D-allulose 3-epimerase mutants with improved thermal stability and use thereof
By mutating the amino acid sequence of D-allulose 3-epimerase, a heat-resistant D-allulose 3-epimerase mutant was constructed, solving the problems of low catalytic activity and poor temperature stability of DAE enzyme, and realizing the industrial application of efficient preparation of D-allulose.
Patent Information
- Application Number
- CN202211704765.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-29
- Publication Date
- 2026-02-13
- Estimated Expiration
- 2042-12-29
AI Technical Summary
Existing D-allulose 3-epimerase (DAE enzyme) has low catalytic activity and poor temperature stability, making it difficult to meet the needs of industrial production of D-allulose.
By performing a single mutation on the amino acid sequence of D-allulose 3-epimerase, alanine at position 13 was mutated to serine, thus constructing a D-allulose 3-epimerase mutant. This mutant was then expressed in Escherichia coli, and D-allulose was prepared by microbial catalytic D-fructose isomerization using recombinant bacteria.
The enzyme's thermal stability and catalytic activity have been improved. The mutant enzyme exhibits a longer half-life and higher conversion efficiency at high temperatures, expanding the enzyme's application temperature range and reducing the waste problems associated with chemical synthesis methods, thus showing promising industrial application prospects.
Smart Images

Figure CN116004598B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a D-psicose 3-epimerase mutant with improved thermal stability and its encoding gene, and its application in microbial catalysis of D-psicose isomerization to prepare a D-fructose and D-psicose mixture. BACKGROUND
[0002] D-psicose is a C-3 epimer of D-fructose. In stereochemistry, a stereoisomer containing multiple chiral carbon atoms, a diastereomer with the same configuration of all chiral carbon atoms except for one chiral carbon atom, is called an epimer, also known as an epimeric stereoisomer. Recent studies have shown that D-psicose, as a new type of functional rare sugar, has many physiological functions and important application potential in diet, medicine, health care and other fields, attracting the attention of more and more scientists at home and abroad. Therefore, developing natural and healthy rare sugars to replace existing sweeteners has become a research hotspot. The Japanese Ministry of Health, Labour and Welfare approved the application of D-psicose in food production, registered the trademark of D-psicose in 2011, and formally applied for a specific health food. The U.S. Food and Drug Administration (FDA) also identified D-psicose as a food safety grade GRAS.
[0003] Currently, the most effective method for producing D-psicose is biological method, which is to find an enzyme that can convert D-fructose to D-psicose. However, the current DAE enzyme has low catalytic activity on fructose and poor temperature stability, which is not suitable for industrial production of D-psicose. With the increasing market demand for D-psicose, the development of high-efficiency biological catalysts is crucial for its industrial application.
[0004] To meet the needs of industrial application, different properties of D-psicose 3-epimerase based on protein engineering technology have been studied for enzyme molecular thermal stability modification. Based on computer-aided enzyme thermal stability molecular modification, it is also important to meet the growing demand of the public for sugar. Therefore, the development of DAE enzymes with high catalytic activity and good temperature stability is of great significance for the production of D-psicose. SUMMARY
[0005] The present application relates to a D-psicose 3-epimerase mutant and its encoding gene, and its application in microbial catalysis of D-psicose isomerization to prepare a D-fructose and D-psicose mixture.
[0006] The technical solution adopted by the present application is:
[0007] A D-psicose 3-epimerase mutant is obtained by single mutation of the amino acid sequence shown in SEQ ID NO. 2 at position 13.
[0008] Preferably, the D-psicose 3-epimerase mutant is an alanine mutation to serine at position 13 of the amino acid sequence shown in SEQ ID NO. 2 (nucleotide sequence is SEQ ID NO. 3 and amino acid sequence is SEQ ID NO. 4).
[0009] Due to the specificity of the amino acid sequence, any polypeptide variant of the amino acid sequence shown in SEQ ID NO. 4, such as a conservative variant, a biologically active fragment or a derivative, as long as the polypeptide fragment or polypeptide variant has more than 95% homology with the aforementioned amino acid sequence, falls within the scope of the present application. The changes can include deletion, insertion or substitution of amino acids in the amino acid sequence; for conservative changes of the variant, the substituted amino acid has similar structure or chemical properties as the original amino acid, such as substitution of leucine for isoleucine, and the variant can also have non-conservative changes, such as substitution of tryptophan for glycine.
[0010] The present application also relates to a gene encoding the D-psicose 3-epimerase mutant.
[0011] Due to the specificity of the nucleotide sequence, any polynucleotide variant of the polynucleotide shown in SEQ ID NO. 3, as long as it has more than 95% homology with the polynucleotide, falls within the scope of the present application. The polynucleotide variant refers to a polynucleotide sequence with one or more nucleotide changes. This polynucleotide variant can be an allelic variant or a non-allelic variant, including substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is a substitution form of a polynucleotide, which can be a substitution, deletion or insertion of one or more nucleotides, but does not substantially change the function of the encoded amino acid.
[0012] The present application also relates to a recombinant bacterium containing the gene encoding the D-psicose 3-epimerase mutant.
[0013] The present application also relates to the use of the D-psicose 3-epimerase mutant in microbial catalysis of D-fructose isomerization to prepare D-psicose. A recombinant vector containing the D-psicose 3-epimerase gene is constructed, the recombinant vector is transformed into E. coli, and the obtained recombinant genetically engineered bacteria are induced to culture, and the bacterial cells containing D-psicose 3-epimerase obtained by separation of the culture solution can be used as an enzyme source for microbial catalysis of D-fructose isomerization to prepare D-psicose.
[0014] Specifically, the application involves using wet cells obtained by fermentation-induced culture of recombinant genetically engineered bacteria containing the D-allulose 3-epimerase mutant gene as the enzyme source, D-fructose as the substrate, cobalt ions as the co-catalyst, and a pH 8.0 buffer solution as the reaction medium. The reaction is carried out at 50-80 °C and 100-200 r / min until the reaction is complete, resulting in a mixture of D-fructose and D-allulose.
[0015] In the reaction system, the amount of wet bacterial cells is 10~70 g / L, preferably 25 g / L, the final concentration of cobalt ions is 0.1~10 mM, preferably 1 mM, and the initial concentration of substrate is 50~500 g / L, preferably 100 g / L.
[0016] The wet bacterial cells were prepared as follows: recombinant genetically engineered bacteria containing the D-allulose 3-epimerase mutant gene were inoculated into LB liquid medium containing a final concentration of 50 μg / mL kanamycin and cultured at 37 ℃ and 200 r / min until OD. 600 =0.8~1.0, to obtain seed culture; the seed culture was transferred into LB liquid medium containing 50 μg / mL kanamycin at an inoculum concentration of 1~5% (v / v), and cultured at 37 ℃ and 180 r / min until OD. 600 =0.6~0.8, add IPTG to a final concentration of 0.1 mM, and induce culture at 28 ℃ and 180 r / min for 12~14 h to obtain the induced culture suspension. Centrifuge the induced culture suspension to collect the wet cells.
[0017] The method for screening, expressing, and measuring the enzyme activity of the D-allulose 3-epimerase mutant described in this invention is as follows:
[0018] (1) Screening of recombinant bacteria: The recombinant expression plasmid pET-28a-CbDAE carries a kanamycin resistance gene. If the recombinant plasmid has been transformed into Escherichia coli, the recombinant strain will be kanamycin resistant and will be able to grow on a plate containing 50 μg / mL kanamycin. Positive transformants are selected, which are D-alokulose 3-epimerase recombinant bacteria BL21(DE3) / pET-28a-CbDAE.
[0019] (2) Construction of D-allulose 3-epimerase mutant expression strain
[0020] According to the source Christensenellaceae bacteriumThe gene sequence of the original enzyme CbDAE (the nucleotide sequence of CbDAE is shown as SEQ ID NO. 1, and the amino acid sequence is shown as SEQ ID NO. 2) is designed to mutate the mutant primer, and the mutant PCR is carried out by using the plasmid of recombinant bacteria BL21 (DE3) / pET-28a-CbDAE as a template. The 13th alanine is mutated to serine. The mutant plasmid is digested by Dpn I and then transformed into E. coli. The recombinant strain has kanamycin resistance and can grow on a plate containing 50 μg / mL kanamycin. The positive transformant is sequenced, and the sequence shows that the 13th site is successfully mutated, that is, the D-allulose 3-epimerase mutant bacteria BL21 (DE3) / pET-28a-CbDAE / A13S.
[0021] (3) Recombinant mutant bacteria expressing D-allulose 3-epimerase
[0022] The composition of LB liquid medium (g / L) is as follows: tryptone 10, yeast powder 5, NaCl 10, and the solvent is ultrapure water; LB solid medium is added with 20 g / L agar; high pressure sterilization; 50 μg / mL kanamycin is added before use.
[0023] The D-allulose 3-epimerase mutant bacteria are inoculated into LB liquid medium with a final concentration of 50 μg / mL kanamycin, and the liquid volume is 10 mL. The culture temperature is 37 ℃, and the shaking speed is 200 r / min. The culture is cultured to OD 600 =0.8-1.0, and the seed liquid is obtained; the seed liquid is inoculated into a 500 mL conical flask containing 100 mL of LB liquid medium with a final concentration of 50 μg / mL kanamycin at a volume concentration of 1%, and cultured at 37 ℃ and 180 r / min for 2-3 h (OD 600 =0.6-0.8). The final concentration of 0.1 mM IPTG is added, and then the induction culture is carried out at 28 ℃ and 180 r / min for 13 h to obtain the induced culture suspension. The induced culture liquid is centrifuged at 4 ℃ and 8000 r / min for 10 min, and then placed in a refrigerator at -20 ℃ for freezing.
[0024] (4) D-allulose 3-epimerase enzyme activity and yield determination
[0025] 0.25 g of bacteria is dissolved in 10 mL of 50 mM Tris-Hcl buffer solution (pH 9.0), and the suspended bacteria are mixed well. The final concentration of 1 mM Co 2+D-fructose, final concentration 100 g / L, sampling at 10 min and 3 h under the condition of 80 ℃, 600 rpm / min, reaction terminated by ice bath for 10 min, centrifugation at 12000 r / min for 1 min, and the supernatant was diluted 10 times;
[0026] HPLC detection condition: Agilent 1260 HPLC chromatograph, Agilent automatic sampler, sugar-park chromatographic column, Agilent differential detector, mobile phase of ultrapure water, column temperature set to 75 ℃, flow rate of 0.4 mL / min, external standard method, and the yield of D-psicose was determined according to the retention time and peak area of the peak. Enzyme activity definition: the amount of enzyme required to isomerize 1 μmol of D-fructose to D-psicose per minute at 80 ℃ and pH 9.0 is defined as one enzyme unit (U). Yield (%) is defined as the ratio of the concentration of D-psicose sampled at 3 h to the initial concentration of D-fructose.
[0027] The D-psicose 3-epimerase and the mutant of the application can tolerate high temperature of 40-70 ℃, and when the substrate concentration is 100 g / L and the reaction temperature is 80 ℃, the enzyme activity of the wild-type D-psicose 3-epimerase reaches 223.5 U / (g·wet cell weight), and the conversion rate reaches 29.2%; the enzyme activity of the D-psicose 3-epimerase mutant reaches 275.6 U / (g·wet cell weight), and the conversion rate reaches 31.2%.
[0028] The beneficial effects of the application mainly include: the application screens a high-temperature-resistant D-psicose 3-epimerase mutant, enhances the half-life of the mutant enzyme, improves the substrate affinity and conversion efficiency of the enzyme for the substrate D-fructose used in the synthesis of D-psicose, and the t 1 / 2 value of mutant enzyme A13S at 50 ℃ is 300 min, and the T m value is increased from 55.1 ℃ of the wild enzyme to 60.8 ℃, and the optimal temperature of the mutant enzyme is increased to 80 ℃, which is increased by 20 ℃ compared with the wild enzyme; the application improves the short half-life of the wild enzyme at high temperature by mutation, the mutant enzyme has a long relative action time, expands the relatively scarce enzyme library, and shows the technical advantages of D-fructose in the synthesis of D-psicose 3-epimerase, such as green environmental protection, low toxicity, and less by-products, overcomes the problem of three wastes in chemical synthesis, and has important industrial application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0029] Figure 1 Optimal reaction temperature of mutant enzyme CbDAE / A13S.
[0030] Figure 2 Optimum metal ion of mutant enzyme CbDAE / A13S.
[0031] Figure 3 T of pure enzyme of mutant enzyme CbDAE / A13S m Figure. DETAILED DESCRIPTION
[0032] In order to deepen the understanding of the present application, the present application will be further described in detail below in combination with specific examples, which are only used to explain the present application and do not constitute a limitation to the protection scope of the present application.
[0033] Example 1: Construction of D-allulose 3-epimerase unit point mutant library
[0034] According to the gene sequence of the original enzyme CbDAE (amino acid sequence is SEQ ID NO. 2, nucleotide sequence is SEQ ID NO. 1), a mutation primer for site-directed mutagenesis was designed, and a single mutation was introduced at the 13th and 148th positions by using rapid PCR technology with the recombinant vector pET28a / CbDAE as a template. The designed primers are as follows:
[0035] Forward primer A13S: CCTACTGGGAACAG AGC TGGGCCGCCGACTA (underlined as mutation base)
[0036] Reverse primer A13S: ACAGGTAGTCGGCGGCCCA GCT CTGTTCC (underlined as mutation base)
[0037] Forward primer G148M: TGATCTG ATG ATGGAGATTCTGAATCGTTTTGAA (underlined as mutation base)
[0038] Reverse primer G148M: TCTCCAT CAT CAGATCAATCCCATAATCTGCGG (underlined as mutation base)
[0039] The PCR reaction system (50 μL) is as follows: 2×Phanta Max Buffer 25 μL, dNTPs 1 μL, forward primer 2 μL (5 pmol / μL), reverse primer 2 μL (5 pmol / μL), template DNA 1 μL (20 ng / μL), Phanta Max Super-Fidelity DNA Polymerase 1 μL, and ddH2O is added to 50 μL.
[0040] PCR reaction program was 95 ℃ pre-denaturation 5 min; 30 cycles (95 ℃ denaturation 10 s, 55-60 ℃ annealing 15 s, 72 ℃ extension 5.5 min); 72 ℃ extension 10 min, finally 16 ℃ incubation, PCR product was verified by 0.9% agarose gel electrophoresis, and the result was that the amplified gene fragment was consistent with the size of the target vector, so that the next step experiment could be carried out.
[0041] After the PCR product was digested with Dpn I at 37 ℃ for 3 h, 3 μL of the PCR product was taken and added to 100 μL of ice-bath E. coli The transformation product was heat-shocked at 42 ℃ for 90 s, quickly cooled on ice for 5 min, 600 μL of LB liquid medium was added to the tube, and the mixture was cultured at 37 ℃ and 150 r / min for 50 min. After centrifugation at 12000 r / min for 1 min, 400 μL of supernatant was discarded and the bacterial suspension was resuspended. 100 μL of the resuspended liquid was spread on LB solid medium containing 50 μg / mL of kanamycin, and after the bacterial liquid was completely absorbed by the medium, it was cultured at 37 ℃ for 12 h. A colony was picked and inoculated in 10 mL of LB liquid medium containing 50 μg / mL of kanamycin, and the mixture was cultured at 37 ℃ for 12 h to obtain the respective bacterial liquid.
[0042] The bacterial liquid was sent to Beijing Qianke Biological Co., Ltd. for sequencing, and the sequencing results were correct, which were the unit point mutant recombinant bacteria E. coli BL21(DE3) / pET28a / CbDAE / A13S and E. coli BL21(DE3) / pET28a / CbDAE / G148M.
[0043] Example 2: Expression of recombinant Escherichia coli
[0044] The D-allulose 3-epimerase CbDAE / A13S and CbDAE / G148M strains in Example 1 were inoculated into 10 mL of LB liquid medium (containing 50 μg / mL of kanamycin) respectively, and cultured at 37 ℃ and 200 r / min until the OD 600 =0.8-1.0, and the seed liquid was inoculated into fresh 100 mL of LB liquid medium containing 50 μg / mL of kanamycin at a volume concentration of 1%, and cultured at 37 ℃ and 180 r / min until the bacterial concentration reached OD 600 =0.6-0.8, and then induced at 28 ℃ and 180 r / min for 13 h.
[0045] After induction culture for 13 h, 1 g of bacterial pellet was suspended in 10 mL of 50 mM Tris-Hcl (pH 9.0) buffer, and was broken by ultrasonic wave (ultrasonic wave for 2 s, pause for 2 s, 30 min). After centrifugation, the purified product was obtained by using a nickel-NTA affinity chromatography column (Bio-Scale Mini Profinity IMAC pre-packed column, 40 mm long x 12.6 mm inner diameter). After purification, the purified enzyme solution was dialyzed overnight in an ultrapure water solution (pH 7.0). 15 μL of the dialyzed purified enzyme solution was mixed with 5 μL of 4X SDS buffer, and was heated in a boiling water bath for 15 min. 8 μL of the mixture was subjected to SDS-PAGE electrophoresis analysis. A protein band with a molecular weight of about 33 kDa was obtained, indicating that the expression of the target protein was successful.
[0046] Example 3: Enzyme activity determination of D-psicose 3-epimerase mutants
[0047] The wild-type D-psicose 3-epimerase CbDAE, the unit point mutant D-psicose 3-epimerase CbDAE / A13S and CbDAE / G148M were induced and expressed according to the method in Example 2, and the enzyme activity of the recombinant mutant bacteria on D-fructose was determined.
[0048] The enzyme activity determination method was as follows: 0.25 g of the bacteria collected in Example 3 was dissolved in 10 mL of 50 mM Tris-Hcl (pH 9.0) buffer, and the bacterial suspension was mixed thoroughly. 1 mM Co 2+ , and 100 g / L of D-fructose was added. The reaction was carried out at 80 ℃ and 600 rpm for 10 min, 1 mL of the reaction solution was sampled, and the reaction was terminated by ice storage for 10 min. The reaction solution was centrifuged at 12000 r / min for 1 min, and the supernatant was diluted 10 times. The diluted solution was filtered through a 0.22 μm water membrane, and the concentrations of D-fructose and D-psicose were determined by HPLC liquid chromatography.
[0049] The HPLC detection conditions were as follows: Agilent 1260 HPLC chromatograph, Agilent automatic sampler, sugar-park chromatographic column, Agilent differential detector, ultrapure water as the mobile phase, column temperature set to 75 ℃, flow rate of 0.4 mL / min, and external standard method. The yield of D-psicose was determined according to the retention time and peak area of the peak.
[0050] Enzyme activity unit definition: The amount of enzyme required to isomerize 1 μmol of D- Psicose from D-fructose per minute at 80 °C and pH 9.0 was defined as one enzyme activity unit (U). The specific enzyme activity of D-psicose 3-epimerase was expressed as enzyme activity units per g of wet cell weight (U / g·wet cell weight), and the results are shown in Table 1. The activity of the recombinant strain CbDAE / A13S of the D-psicose 3-epimerase site mutant was 1.23 times that of the wild-type D-psicose 3-epimerase, reaching 275.6 U / (g·wet cell weight), while the activity of the recombinant strain CbDAE / G148M of the mutant was only 0.87 times that of the wild-type D-psicose 3-epimerase.
[0051] Table 1: Enzyme activity of D-psicose 3-epimerase and its mutants
[0052]
[0053] Example 4: Determination of kinetic constants of D-psicose 3-epimerase and its mutants
[0054] Purification of recombinant mutant enzymes: The wild-type D-psicose 3-epimerase CbDAE and the mutant D-psicose 3-epimerase CbDAE / A13S in Example 1 were induced and expressed according to the method in Example 2. After 12 h of induction, the bacteria were collected by centrifugation at 8000 r / min for 10 min, and the supernatant was discarded. The bacteria were then washed once with 50 mM Tris-Hcl (pH 9.0) buffer and collected under the same conditions. A certain amount of bacteria was suspended in 100 g of bacteria / L Tris-Hcl (pH 9.0) buffer, sonicated, and centrifuged at 8000 r / min for 10 min. The supernatant was collected and used as the crude enzyme solution. The crude enzyme solution was then purified by a nickel-NTA affinity chromatography column (Bio-Scale Mini Profinity IMAC pre-packed column, 40 mm long x 12.6 mm inner diameter). The purified enzyme solution was collected and tested for protein concentration using a BCA kit, which was found to be 2.72 mg / mL. This purified enzyme was used to determine the kinetic constants for the catalysis of the substrates D-fructose and D-psicose.
[0055] The reaction system was as follows: the initial substrate concentrations of D-fructose and D-allulose were 20-600 mM, with cobalt ions (1 mM) as a co-catalyst and 50 mM Tris-HCl (pH 9.0) buffer as the reaction medium. The reaction was carried out at 80 ℃ and 600 r / min for 10 min. The reaction solution was then separated and purified, and the kinetic constants were calculated by fitting the amounts of D-fructose and D-allulose produced. The results are shown in Table 2. The results show that the single-point mutation CbDAE / A13S improves the affinity for the substrate.
[0056] Table 2: Determination of enzyme kinetic parameters
[0057]
[0058] Example 5: Determination of the thermostability of D-allulose 3-epimerase mutant
[0059] The original strain and mutant CbDAE / A13S of D-allulose 3-epimerase were purified. The collected purified enzyme solution was used to catalyze the isomerization reaction of the substrate D-fructose to prepare D-allulose. The reaction system consisted of 50 mM Tris-HCl (pH 9.0) buffer, 100 g / L D-fructose, and 0.03 mg / mL purified enzyme solution, totaling 1 mL. The reaction conditions were: incubation at 50 °C for 420 min, with enzyme samples taken every 10 min to a final concentration of 0.03 mg / mL and reacted for 10 min. The reaction was terminated by incubating on ice for 10 min, centrifuged at 12000 r / min, diluted 10-fold, and filtered through a 0.22 μm water membrane. The concentrations of D-fructose and D-allulose were determined using the detection method described in Example 3, and the residual enzyme activity was calculated.
[0060] Table 3: Determination of enzyme half-life at 50 °C
[0061]
[0062] Example 6: Determination of the optimal reaction temperature for the D-allulose 3-epimerase mutant CbDAE / A13S
[0063] The purified enzyme solution prepared in Example 4 was used as the enzyme for conversion, and the optimal reaction temperature of the enzyme was determined. The reaction system consisted of 100 g / L D-fructose and 0.04 mg / mL purified enzyme solution, with 50 mM Tris-HCl (pH 9.0) buffer added to a total volume of 1 mL. The reaction was carried out at different temperatures (40, 45, 50, 55, 60, 65, 70, 75, 80, 90 °C) for 10 min, with other conditions following the enzyme activity detection method in Example 3. The results are shown in [Figure 1]. Figure 1As shown in the figure, the optimal reaction temperature for the D-allulose 3-epimerase mutant CbDAE / A13S is 80 °C.
[0064] Example 7: T-allulose 3-epimerase mutant m Value determination
[0065] Wild-type D-allulose 3-epimerase CbDAE and the mutant CbDAE / A13S from Example 1 were purified using the purification method for D-allulose 3-epimerase described in Example 5. The collected purified enzyme solutions were desalted and then analyzed using a circular dichroism spectroscopy (CDS). The results are as follows: Figure 3 As shown, T m The value increased from 55.1 °C for the wild enzyme to 60.8 °C.
[0066] Example 8: Determination of the optimal metal ion for the D-allulose 3-epimerase mutant CbDAE / A13S
[0067] The purified enzyme solution prepared in Example 4 was used as the enzyme for conversion, and the optimal metal ion for enzyme reaction was determined. Reaction system: 100 g / L D-fructose and 0.03 mg / mL purified enzyme solution, then 50 mM Tris-HCl (pH 9.0) buffer was added to a total volume of 1 mL. Different metal ions (EDTA, Mg...) were added... 2+ Co 2+ Mn 2+ Cu 2+ Ca 2+ Zn 2+ Fe 2+ Ba 2+ and Pb 2+ (And without the addition of metal ions, the reaction was carried out at 80 °C for 10 min, with other conditions the same as the enzyme activity detection method in Example 3. The results are shown in the figure.) Figure 2 As shown in the figure, the optimal metal ion for the D-allulose 3-epimerase mutant CbDAE / A13S is Co. 2+ .
[0068] Example 9: Preparation of D-allulose from D-allulose catalyzed by D-allulose 3-epimerase mutant
[0069] The mutant CbDAE / A13S in Example 1 was induced to express according to the method in Example 2. After 13 h of induction culture, the bacterial cells were collected by centrifugation at 8000 r / min for 10 min, the supernatant was discarded, and the bacterial cells were rinsed once with 50 mM Tris-Hcl (pH 9.0) buffer. The bacterial cells were then collected under the same conditions. The wet bacterial cells were collected as the enzyme for transformation, and isomerization reaction was performed with D-fructose as the substrate to prepare D-allulose.
[0070] The specific operation is as follows: 10 mL of 50 mM Tris-Hcl (pH 9.0) buffer, 0.25 g of wet bacterial cells, 50 g / L of D-fructose, 0.7 of boric acid concentration (35 g / L final concentration) and 1 mM Co 2+ After 3 h of reaction at 80℃ and 600 r / min, 1 mL of the reaction solution was centrifuged at 12000 r / min, diluted 10 times, filtered with a 0.22 μm water membrane, and then the concentrations of D-fructose and D-allulose were detected by the detection method in Example 3. The D-allulose 3-epimerase mutant catalyzed the D-fructose to reach equilibrium within 3 h, and the conversion rate was as high as 73.2%.
Claims
1. A D-allulose 3-epimerase mutant, characterized in that... The amino acid sequence of the D-allulose 3-epimerase mutant is shown in SEQ ID NO.
4.
2. The gene encoding the D-allulose 3-epimerase mutant of claim 1.
3. A recombinant bacterium containing the encoding gene of claim 2.
4. The application of the D-allulose 3-epimerase mutant according to claim 1 in the preparation of D-allulose by microbial catalytic D-fructose isomerization.
5. The application as described in claim 4, characterized in that... The application involves using wet cells obtained by shaking-flask fermentation and induction culture of recombinant genetically engineered bacteria containing the D-allulose 3-epimerase mutant gene as the enzyme source, D-fructose as the substrate, cobalt ions as the co-catalyst, and a pH 9.0 buffer solution as the reaction medium. The reaction is carried out at 50–80 °C and 100–200 r / min. After the reaction is complete, a mixture of D-fructose and D-allulose is obtained. In the reaction system, the amount of wet cells is 10–70 g / L, the final concentration of cobalt ions is 0.1–10 mM, and the initial concentration of the substrate is 50–500 g / L.
6. The application as described in claim 5, characterized in that... The wet bacterial cells were prepared as follows: recombinant genetically engineered bacteria containing the D-allulose 3-epimerase mutant gene were inoculated into LB liquid medium containing a final concentration of 50 μg / mL kanamycin and cultured at 37 ℃ and 200 r / min until OD. 600 =0.8~1.0, to obtain seed culture; the seed culture was transferred into LB liquid medium containing 50 μg / mL kanamycin at an inoculum concentration of 1~5% (v / v), and cultured at 37 ℃ and 180 r / min until OD. 600 =0.6~0.8, add IPTG to a final concentration of 0.1 mM, and induce culture at 28 ℃ and 180 r / min for 12~14 h to obtain the induced culture suspension. Centrifuge the induced culture suspension to collect the wet cells.
Citation Information
Patent Citations
Psicose 3-epimerase mutant, engineering bacterium for expressing mutant and application thereof
CN112852795A
D-psicose 3-epimerase with improved thermal stability and mutant
CN115786319A
D-psicose invertase mutant and application thereof
CN119220528A