Orthogonal linear gene expression system and use thereof

Abstract

The application discloses a kind of orthogonal linear gene expression system and application, belong to genetic engineering field.The application is with Bacillus thuringiensis as expression host, realizes the stable expression of gene by constructing linear plasmid in cell.Meanwhile, the application also realizes the accurate control of linear plasmid copy number.This not only develops a stable protein expression system in Bacillus thuringiensis, but also lays a foundation for Bacillus thuringiensis synthetic biology application.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to an orthogonal linear gene expression system and application thereof. BACKGROUND

[0002] Plasmid is an extrachromosomal genetic unit that can replicate autonomously, and is widely present in many organisms. They can provide some additional functions for the host, such as drug resistance, etc. Plasmid DNA has three conformations, most plasmid DNA usually presents a supercoiled SC conformation, both polynucleotide chains of which maintain a complete circular structure, also known as covalently closed circular DNA (cccDNA); when only one of the two polynucleotide chains maintains a complete circular structure, and the other chain has one to several nicks, it is also called open circular DNA (ocDNA); when the plasmid DNA is cut by restriction endonuclease and other nucleases, double-strand breaks occur to form linear molecules (lDNA).

[0003] Bacillus thuringiensis as a gram-positive microorganism is widely used as a biological pesticide in agriculture. In addition, as a microorganism generally considered safe, it has great potential for application in the field of synthetic biology, and is suitable as a host for protein expression and metabolic engineering. However, the development of tools for it is still limited. In addition, the existing bacterial plasmids are all circular plasmids, and linear DNA plasmids have not been developed. Compared with circular plasmids, linear plasmids have many advantages such as orthogonality, controllable copy number, stable replication and not easy to lose, etc. Therefore, in order to lay the foundation for the development of enzyme engineering, metabolic engineering and other fields, the present application aims to realize the development and application of a linear plasmid suitable for Bacillus thuringiensis. SUMMARY

[0004] To solve the above technical problems, the present application provides an orthogonal linear gene expression vector suitable for Bacillus thuringiensis, which is a vector capable of expressing a target gene obtained by modifying the lysogenic linear double-stranded DNA bacteriophage genome, and is applied to stable expression of proteins.

[0005] The first object of the present application is to provide an orthogonal linear gene expression system, which comprises I or II as follows:

[0006] I, a first plasmid containing a left replication origin, a promoter, a target gene and a right replication origin, and a second plasmid containing a DNA replication and control gene cluster;

[0007] II, a third plasmid containing a left replication origin, a DNA replication and control gene cluster, a promoter, a target gene and a right replication origin;

[0008] wherein, when the sequence of the left replication origin is SEQ ID NO. 1, the sequence of the right replication origin is SEQ ID NO. 2, and the sequence of the DNA replication and control gene cluster is SEQ ID NO. 3;

[0009] when the sequence of the left replication origin is SEQ ID NO. 4, the sequence of the right replication origin is SEQ ID NO. 5, and the sequence of the DNA replication and control gene cluster is SEQ ID NO. 6.

[0010] Specifically, the sequence of SEQ ID NO. 1 is:

[0011] ATTATGTACCTCTACTAGCCTATTAAAATATTTACCTATTGACACGTAATAACATTTATGAAATATGATATAC;

[0012] The sequence of SEQ ID NO. 2 is:

[0013] TATATCGTGAAACATAGATGTTTATTTGTGTCAATGGGTAATATTGGTAAAAGTGCTAGTAGGGATACATAATA;

[0014] The sequence of SEQ ID NO. 4 is:

[0015] ATTATGTACCCCTACCAACCTATTAAAATATTTACCTATTGACATGTAATAACATTTATGAAACACGATATAC;

[0016] The sequence of SEQ ID NO. 5 is:

[0017] TATATCGTGTTTCATAGATGTTTATTTTTGTCAATGGGTAAATATGGTAAAGGTGCTAGTAGGGGTACATAAT.

[0018] Further, in the third plasmid, the elements are sequentially arranged from 5' end to 3' end as the left replication origin, the DNA replication and control gene cluster, the promoter, the target gene, and the right replication origin; and in the first plasmid, the elements are sequentially arranged from 5' end to 3' end as the left replication origin, the promoter, the target gene, and the right replication origin.

[0019] Further, the plasmid is derived from a double-stranded linear DNA source bacteriophage genome, and exists in the form of linear DNA in the cell, and the two ends are covalently connected with a terminal protein.

[0020] Further, the DNA replication and control gene cluster comprises the following four proteins: terminal protein TP, DNA polymerase DNAP, double-stranded DNA-binding protein DSB, and single stranded DNA-binding protein SSB.

[0021] In the present application, the replication of the expression vector mainly depends on the above four proteins:

[0022] (1) The two ends of the expression vector are covalently linked to the terminal protein TP. The -OH of the serine residue on TP replaces the 3'-OH of the nucleotide, which can serve as a primer for DNA replication.

[0023] (2) The DNA polymerase recognizes a specific DNA sequence at the two ends of the linear plasmid and then realizes the replication of the linear plasmid using TP as a primer. According to whether the two ends of the linear plasmid initiate replication simultaneously, the replication of the linear plasmid is divided into type I and type II.

[0024] (3) The expression vector in double-stranded form has DSB bound to it for protection, and SSB will bind to it for protection when it appears in single-stranded form during replication. Since the DNA polymerase that replicates the linear plasmid cannot replicate the genome, and the DNA polymerase of the host cannot initiate the replication of the linear plasmid, the replication mode of the linear plasmid is called orthogonal replication.

[0025] Further, the orthogonal linear gene expression system further comprises a fourth plasmid containing an inducible promoter and a DNA polymerase.

[0026] Further, the gene sequence of the DNA polymerase is shown in SEQ ID NO. 7 or SEQ ID NO. 8. Among them, the DNA polymerase shown in SEQ ID NO. 7 is used in combination with the vector system composed of SEQ ID NO. 1-3, and the DNA polymerase shown in SEQ ID NO. 8 is used in combination with the vector system composed of SEQ ID NO. 4-6.

[0027] Further, the inducible promoter is used for the expression regulation of the DNA polymerase, and the inducible promoter can be any suitable promoter for the host, such as the xylose inducible promoter used in the present application.

[0028] Further, the sequence of the third plasmid is shown in SEQ ID NO. 9. The sequence includes a green fluorescent protein gene (the amino acid sequence is shown in SEQ ID NO. 10) as a reporter gene, and in actual application, the reporter gene can be replaced by the desired target gene.

[0029] Further, the expression vector is derived from the genome of phage GIL16 or GIL01.

[0030] Further, the expression vector is modified by homologous recombination.

[0031] A second object of the present application is to provide a cell containing the above orthogonal linear gene expression system.

[0032] Further, the cell is Bacillus thuringiensis.

[0033] Further, the Bacillus thuringiensis includes but is not limited to Bacillus thuringiensis HD-1 (GenBank No: CP001903), Bacillus thuringiensis JW-1 (GenBank No: CP045030), etc.

[0034] Further, the first plasmid, the second plasmid and the third plasmid are respectively independently a vector suitable for Bacillus thuringiensis expression, such as pGIL01, pGIL16, etc.

[0035] Further, the fourth plasmid can adopt a circular vector skeleton, such as pBMB, etc.

[0036] Further, the promoter is any promoter suitable for Bacillus thuringiensis expression, such as P 43 , etc.

[0037] A third object of the present application is to provide an application of the above orthogonal linear gene expression system or the cell containing the above orthogonal linear gene expression system in regulating the expression of a target protein.

[0038] Further, the application is to regulate the expression of the target protein by using different concentrations of inducers (such as xylose) in the fermentation process of the cell containing the orthogonal linear gene expression system. On the basis of the fourth plasmid, the expression level of the orthogonal DNA polymerase is regulated by inducing the promoter to realize the accurate regulation of the copy number of the linear plasmid, and the copy number control mainly depends on the action of gp1 and gp7 encoded by the phage itself and the SOS system regulating protein LexA of the bacterium.

[0039] Further, the concentration of the inducer is 0.01-100 g / L.

[0040] A fourth object of the present application is to provide an application of the above orthogonal linear gene expression system or the cell containing the above orthogonal linear gene expression system in the field of food and biology.

[0041] By the above scheme, the present application at least has the following advantages:

[0042] The application constructs a bacterial intracellular orthogonal linear gene expression vector, which can stably replicate and express target proteins in the form of double-stranded linear DNA in Bacillus thuringiensis, and the vector is almost not lost after more than 70 generations without adding pressure screening tags. At the same time, the use of inducible promoter to express DNA P can control the copy number of linear plasmid between 12-80, so that the expression level of target gene on linear plasmid is increased by 2.9 times.

[0043] The above description is only a summary of the technical solutions of the present application. In order to make the technical means of the present application clearer and can be implemented according to the content of the specification, the following is the preferred embodiment of the present application and the detailed description of the drawings as follows. BRIEF DESCRIPTION OF DRAWINGS

[0044] In order to make the content of the present application more easily understood, the following is a further detailed description of the present application according to the specific embodiments of the present application and in combination with the drawings.

[0045] Figure 1 Conceptual diagram for bacterial intracellular orthogonal linear gene expression system;

[0046] Figure 2 Conceptual diagram for linear plasmid structure. DETAILED DESCRIPTION

[0047] The present application is further described below in combination with the drawings and specific embodiments, so that those skilled in the art can better understand the present application and can implement it, but the embodiments are not as a limitation on the present application.

[0048] The materials and methods involved in the following examples are as follows:

[0049] The GenBank accession number of green fluorescent protein (GFP) is AF324408.1.

[0050] LB medium (g / L): tryptone 10, yeast powder 5, NaCl 10.

[0051] SG buffer: 93.1 g of sucrose and 150 mL of glycerol per L.

[0052] 0.1M PBS: 1.4 g of K2HPO4 and 0.52 g of KH2PO4 per 100 mL.

[0053] 1M MgCl2: 20.33 g of MgCl2·6H2O per 100 mL.

[0054] EP buffer: 1L of SG buffer, 5mL of 0.1M PBS, 500μL of 1.0M MgCl2 per L

[0055] The method for measuring the expression amount of green fluorescent protein: 200 μL of diluted fermentation broth was added to each well of a 96-well plate, and a Cytation3 cell imaging microplate reader (BioTek Instruments, Inc., USA) was used with an excitation wavelength of 488 nm, an emission wavelength of 523 nm, and a gain of 60.

[0056] Example 1 Electroporation of Bacillus thuringiensis

[0057] Preparation of competent cells: First, a single colony was picked and cultured in 5 mL of LB medium at 30°C overnight. Then, the culture was transferred to fresh LB medium at a 1 / 100 inoculation ratio and cultured at 30°C and 220 r / min until the OD 600 was about 1.0-1.3 (about 2 h), and the whole process of preparation and transformation of competent cells was performed under low-temperature conditions. After cooling, the bacterial solution was centrifuged at 5000 r / min and 4°C for 5 min, the supernatant was discarded, and the bacterial cells were washed twice with pre-cooled EP buffer and once with pre-cooled SG buffer. Finally, the bacterial cells were resuspended in SG buffer (about 1.5 mL) to obtain competent cells with an OD 600 of about 50-70. The competent cells were divided into 50 μL / tube and stored at -80°C, or 500 μL / tube and used immediately.

[0058] Electroporation process: One tube of competent cells was placed on ice, 3-5 μL of plasmid DNA (with a concentration of 100 ng / μL or higher) was added, and the mixture was gently shaken to mix. After 10-30 min of ice bath, the mixture was added to a 1-mm pre-cooled electroporation cup, and 1.25 kV was applied for electroporation. Then, 500 μL of 37°C pre-heated LB medium was quickly added. After recovery culture at 37°C and 220 r / min for 2 h, the culture was plated on a resistance plate and cultured in a 37°C incubator overnight.

[0059] Example 2 Homologous recombination modification of linear plasmid GIL16

[0060] To achieve efficient recombination of Bacillus thuringiensis HD-1, first construct the helper plasmid pBMB-ESC (SEQ ID NO. 11), and then use xylose to induce the expression of Exo (double-stranded DNA 5'-3' exonuclease), EcoSSB (single-stranded DNA binding protein from E. coli), and CspRecT (DNA annealing protein) to achieve the formation of single-stranded DNA and efficient annealing of DNA fragments in the cell. The construction of the GIL16 linear plasmid integration frame uses fusion PCR. First, design the homologous recombination frame, and the length of the homologous arm is 500-1000 bp. The specific operation is as follows: use primers HD-Re-1F: acggacagttgtgcaacaactacg, HD-Rgfp-1R: aggatccagttgctccgtcacacgtgtgtcattttggac to amplify the left arm, use primers HD-Rgfp-2F: acgtgtgacggagcaactggatcctgataggtggtatg, HD-Rgfp-2R: gaaattgttatccgctcccaagctttcatcaCTATTTGTATAGTTCATCC to amplify the GFP expression frame, use primers HD-Rgfp-3F: Gtgatgaaagcttgggagcggataacaatttcacacaggaaacagc, HD-Rgfp-3R: gcgtgataacgccagggttttcccagtcacg to amplify the antibiotic resistance gene, and use primers HD-Re-4F: tgggaaaaccctggcgttatcacgctgggcataactactttgtg, HD-Re-4R: caattacggcttgtgcttcctctcg to amplify the right arm. The corresponding linear plasmid / genome integration operation is as follows:

[0061] First, prepare the competent cells of the strain containing the pBMB-ESC plasmid, and when the OD 600 of the bacterial solution is about 0.5, add xylose at a final concentration of 3%, and continue to culture until the OD 600 is equal to 1.0-1.3. The rest of the operation is the same as that of the electroporation plasmid. When electroporated, the DNA fragment needs to be relatively single, and 5 μL of DNA fragment with a concentration of 200 ng / μL or more is added, and then cultured for 3 h. The rest of the operation is the same as that of the electroporation plasmid. Finally, the DNA integration frame realizes the recombination editing of the prophage GIL16 genome, and the recombinant Bacillus thuringiensis containing the linear plasmid expressing GFP (SEQ ID NO. 9) is constructed.

[0062] Example 3 Homologous recombination modification of linear plasmid GIL01

[0063] Similarly, to achieve efficient recombination of Bacillus thuringiensis JW-1, an auxiliary plasmid pBMB-ESC (SEQ ID NO. 11) was first constructed, and Exo (double-stranded DNA 5'-3' exonuclease), EcoSSB (single-stranded DNA binding protein from Escherichia coli) and CspRecT (DNA annealing protein) were induced to express by using xylose to realize the formation of single-stranded DNA and efficient annealing of DNA fragments in the cell. The construction of linear plasmid integration frame used fusion PCR. First, the homologous recombination frame was designed, and the length of the homologous arm was 500-1000 bp. The specific operation was as follows: the left arm was amplified using primers pGIL01-1F: ggcgttccgaaatgggtagtagagg, pGIL01-1R: tcgccagtcactatggcacgtgtgtcattttggacaaataaaaaagactagc, the GFP expression frame was amplified using primers pGIL01-2F: tgacacacgtgccatagtgactggcgatgctgtcg, pGIL01-2R: gtcacagaacgcctgcgttattgcgcaggcgttttgtaataaaaaaagagcctcgtacctattaatgtatcgttagaaaaccgactgt, the antibiotic resistance gene was amplified using primers pGIL01-3F: cgcaataacgcaggcgttctgtgacattaacttatttcacgaacggtagaatcgtcgacctg, pGIL01-3R: cacTTATTTGTATAGTTCATCCATGCCATGTGTAATCCC, and the right arm was amplified using primers pGIL01-4F: attatgtacccctactagcacctttaccatatttacccattgacaaaaataaacatctatgaaacacg, pGIL01-4R: GCTGGGATTACACATGGCATGGATGAACTATACAAATAAgtgaatacaaacttccaaattcatataggagactttgacg. The corresponding linear plasmid / genome integration operation was as follows:

[0064] First, the competence of the strain containing the pBMB-ESC plasmid was prepared, and when the OD 600 of the bacterial solution was about 0.5, 3% xylose was added to a final concentration, and the culture was continued to an OD 600about 1.0-1.3. The rest of the operation is the same as the plasmid electroporation. When electroporation, the DNA fragment needs to be more single, add 5 μL of DNA fragment with concentration of 200 ng / μL or more, and then culture for 3 h. The rest of the operation is the same as the plasmid electroporation. The final DNA integration frame realizes the recombination editing of the genome of the original bacteriophage GIL01, and the recombinant Bacillus thuringiensis containing the linear plasmid expressing GFP is constructed.

[0065] Example 4: Linear plasmid passage test stability

[0066] The recombinant Bacillus thuringiensis constructed in Example 2 was cultured in 50 mL LB medium at 37°C, 220 rpm, 50 mL for 12 h to obtain a seed liquid, and then the seed liquid was inoculated into 50 mL LB medium without antibiotics at an inoculation amount of 0.1%, and 4 parallel controls were set. Cultured at 37°C, 220 rpm for 12 h. Under the same conditions, continue to pass. The GFP expression of each strain obtained was determined by flow cytometry to characterize the loss of linear plasmid.

[0067] Table 1: The proportion of cells still containing linear plasmid after different generations of transfer

[0068]

[0069] Example 5: Adding different concentrations of xylose to control the copy number of linear plasmid and the expression level of GFP

[0070] Firstly, the plasmid pBMB-ODNAP (SEQ ID NO. 12) was constructed. The construction process was as follows: firstly, GIL16 DNA polymerase DNA was amplified using primers ODNAP-1F: tgTTAAAGGAGGAAGGATCCatgagtactactaatagaaaaaagcgtagagag and ODNAP-1R: gcatccttcaatccttataagaaacttaattcgcctaatagttctttcatgtcc, and the pBMB plasmid vector with a xylose-inducible promoter was amplified using primers ODNAP-2F: catGGATCCTTCCTCCTTTAAcatttccccctttgatttttagatatcactagtttgg and ODNAP-2R: gtttcttataaggattgaaggatgcttaggaagacgag, and then the plasmid pBMB-ODNAP was constructed using Gibson assembly. Then, the recombinant Bacillus thuringiensis transformation plasmid pBMB-ODNAP constructed in Example 2 was transformed. The seed liquid was obtained by culturing at 37°C, 750 rpm, 700 μL of LB medium, 96-well deep well plate for 10 h, and then the seed liquid was transferred into 190 μL of LB medium containing different concentrations of xylose at a 5% inoculation amount, so that the final concentration of xylose in different wells was 0.00 g / L to 50 g / L, and six parallel controls were set for each concentration. The culture was carried out at 37°C, 750 rpm for 45 h. Under the same conditions, the fluorescence intensity of the control group without adding xylose was about 34.3; and after adding 0.01, 0.05, 0.1, 0.25, 0.5, 1, 2.5, 5, 10, 30, and 50 g / L of xylose, the average fluorescence intensity was 35.6, 36.6, 43.7, 51.7, 58.4, 68.4, 85.3, 84.9, 86.7, 100.0, and 99.4, respectively.

[0071] Table 2 Data record of linear plasmid copy number and expression level of GFP after adding different concentrations of xylose

[0072]

[0073] Comparative Example

[0074] The specific implementation is the same as that in Example 3, except that the recombinant Bacillus thuringiensis contains circular plasmids pDG148, pBMB, and pP43NMK, respectively. The plasmid is significantly lost when the circular plasmid is passaged for 70 generations without adding antibiotic selection pressure, and the number of cells containing the plasmid is only 26.37%, 2.73%, and 0.00%, respectively.

[0075] Table 3 Proportion of cells still containing circular plasmids after transfer of different generations

[0076]

[0077] It is apparent that the above-described embodiments are merely example for the purpose of clear illustration, and are not intended to limit the embodiments. Based on the above description, other different forms of changes or variations can be made by those of ordinary skill in the art. Here, it is not necessary and impossible to exhaust all the embodiments. The obvious changes or variations derived therefrom are still within the protection scope of the present application.

Claims

1. A cell comprising an orthogonal linear genetic expression system, characterized by: The cell is Bacillus thuringiensis HD-1, The orthogonal linear gene expression system comprises, from 5' end to 3' end, a third plasmid containing a left replication origin, a DNA replication and control gene cluster, a promoter, a target gene and a right replication origin, and the two ends of the third plasmid are covalently connected with terminal proteins; The orthogonal linear gene expression system further comprises a fourth plasmid containing an inducible promoter and a DNA polymerase, and the gene sequence of the DNA polymerase is as shown in SEQ ID NO.

7. The sequence of the left replication origin is SEQ ID NO. 1, the sequence of the right replication origin is SEQ ID NO. 2, and the sequence of the DNA replication and control gene cluster is SEQ ID NO.

3.

2. The cell of claim 1 is used for regulating expression of a target protein.

3. Use according to claim 2, characterized in that: The application is to regulate expression of a target protein by using different concentrations of an inducer in a fermentation process of a cell containing an orthogonal linear gene expression system.

Images