mitochondrial transplantation therapy.

CN115998769BActive Publication Date: 2025-12-09ACADEMY OF MILITARY MEDICAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211360586.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-02
Publication Date
2025-12-09
Estimated Expiration
2042-11-02

AI Technical Summary

Technical Problem

Mitochondrial dysfunction is prevalent in aging and neurodegenerative diseases, and current technologies struggle to effectively salvage mitochondrial function to treat these diseases.

Method used

By inhibiting Mysm1 gene expression in astrocytes, recombinant astrocytes were prepared using recombinant lentiviruses such as LV-shMysm1-zsgreen-puro to enhance mitochondrial activity, thereby strengthening their defense against mitochondrial damage caused by inflammatory factors and their ability to repair neuronal oxidative damage.

Benefits of technology

It increases the mitochondrial membrane potential of astrocytes, enhances their defense against mitochondrial damage caused by inflammatory factors, and improves their ability to repair neuronal oxidative damage, providing a theoretical basis for mitochondrial transplantation therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0003922309670000011
    Figure HDA0003922309670000011
  • Figure HDA0003922309670000021
    Figure HDA0003922309670000021
  • Figure HDA0003922309670000022
    Figure HDA0003922309670000022
Patent Text Reader

Abstract

The application discloses application of a substance taking Mysm1 gene as an inhibition target in improving mitochondrial activity. The application provides application of a recombinant astrocyte in preparation of a drug for treating neuronal oxidative damage; the recombinant astrocyte is an astrocyte with inhibited expression of a Mysm1 gene. The application also protects application of mitochondria of the recombinant astrocyte in preparation of the drug for treating the neuronal oxidative damage. The application provides a theoretical basis and a material basis for subsequent application of mitochondrial transplantation in treatment of related diseases.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biotechnology, and relates to application of a substance taking Mysm1 gene as an inhibition target in improving mitochondrial activity. BACKGROUND

[0002] Mitochondria exist in most eukaryotes and are a kind of organelle with a double-membrane structure. In addition to participating in oxidative phosphorylation to provide energy for the body, mitochondria also have functions such as maintaining calcium homeostasis, generating reactive oxygen species, and participating in cell signal transduction. Mitochondrial dysfunction mainly manifests as changes in mitochondrial morphology, energy metabolism, mitochondrial dynamics, and mitochondrial quality control. In recent years, research reports have shown that mitochondrial dysfunction occurs in many diseases such as aging and neurodegenerative diseases, and thus rescuing mitochondrial function may be a way to treat these diseases.

[0003] Mitochondrial transplantation therapy is a treatment technology that separates mitochondria from normal tissue cells and then injects them into a site where mitochondria are damaged or missing in a patient, thereby rescuing mitochondria and restoring normal cell function. Research has shown that neither exogenous mitochondria nor autologous mitochondria transplantation causes significant immune rejection. In animal experiments, mitochondrial transplantation has been reported as a treatment for ischemia-reperfusion injury and nervous system-related diseases, and clinical trials have found that mitochondrial transplantation can improve congenital heart disease. SUMMARY

[0004] The purpose of the present application is to provide application of a substance taking Mysm1 gene as an inhibition target in improving mitochondrial activity.

[0005] The present application provides application of a recombinant astrocyte in preparation of a medicament for treating oxidative damage of neurons; the recombinant astrocyte is an astrocyte in which expression of a Mysm1 gene is inhibited.

[0006] The preparation method of the recombinant astrocyte comprises the following steps: introducing a substance for inhibiting expression of a Mysm1 gene into a recipient astrocyte to obtain a recombinant astrocyte.

[0007] The substance for inhibiting expression of the Mysm1 gene can be specifically shRNA.

[0008] Specifically, the shRNA is as shown in SEQ ID NO: 3.

[0009] The substance for inhibiting expression of the Mysm1 gene can be specifically a recombinant lentivirus expressing the shRNA.

[0010] Specifically, the recombinant lentivirus expressing the shRNA is LV-shMysm1-zsgreen-puro recombinant lentivirus.

[0011] The application also protects the use of the mitochondria of the recombinant astrocyte in the preparation of a drug for treating oxidative damage of neurons; the recombinant astrocyte is an astrocyte in which the expression of the Mysm1 gene is inhibited.

[0012] The preparation method of the recombinant astrocyte comprises the following steps: introducing a substance for inhibiting the expression of the Mysm1 gene into a recipient astrocyte to obtain a recombinant astrocyte.

[0013] The substance for inhibiting the expression of the Mysm1 gene can be specifically an shRNA.

[0014] Specifically, the shRNA is as shown in SEQ ID NO: 3.

[0015] The substance for inhibiting the expression of the Mysm1 gene can be specifically a recombinant lentivirus expressing the shRNA.

[0016] Specifically, the recombinant lentivirus expressing the shRNA is LV-shMysm1-zsgreen-puro recombinant lentivirus.

[0017] The application also protects the use of a substance for inhibiting the expression of the Mysm1 gene in an astrocyte in the preparation of a product.

[0018] The functions of the product are as follows (a1) and / or (a2) and / or (a3) and / or (a4) and / or (a5):

[0019] (a1) for increasing the mitochondrial membrane potential of an astrocyte;

[0020] (a2) for rescuing the mitochondrial damage of an astrocyte caused by stimulation of an inflammatory factor;

[0021] (a3) for increasing the ATP content of an astrocyte;

[0022] (a4) for increasing the ability of an astrocyte to produce ATP;

[0023] (a5) for increasing the repair ability of the mitochondria of an astrocyte to oxidative damage of neurons.

[0024] The inflammatory factor can be specifically TNF-α and / or IL-1β.

[0025] The substance for inhibiting the expression of the Mysm1 gene in an astrocyte can be specifically an shRNA.

[0026] Specifically, the shRNA is as shown in SEQ ID NO: 3.

[0027] The substance for inhibiting the expression of Mysm1 gene in the astrocyte can be specifically a recombinant lentivirus expressing the shRNA.

[0028] Specifically, the recombinant lentivirus expressing the shRNA is LV-shMysm1-zsgreen-puro recombinant lentivirus.

[0029] The application also protects the use of a recombinant astrocyte in the preparation of mitochondria; the recombinant astrocyte is an astrocyte in which the expression of Mysm1 gene is inhibited.

[0030] The preparation method of the recombinant astrocyte comprises the following steps: introducing a substance for inhibiting the expression of Mysm1 gene into a recipient astrocyte to obtain a recombinant astrocyte.

[0031] The substance for inhibiting the expression of Mysm1 gene can be specifically an shRNA.

[0032] Specifically, the shRNA is as shown in SEQ ID NO: 3.

[0033] The substance for inhibiting the expression of Mysm1 gene can be specifically a recombinant lentivirus expressing the shRNA.

[0034] Specifically, the recombinant lentivirus expressing the shRNA is LV-shMysm1-zsgreen-puro recombinant lentivirus.

[0035] Compared with the mitochondria of the recipient astrocyte, the mitochondria of the recombinant astrocyte have the following characteristics (b1) and / or (b2) and / or (b3):

[0036] (b1) the membrane potential is increased;

[0037] (b2) the defense ability against mitochondrial damage caused by inflammatory factor stimulation is enhanced;

[0038] (b3) the repair ability against neuronal oxidative damage is enhanced.

[0039] The inflammatory factor can be specifically TNF-α and / or IL-1β.

[0040] The application also protects a method for preparing mitochondria, which comprises the following steps in sequence:

[0041] (1) preparing a recombinant astrocyte; the recombinant astrocyte is an astrocyte in which the expression of Mysm1 gene is inhibited;

[0042] (2) extracting mitochondria from the recombinant astrocyte.

[0043] The method for preparing the recombinant astrocyte comprises the following steps: introducing a substance for inhibiting expression of Mysm1 gene into a recipient astrocyte to obtain a recombinant astrocyte.

[0044] The substance for inhibiting expression of Mysm1 gene can be specifically shRNA.

[0045] Specifically, the shRNA is as shown in SEQ ID NO: 3.

[0046] The substance for inhibiting expression of Mysm1 gene can be specifically a recombinant lentivirus expressing the shRNA.

[0047] Specifically, the recombinant lentivirus expressing the shRNA is LV-shMysm1-zsgreen-puro recombinant lentivirus.

[0048] Compared with mitochondria of a recipient astrocyte, mitochondria of the recombinant astrocyte have the following characteristics (b1) and / or (b2) and / or (b3):

[0049] (b1) improved membrane potential;

[0050] (b2) enhanced ability to defend against mitochondrial damage caused by stimulation of inflammatory factors;

[0051] (b3) enhanced ability to repair oxidative damage to neurons.

[0052] The inflammatory factors can be specifically TNF-α and / or IL-1β.

[0053] The mitochondria prepared by the method also belong to the protection scope of the present application.

[0054] Compared with mitochondria of a recipient astrocyte, mitochondria of the recombinant astrocyte have the following characteristics (b1) and / or (b2) and / or (b3):

[0055] (b1) improved membrane potential;

[0056] (b2) enhanced ability to defend against mitochondrial damage caused by stimulation of inflammatory factors;

[0057] (b3) enhanced ability to repair oxidative damage to neurons.

[0058] The present application also protects use of the mitochondria in preparation of a medicament for treating oxidative damage to neurons.

[0059] The application also protects a method for preparing a Mysm1 gene expression-inhibited astrocyte, comprising the following steps: introducing a substance for inhibiting Mysm1 gene expression into a recipient astrocyte to obtain a recombinant astrocyte.

[0060] The substance for inhibiting Mysm1 gene expression can be specifically shRNA.

[0061] Specifically, the shRNA is as shown in SEQ ID NO: 3.

[0062] The substance for inhibiting Mysm1 gene expression can be specifically a recombinant lentivirus expressing the shRNA.

[0063] Specifically, the recombinant lentivirus expressing the shRNA is LV-shMysm1-zsgreen-puro recombinant lentivirus.

[0064] The application also protects the recombinant astrocyte prepared by the method.

[0065] The recipient astrocyte can be specifically an ex vivo astrocyte.

[0066] Specifically, the recipient astrocyte can be an astrocyte isolated from an ex vivo mouse brain and obtained by subculture. Specifically, the mouse is a C57BL / 6N suckling mouse.

[0067] Specifically, the recipient astrocyte can be C8-D1A cells.

[0068] The Mysm1 gene is a gene encoding a Mysm1 protein.

[0069] The Mysm1 protein is a histone H2A deubiquitinase.

[0070] Specifically, the Mysm1 protein is a protein with an amino acid sequence as shown in SEQ ID NO: 1.

[0071] Specifically, the Mysm1 gene (cDNA sequence) is as shown in SEQ ID NO: 2.

[0072] Mitochondria exist in most eukaryotes, and are a kind of cell organelle with double-membrane structure. In addition to participating in oxidative phosphorylation to provide energy for the body, mitochondria also maintain calcium homeostasis, generate reactive oxygen species, and participate in cell signal transduction. In recent years, research has found that mitochondrial dysfunction occurs in a variety of diseases such as aging and neurodegenerative diseases, so rescuing mitochondrial function has become a strategy for treating these diseases. There have been reports of animal studies using mitochondrial transplantation to treat neurodegenerative diseases and the like. The present application provides a theoretical basis and material basis for subsequent application of mitochondrial transplantation in the treatment of related diseases. BRIEF DESCRIPTION OF DRAWINGS

[0073] Figure 1 Results of proteomic analysis in Example 4.

[0074] Figure 2 Results of ATP detection and superoxide anion detection of C8-D1A cells in Example 5.

[0075] Figure 3 Results of ATP detection of astrocytes in Example 6.

[0076] Figure 4 Results of factor stimulation of C8-D1A cells in Example 7.

[0077] Figure 5 Results of Western blot experiment in Example 8.

[0078] Figure 6 Results of rescuing glutamate damage to HT22 cells by mitochondria in Example 9. DETAILED DESCRIPTION

[0079] The application will be further described in conjunction with the specific embodiments, and the examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0080] The experimental methods in the following examples are all conventional methods, unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The quantitative tests in the following examples are all set up with more than three repeated experiments, unless otherwise specified, and the results are averaged. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially. FBS: ExCell Bio, product number 12B013. DMEM-F12 medium: Sigma, product number D8437. Polylysine: Sigma, product number P6407. PEI (polyethylenimine): Polysciences, product number 23966. DMEM medium: Thermo Fisher Scientific, product number D6429. 25x polybrene: Hanheng Biotechnology (Shanghai) Co., Ltd., batch number 20210810. C8-D1A cells (C8-D1A mouse brain astrocytes): Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd. product, product number ZQ0566. ATP detection kit: Biyun Tian, product number S0026. Dihydroethidium (superoxide anion fluorescent probe): Biyun Tian, product number S0063. Cell mitochondria isolation kit: Biyun Tian, product number C3601. Mito-Tracker Red CMXRos (mitochondrial red fluorescent probe): Biyun Tian, product number C1049B. PBS buffer (pH 7.2-7.8): Boerder Biological Engineering Co., Ltd., product number AR0030.

[0081] LV-shMysm1-zsgreen-puro recombinant lentivirus: Hanheng Biotechnology (Shanghai) Co., Ltd. The LV-shMysm1-zsgreen-puro recombinant lentivirus expresses ZsGreen green fluorescent protein and expresses shRNA for reducing the expression amount of Mysm1 gene (the shRNA is named shMysm1, as shown in SEQ ID NO: 3).

[0082] LV-zsgreen-puro recombinant lentivirus: Hanheng Biotechnology (Shanghai) Co., Ltd. The difference between the LV-zsgreen-puro recombinant lentivirus and the LV-shMysm1-zsgreen-puro recombinant lentivirus is only that the genomic DNA lacks the nucleotides encoding the RNA segment shown in SEQ ID NO: 3.

[0083] Mysm1 is a protein with an amino acid sequence as shown in SEQ ID NO: 1. The Mysm1 gene (cDNA sequence) is shown in SEQ ID NO: 2.

[0084] shMysm1 (SEQ ID NO: 3):

[0085] GAUCCG CCACCAAUCAAGGAGAAUUAU cucgag AUAAUUCUCCUUGAUUGGUGG UUUUUUG.

[0086] Example 1, Preparation of astrocytes

[0087] 1. Take C57BL / 6N newborn mice within 24h, soak them in 75% alcohol for disinfection, then take out the brain under sterile conditions and place it in pre-cooled PBS buffer, remove the meninges and blood vessels under a dissecting microscope, and separate the brain tissue.

[0088] 2. After completing step 1, blow the brain tissue with a gun head, then digest with 0.25% trypsin solution (containing EDTA) at 37°C for 5 min, then add DMEM-F12 medium containing 10% FBS to terminate digestion, blow with a gun head, then mechanically filter with a double-layer screen (100 mesh on top, 200 mesh on bottom), collect the filtrate, which is a single cell suspension.

[0089] 3. Take the single cell suspension obtained in step 2, centrifuge at 1000 rpm for 5 min, discard the supernatant, blow the cells with DMEM-F12 medium containing 10% FBS, then inoculate into a cell culture dish previously coated with polylysine (at this time, the cells in the culture dish are P0 generation astrocytes).

[0090] 4. After completing step 3, place the cell culture dish in a 37°C cell culture incubator containing 5% CO2 and culture until the cell confluence reaches 70% (during the culture process, replace the new DMEM-F12 medium containing 10% FBS every 3 days).

[0091] 5. After completing step 4, discard the culture supernatant, add 0.25% trypsin solution (containing EDTA) at 37°C for 5 min, then add DMEM-F12 medium containing 10% FBS to terminate digestion, then centrifuge at 1000 rpm for 5 min, discard the supernatant, blow the cells with DMEM-F12 medium containing 10% FBS, then inoculate into a cell culture dish previously coated with polylysine (at this time, the cells in the culture dish are P1 generation astrocytes). Then, place the cell culture dish in a 37°C cell culture incubator containing 5% CO2 and culture until the cell confluence reaches 70% (during the culture process, replace the new DMEM-F12 medium containing 10% FBS every 3 days).

[0092] 6、After step 5, discard the culture supernatant, add 0.25% trypsin solution (containing EDTA) and incubate at 37°C for 5 minutes, then add DMEM-F12 medium containing 10% FBS to terminate the digestion, then centrifuge at 1000 rpm for 5 minutes, discard the supernatant, add DMEM-F12 medium containing 10% FBS to the precipitate to disperse the cells, then inoculate into a cell culture dish previously coated with polylysine (at this time, the cells in the culture dish are P2 generation astrocytes). Then, place the cell culture dish in a 37°C cell incubator containing 5% CO2 (during the culture process, replace the new DMEM-F12 medium containing 10% FBS every 3 days).

[0093] P2 generation astrocytes are used for subsequent experiments, and are denoted as Astrocyte.

[0094] Example 2, recombinant lentivirus infection of Astrocyte

[0095] 1、Inoculate Astrocyte into a six-well plate (2x10 5 cells / well), culture with DMEM-F12 medium containing 10% FBS to 50-70% confluence, then discard the culture supernatant.

[0096] 2、After step 1, add LV-shMysml virus infection solution (1 mL / well, MOI value is 20) to the test well, add LV-Con virus infection solution (1 mL / well, MOI value is 20) to the control well, and incubate in a 37°C cell incubator containing 5% CO2 for 4 hours, then add DMEM-F12 medium containing 10% FBS (1 mL / well) and continue to culture for 20 hours.

[0097] Preparation method of LV-shMysml virus infection solution: add LV-shMysml-zsgreen-puro recombinant lentivirus and 25x polybrene to 37°C preheated DMEM-F12 medium to make the concentration of polybrene 1x.

[0098] Preparation method of LV-Con virus infection solution: add LV-zsgreen-puro recombinant lentivirus and 25x polybrene to 37°C preheated DMEM-F12 medium to make the concentration of polybrene 1x.

[0099] 3、After step 2, discard the culture supernatant, add DMEM-F12 medium containing 10% FBS to each well, and incubate in a 37°C cell incubator containing 5% CO2. A large number of GFP expression can be observed after 48-72 hours of virus infection of the cells.

[0100] The cells in the test wells cultured for 24 hours in Step 3 were treated with Astrocyte shMysm1 .

[0101] The cells in the control wells cultured for 24 hours in Step 3 were treated with Astrocyte Con .

[0102] The cells used in the following examples were respectively used as test cells.

[0103] Example 3, Recombinant lentivirus infection of C8-D1A cells

[0104] C8-D1A cells were used instead of Astrocyte, DMEM medium was used instead of DMEM-F12 medium, and the rest was the same as in Example 2.

[0105] The cells in the test wells cultured for 24 hours in Step 3 were treated with C8-D1A shMysm1 .

[0106] The cells in the control wells cultured for 24 hours in Step 3 were treated with C8-D1A Con .

[0107] The cells used in the following examples were respectively used as test cells.

[0108] Example 4, Proteomics analysis

[0109] Test cells: C8-D1A shMysm1 or C8-D1A Con .

[0110] The test cells were taken, total proteins were extracted, and a total protein solution of the cells was obtained.

[0111] Part of the total protein solution of the cells was taken, the protein concentration was detected, and SDS-PAGE was performed.

[0112] Part of the total protein solution of the cells was taken, trypsin digestion and labeling were first performed, then an equal amount of each labeled sample was mixed and subjected to chromatographic separation, and finally LC-MS / MS analysis and data analysis were performed. The identified proteins were subjected to functional annotation analysis using common databases. The differential proteins screened were subjected to GO analysis, Pathway analysis, and interaction analysis, and at the same time, correlation analysis, expression pattern clustering heat map, and venn analysis were performed on the differential comparison group data. In addition, according to the data, the correlation or interested part was studied, and the key proteins and their functions or pathways were selected for subsequent key research and verification direction.

[0113] The results are shown in Figure 1 . Figure 1 The a graph of Figure 1 shows the comparison of C8-D1A shMysm1 and C8-D1A ConVolcano plot of differentially expressed genes; gray indicates single genes with no significant changes (P<0.05, false discovery rate (FDR)q<0.05); red and blue indicate single genes that are upregulated and downregulated, respectively (P<0.05, FDRq<0.05). Figure 1 Figure b is C8-D1A shMysm1 and C8-D1A Con Heatmap. Figure 1 Figure c shows the enrichment of differentially expressed genes in the pathway as revealed by GO enrichment analysis. Figure 1 The d-figure shows the enrichment of differentially expressed genes in each pathway using the KEGG enrichment pathway.

[0114] The results show that: compared with C8-D1A Con Compared to C8-D1A shMysm1 Increased expression of respiratory chain complex IV-related molecules, and KEGG enrichment pathway showed significant upregulation of oxidative phosphorylation and tricarboxylic acid cycle.

[0115] Example 5: ATP detection and superoxide anion detection in C8-D1A cells

[0116] Test cells: C8-D1A cells (denoted as NC) before viral infection or C8-D1A cells. Con (Represented by Con).

[0117] I. ATP Detection

[0118] Take test cells and use the ATP assay kit according to the instructions.

[0119] See results Figure 2 a.

[0120] II. Detection of Superoxide Anions

[0121] Take the test cells, incubate them in Dihydroethidium working solution at 37°C for 30 min, and then observe them by taking pictures with a fluorescence microscope.

[0122] Dihydroethidium is prepared as a 10 mM stock solution using DMSO. Before use, dilute the stock solution with DMEM medium to a Dihydroethidium concentration of 5 μM, which is the working solution.

[0123] See results Figure 2 b.

[0124] The results of Step 1 and Step 2 show that the ATP content and superoxide anion content of C8-D1A cells infected with LV-zsgreen-puro recombinant lentivirus do not change significantly compared with C8-D1A cells before infection with virus. The results show that infection with recombinant lentivirus has no significant effect on the metabolism of C8-D1A cells.

[0125] Example 6, ATP detection of astrocytes

[0126] I. ATP detection

[0127] Tested cell: Astrocyte shMysm1 or Astrocyte Con or C8-D1A shMysm1 or C8-D1A Con .

[0128] Collection of cell culture supernatant of tested cell: The cell culture supernatant of tested cell was collected.

[0129] The tested cell or the cell culture supernatant of tested cell was taken, and an ATP detection kit was used and operated according to the instructions.

[0130] The relevant results of Astrocyte are shown in Figure 3 a. The relevant results of C8-D1A cells are shown in Figure 3 b.

[0131] The results show that the ATP content of test cell (shMysm1) is significantly increased compared with control cell (Con).

[0132] II. Mitochondrial labeling

[0133] Tested cell: C8-D1A shMysm1 or C8-D1A Con .

[0134] 1. Mitochondrial isolation and extraction

[0135] The tested cell was taken, and a cell mitochondrial isolation kit was used and operated according to the instructions to obtain mitochondria.

[0136] 2. Mitochondrial labeling

[0137] The mitochondria were taken and incubated in Mito-Tracker Red CMXRos working solution at 37℃ for 30 min, and then photographed and observed under fluorescence microscope.

[0138] Mito-Tracker Red CMXRos was prepared into 200μM stock solution with DMSO; when used, it was diluted into 100nM working solution with DMEM culture medium.

[0139] Results are shown in Figure 3 c. The results show that C8-D1A Con cells have stronger fluorescence intensity than C8-D1A shMysm1 cells, indicating that the mitochondrial membrane potential of the test cells (shMysm1) is higher than that of the control cells (Con).

[0140] Example 7, Factor stimulation of C8-D1A cells

[0141] Test cells: C8-D1A shMysm1 or C8-D1A Con cells.

[0142] Cell culture was carried out in a 37°C cell culture incubator containing 5% CO2.

[0143] The test cells were inoculated into a 24-well plate (5 x 10 4 cells / well) and cultured in DMEM medium until the cells were completely adherent, then 120 ng / mL TNF-α and 40 ng / mL IL-1β were added to the DMEM medium, and then cultured for 24 hours. Then the mitochondrial morphology of the cells was observed under a transmission electron microscope.

[0144] The electron microscope images were analyzed using ImageJ software. The shape factor consisting of P 2 / 4πA(p, perimeter and A, area) was applied to the mitochondria. The mitochondria were given an aspect ratio consisting of d max / d min (d, dome).

[0145] Results are shown in Figure 4 . The results show that shMysm1 can rescue the mitochondrial morphological damage of C8-D1A cells caused by inflammatory stimulation.

[0146] Example 8, Western blot

[0147] Test cells: Astrocyte shMysm1 or Astrocyte Con or C8-D1A shMysm1 or C8-D1A Con cells.

[0148] The total protein was extracted from the test cells, and then Western blot was performed. The Western blot used a primary antibody for each target. The primary antibodies were all commercially available products. The targets were: GAPDH, Mysm1, pgc1a, Sirt1, p-mTOR, mTOR, p-p53, p53, p-AMPK, and AMPK. GAPDH primary antibody: Abclonal. Mysm1 primary antibody: Abeam. AMPK primary antibody: Cell Signal Technology.

[0149] The results are shown in Figure 5 . The results show that knocking out Mysm1 in astrocytes can activate p-P53 and p-AMPK and inhibit p-mTOR expression; knocking out Mysm1 in C8-D1A can activate p-P53 and p-AMPK and inhibit p-mTOR expression.

[0150] Example 9, Mitochondrial Rescue Glutamate Damage to HT22 Cells

[0151] HT22 cells are an immortalized cell line derived from mouse hippocampal neurons. Glutamate can induce oxidative stress and cell death in them, so they are a good cell model for studying oxidative damage to neurons.

[0152] 1. Mitochondrial isolation and extraction

[0153] C8-D1A shMysm1 was taken, and a cell mitochondrial isolation kit was used according to the instructions to obtain C8-D1A shMysm1 mitochondria.

[0154] C8-D1A Con was taken, and a cell mitochondrial isolation kit was used according to the instructions to obtain C8-D1A Con mitochondria.

[0155] 2. HT22 cells were seeded into a 24-well plate (5 x 10 4 cells / well), and DMEM medium was used for culture for 24 hours.

[0156] 3. After step 2 was completed, the culture supernatant was discarded, shMysm1 DMEM medium containing 20 mM glutamate and 2 ng / μL C8-D1A shMysm1 mitochondria was added to the drug wells, DMEM medium containing 20 mM glutamate was added to the model wells, and DMEM medium was added to the cell wells, and then cultured for 24 hours. Con DMEM medium containing 20 mM glutamate and 2 ng / μL C8-D1A Con mitochondria was added to the drug wells, DMEM medium containing 20 mM glutamate was added to the model wells, and DMEM medium was added to the cell wells, and then cultured for 24 hours.

[0157] 4. After step 3, observe under light microscope.

[0158] See Fig. 2a. Figure 6 C8-D1A shMysm1 Mitochondria rescued the damage of glutamate to HT22. C8-D1A Con Mitochondria also rescued the damage of glutamate to HT22 to some extent, but the effect was not as good as C8-D1A shMysm1 Mitochondria, there was a significant difference in effect.

[0159] 5. Immunofluorescence

[0160] Fixing solution: 4% paraformaldehyde solution. Blocking solution: PBS buffer containing 0.3% Triton X-100 and 5% normal goat serum and 3% bovine serum albumin. Primary antibody working solution: mix rabbit MAP2 antibody (abcam, ab32454) with blocking solution at a volume ratio of 1:200 to obtain the primary antibody working solution. Secondary antibody working solution: mix Goat Anti-Rabbit Alexa Fluor 488 IgG (H+L) (Invitrogen) with blocking solution at a volume ratio of 1:200 to obtain the secondary antibody working solution.

[0161] After step 3, aspirate the culture supernatant and wash three times with PBS buffer; then, add fixing solution and fix at room temperature for 30 min, wash three times with PBS buffer; then, add blocking solution and block at room temperature for 1 hour, wash three times with PBS buffer; then, add primary antibody working solution and incubate at 4°C for 12 hours, wash three times with PBS buffer; then, add secondary antibody working solution and incubate at room temperature for 1 hour, wash three times with PBS buffer; then, re-stain with 4', 6-diamidino-2-phenylindole (DAPI, sigma) and collect images under a fluorescence microscope.

[0162] See Fig. 2b. Figure 6

[0163] Count the number of cells in each treatment group, and the results are shown in Fig. 2c. Figure 6

[0164] C8-D1A shMysm1 Mitochondria rescued the damage of glutamate to HT22. C8-D1A Con Mitochondria also rescued the damage of glutamate to HT22 to some extent, but the effect was not as good as C8-D1A shMysm1 Mitochondria, there was a significant difference in effect.

[0165] ​​The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives a special example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including changes made by conventional techniques known in the art, which deviates from the range disclosed in the application. Some basic features can be applied within the scope of the following attached claims.

Claims

1. The use of mitochondria from recombinant astrocytes in the preparation of drugs for treating oxidative damage to hippocampal neurons, wherein the recombinant astrocytes are astrocytes with suppressed expression of the Mysm1 gene.

2. The application of a substance for inhibiting the expression of the Mysm1 gene in astrocytes in the preparation of a product, wherein the product has the following functions (a1) and / or (a2) and / or (a3) ​​and / or (a4) and / or (a5): (a1) Used to increase the mitochondrial membrane potential of astrocytes; (a2) Used to rescue mitochondrial damage in astrocytes caused by inflammatory factor stimulation; (a3) Used to increase the ATP content of astrocytes; (a4) Used to enhance the ability of astrocytes to produce ATP; (a5) Used to enhance the ability of mitochondria in astrocytes to repair oxidative damage to neurons; The substance used to inhibit Mysm1 gene expression is the shRNA shown in SEQ ID NO: 3 or a recombinant lentivirus expressing the shRNA.

3. Application of recombinant astrocytes in the preparation of mitochondria, wherein the recombinant astrocytes are astrocytes in which the expression of the Mysm1 gene is suppressed.

4. A method for preparing mitochondria, comprising the following steps in sequence: (1) Preparation of recombinant astrocytes; the recombinant astrocytes are astrocytes in which the expression of the Mysm1 gene is suppressed; (2) Mitochondria were extracted from the recombinant astrocytes.

5. Mitochondria prepared by the method of claim 4.

6. The mitochondria as described in claim 5, characterized in that: The mitochondria have the following characteristics (b1) and / or (b2) and / or (b3): (b1) Increased membrane potential; (b2) Enhanced defense against mitochondrial damage caused by inflammatory factors; (b3) Enhanced ability to repair neuronal oxidative damage.

7. Use of the mitochondria as described in claim 5 or 6 in the preparation of a medicament for treating oxidative damage to hippocampal neurons.

8. A method for preparing astrocytes with suppressed expression of the Mysm1 gene, comprising the following steps: introducing a substance for suppressing the expression of the Mysm1 gene into recipient astrocytes to obtain recombinant astrocytes; wherein the substance for suppressing the expression of the Mysm1 gene is shRNA as shown in SEQ ID NO: 3 or a recombinant lentivirus expressing the shRNA.

9. Recombinant astrocytes prepared by the method of claim 8.

Citation Information

Patent Citations

  • Targeted nanometer mitochondria in ischemic brain region as well as preparation method and application thereof

    CN115212188A

  • Targeting chromatin modifiers for the treatment of medical conditions

    US20160046946A1