The transcription factor ScWRKY35 gene of Salvia salvia officinalis and its application

Abstract

The present invention provides a ScWRKY35 gene of a transcription factor of chestnut sage and an application thereof, wherein the nucleotide sequence of the gene is shown in SEQ ID NO. 1. The present invention adopts methods such as bioinformatics and molecular biology to analyze the types and structural characteristics of members of the WRKY family of chestnut sage, obtains a complete ScWRKY35 sequence from the measured transcriptome data, designs primers based on the sequence to clone the gene, and transfers the gene into a plant of the same genus, Salvia miltiorrhiza, obtains transgenic hairy roots carrying the ScWRKY35 gene, and finds that the ScWRKY35 gene is involved in regulating the expression of key enzyme genes in the biosynthesis pathway of phenolic acids, thereby increasing the content of phenolic acids.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a transcription factor ScWRKY35 gene derived from sagebrush and an application thereof. Background Art

[0002] Salvia miltiorrhiza is one of the commonly used bulk medicinal materials. Its main active ingredients are fat-soluble tanshinones and water-soluble phenolic acids. Its medicinal part is the root, which is often used to treat cardiovascular and cerebrovascular diseases. Tanshinones and phenolic acids have important medicinal value, and the demand for Salvia miltiorrhiza is very large. How to improve the quality of medicinal materials and increase the content of medicinal ingredients has received great attention.

[0003] WRKY is one of the top ten transcription factor families in plants and is widely involved in various physiological processes such as plant growth, development, and response to biotic or abiotic stresses. Studies have found that members of this family are involved in the regulation of the synthesis of various secondary metabolites. However, little is known about whether WRKY transcription factors in chestnut sage regulate the synthesis of secondary metabolites.

[0004] Suttipanta studied the hairy roots overexpressing CrWRKY1 and found that the expression levels of key enzyme genes TDC, ZCT1, ZCT2, and ZCT3 related to the biosynthesis of TIAs increased, indicating that CrWRKY1 is likely to be involved in the biosynthesis of TIAs (Suttipanta, N., Pattanaik, S., Kulshrestha, M., et al. The Transcription Factor CrWRKY1 Positively Regulates the Terpenoid Indole Alkaloid Biosynthesis in Catharanthus roseus. Plant Physiology, 2011, 157: 2081-2093.). In tomato (Solanum lycopersicum), SlWRKY73 can activate the expression of three monoterpene synthesis genes SlTPS5, SlTPS3, and SlTPS7, thereby regulating the biosynthesis of terpenes (Spyropoulou, EA, Haring, MA, Schuurink, RC RNA sequencing on Solanum lycopersicum trichomes identifies transcription factors that activate terpene synthase promoters. BMC Genomics, 2014, 15: 1-16.). Summary of the invention

[0005] The invention provides a transcription factor ScWRKY35 gene derived from sage. The gene is derived from sage and can participate in regulating the expression of key enzyme genes in the biosynthesis pathway of phenolic acids, thereby increasing the content of water-soluble phenolic acid (salvianolic acid B).

[0006] The specific technical solutions are as follows:

[0007] The invention provides a sagebrush transcription factor ScWRKY35 gene, and the nucleotide sequence of the gene is shown in SEQ.

[0008] The invention provides a recombinant expression vector comprising the transcription factor ScWRKY35 gene.

[0009] Preferably, the expression vector is pCAMBIA1300-eGFP.

[0010] The invention provides a genetically engineered bacterium comprising the transcription factor ScWRKY35 gene.

[0011] The present invention provides a protein encoded by a ScWRKY35 gene, a transcription factor of Salvia salvia officinalis. The amino acid sequence of the transcription factor is shown in 2.

[0012] The present invention also provides the application of the ScWRKY35 gene, the recombinant expression vector or the genetically engineered bacteria in increasing the content of phenolic acid substances in plants.

[0013] Furthermore, the plant is Salvia miltiorrhiza.

[0014] Furthermore, the phenolic acid substance is salvianolic acid B.

[0015] The present invention also provides a method for increasing the content of phenolic acid substances in hairy roots of Salvia miltiorrhiza, comprising the following steps:

[0016] (1) The ScWRKY35 gene, a transcription factor of Sagebrush, was obtained by gene cloning.

[0017] (2) inserting the ScWRKY35 gene into an expression vector to obtain an overexpression vector of the ScWRKY35 gene;

[0018] (3) The overexpression vector of the ScWRKY35 gene was transformed into rhizogenes competent Agrobacterium to obtain recombinant Agrobacterium, which was then used to infect Salvia miltiorrhiza leaves to obtain transgenic Salvia miltiorrhiza plants.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention adopts bioinformatics, molecular biology and other methods to analyze the types and structural characteristics of WRKY family members of sage, obtains a complete ScWRKY35 sequence from the measured transcriptome data, designs primers based on the sequence to clone the gene, and transfers the gene into a plant of the same genus, Salvia miltiorrhiza, to obtain transgenic hairy roots carrying the ScWRKY35 gene, and finds that the ScWRKY35 gene is involved in regulating the expression of key enzyme genes in the biosynthesis pathway of salvianolic acid B, thereby increasing the content of salvianolic acid B. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the PCR electrophoresis diagram of the cloning of the ScWRKY35 gene of Sage serrata in Example 1.

[0022] Figure 2 The secondary structure prediction diagram of the protein encoded by the transcription factor ScWRKY35 in Example 2;

[0023] Among them, based on the height of the vertical bars, the highest is the α-helix, followed by the extended chain, then the β-turn, and the lowest is the random curl.

[0024] Figure 3 This is the secondary structure prediction peak diagram of the protein encoded by the transcription factor ScWRKY35 in Example 2.

[0025] Figure 4 This is the subcellular localization map of the ScWRKY35 gene in Sagebrush.

[0026] Figure 5 This is the PCR identification image of the positive hairy roots of the ScWRKY35 gene of Sage. DETAILED DESCRIPTION

[0027] The present invention will be further described below in conjunction with specific embodiments. The following are only specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto.

[0028] Example 1 Obtaining the full-length cDNA sequence of the ScWRKY35 gene of Salvia chinensis

[0029] Take 0.15g of fresh chestnut sage root sample, grind it into powder in liquid nitrogen, and use The total RNA was extracted by Universal Plant Total RNA Isolation Kit, and its integrity and concentration were detected by 1% agarose gel electrophoresis and NanoDrop ultra-micro spectrophotometer. The extracted RNA was then converted into cDNA using HiScript III 1st Strand cDNA Synthesis Kit (+ gDNA wiper).

[0030] use Max DNA Polymerase uses cDNA as a template for PCR amplification ( Figure 1 ), the amplification primers are:

[0031] ScWRKY35-F:GGGACGAGCTCGGTACCCGGGATGCAAGAAAGTGATCAGAGTTAT TC, ScWRKY35-R:GTAGTCCATGTCGACTCTAGAAGATAGATTTACAGTAATCCTCTCC.

[0032] 50μL PCR amplification system: 25μL PrimeSTAR Max Premix (2×), 1μL Forward primer, 1μL Reverse primer, 500ng Template cDNA, RNase Free ddH2O added to 50μL. PCR instrument program settings: 98℃ 10s, 60℃ 30s, 72℃ 90s, 32 cycles, 72℃ 5min, 12℃ storage.

[0033] 1% agarose gel electrophoresis to observe whether the target band size is correct. Gel DNA Extraction Mini Kit was used for gel excision and recovery, and the recovered products were sequenced to obtain the gene sequence of Sage ScWRKY35.

[0034] The amino acid sequence of ScWRKY35 gene was analyzed by DNAStar and DNAMAN software. The ORF sequence of ScWRKY35 (nucleotide sequence as shown in SEQ ID NO.1, amino acid sequence as shown in SEQ ID NO.2) is 666bp long, encoding 221 amino acids, including 26 strongly basic amino acids (K, R), 30 strongly acidic amino acids (D, E), 46 hydrophobic amino acids (A, I, L, F, W, V), and 77 polar amino acids (N, C, Q, S, T, Y). The molecular weight was predicted to be 24730.25 and the isoelectric point (pI) was 6.07 using ExPASy online software (https: / / web.expasy.org / protparam / ), indicating that the protein is an acidic protein, with a total number of negatively charged residues (Asp+Glu): 30 and a total number of positively charged residues (Arg+Lys): 26. The instability index (II) was calculated to be 60.72, which classified the protein as unstable. The fat index was 43.71, and the overall average of hydrophilicity was -0.995. The SMART prediction results showed that there was a low copy region (low complexity) located at the position of amino acids 107 to 121, and there was no transmembrane helical region, indicating that it could be expressed in a prokaryotic expression system.

[0035] Example 2 Prediction of secondary and tertiary structures and phylogenetic tree analysis of the ScWRKY35 gene

[0036] The secondary structure prediction of ScWRKY35 using the online software SOPMA (https: / / npsa-prabi.ibcp.fr / cgi-bin / npsa_automat.plpage=npsa_sopma.html) showed that the protein encoded by the ScWRKY35 gene was composed of 23.08% alpha helix, 12.67% extended strand, 4.52% beta turn, and 59.73% random coil. Figure 2 , Figure 3 ), indicating that the random coil structure is the skeleton of protein WRKY35. In the amino acid sequence encoded by the ScWRKY35 gene, serine has the largest number.

[0037] Example 3 Functional verification of the ScWRKY35 gene in Salvia salviae

[0038] The cloned gene and pCAMBIA1300-eGFP vector were linearized using restriction endonucleases SmaI and XbaI from NEB. The linearization system was rCutSmart buffer 5μL, gene or vector 2μg, SmaI 1μL, ddH2O added to 50μL, digested at 25℃ for 2h, and purified and recovered after agarose gel electrophoresis. The gel-recovered product was subjected to the next step of digestion. The digestion system was rCutSmart buffer 5μL, gene or vector 2μg, XbaI 1μL, ddH2O added to 50μL, digested at 25℃ for 2h, and then purified and recovered. The recovered product was ligated with T4 DNA ligase and incubated overnight at 16℃. The ligation system was: 0.03pmol plasmid vector fragment, 0.09pmol target gene fragment, 1μL T4 ligase and 1μL T4 ligase buffer, ddH2O added to 10μL.

[0039] The ligated product was transformed into E. coli DH5α competent cells, and LB medium without antibiotics was added. The cells were shaken for 1 hour and centrifuged at 5000 rpm for 3 minutes. 100 μl of the resuspended cells were spread on LB plates containing 50 ng / μL kanamycin. Single colonies were selected for marking, half of which were used for plaque PCR, and the other half were shaken for bacterial liquid PCR. The correct bands of the two verifications were sent for sequencing. The correct bacterial liquid was shaken, and the plasmid was extracted and stored at -20°C for the next experiment.

[0040] The extracted plasmid was transformed into Agrobacterium tumefaciens GV3101 competent cells, and the collected bacterial solution was resuspended and spread on LB plates containing kanamycin and rifampicin. PCR verification was performed after 2-3 days, positive clones were screened, and the bacteria were shaken and injected into tobacco. The mcherry recombinant strain was shaken. mcherry can express red fluorescent protein, which makes the cell nucleus appear red under a laser confocal microscope. ScWRKY35-eGFP and mcherry recombinant strains were mixed in equal volumes and injected into tobacco. The fluorescence results were observed using a laser confocal microscope. Green fluorescence was observed at 488nm and red fluorescence was observed at 530nm ( Figure 4 ). The results showed that ScWRKY35 was only present in the cell nucleus.

[0041] The extracted plasmid was transformed into Agrobacterium rhizogenes ATCC15834 competent cells, and the resuspension was spread on LB plates containing kanamycin and inverted at 28°C for 2-3 days. Single colonies were picked for bacterial liquid PCR verification, and the screened positive clones were used to infect leaves of appropriate size in sterile Salvia miltiorrhiza seedlings and placed in 1 / 2MS medium containing timentin. The MS plates containing timentin were replaced every 5 days, and the concentrations of timentin were 200, 150, 100, and 50 ng / μl, respectively. After that, the MS plates containing cef were replaced, and the cef concentrations were 500 and 250 ng / μl, respectively, until the sterilization was complete, and the MS medium without antibiotics was replaced. The DNA of the hairy roots was extracted, and the vector universal primer was used as the forward primer and ScWRKY35-R as the reverse primer. After PCR amplification, agarose gel electrophoresis was performed to screen positive hairy roots ( Figure 5 ).

[0042] 0.2 g of positive hairy roots were weighed for shake flask culture. One month later, the content of salvianolic acid B was determined by high performance liquid chromatography, and the expression levels of key enzyme genes in the salvianolic acid B metabolic pathway were determined by fluorescence quantitative PCR to study the role of transcription factor ScWRKY35 in increasing the content of salvianolic acid B.

[0043] Compared with the wild type, the transcription factor ScWRKY35 can significantly increase the expression of key enzyme genes in the salvianolic acid B metabolic pathway. The content of salvianolic acid B in transgenic hairy roots is significantly increased compared with the wild type control (25 mg / g), with an increase of more than 10%, which is consistent with expectations.

Claims

1. Sagebrush transcription factor ScWRKY35 A gene characterized by The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. Containing the transcription factor according to claim 1 ScWRKY35 Recombinant gene expression vector.

3. The recombinant expression vector according to claim 2, characterized in that The expression vector is pCAMBIA1300-eGFP.

4. A method comprising the transcription factor according to claim 1 ScWRKY35 Genetically engineered bacteria.

5. Sagebrush transcription factor ScWRKY35 The encoded protein of the gene is characterized in that The amino acid sequence of the transcription factor is shown in SEQ ID NO.

2.

6. The Sagebrush transcription factor according to claim 1 ScWRKY35 The use of the gene, the recombinant expression vector according to claim 2, or the genetically engineered bacteria according to claim 4 in increasing the content of phenolic acids in plants, characterized in that: The plant is Salvia miltiorrhiza.

7. The use according to claim 6, characterized in that The phenolic acid substance is salvianolic acid B.

8. A method for increasing the content of phenolic acids in hairy roots of Salvia miltiorrhiza, characterized in that: The following steps are involved: (1) Obtaining the Sagebrush transcription factor by gene cloning ScWRKY35 gene; ScWRKY35 The nucleotide sequence of the gene is shown in SEQ ID NO.1; (2) ScWRKY35 The gene was inserted into the expression vector to obtain ScWRKY35 Gene overexpression vector; (3) ScWRKY35 The gene overexpression vector is transformed into rhizogenes competent Agrobacterium to obtain recombinant Agrobacterium, which is then used to infect Salvia miltiorrhiza leaves to obtain transgenic Salvia miltiorrhiza plants.

Images