Protein for regulating ear height and flowering time of maize, its coding gene and application

Abstract

The application discloses a protein and related biomaterials thereof, and application of the protein or a substance for regulating expression of a gene coding the protein or a substance for regulating activity or content of the protein in regulation of ear position height and / or flowering time of plants; the protein is a protein with an amino acid sequence of SEQ ID No. 1. A transgenic plant with a knockout of a gene coding the protein is successfully obtained based on a CRISPR-Cas9 system knockout experiment, and a plant obtained by self-crossing of a transgenic positive plant is identified and compared with a wild type, and the result shows that the knockout of the target gene can increase the ear position height of a corn inbred line; overexpression of the protein coding gene in Arabidopsis thaliana leads to a shortened flowering time of the Arabidopsis thaliana, thereby proving that the gene Zm00001d010894 has an important biological function in the ear position height and / or flowering time phenotype.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to proteins that regulate ear height and flowering period in maize, their encoding genes, and their applications. Background Technology

[0002] Maize (Zea mays L.) is one of the most important food, feed, and energy crops, and its production security plays a crucial role in national food security. Plant height and ear height are the main factors influencing plant architecture. Flowering time is an important agronomic trait, significantly impacting harvest date, biomass yield, crop rotation, and drought resistance. Therefore, identifying genes controlling maize plant architecture and flowering time for use in basic research or molecular design breeding is of great significance for developing new maize varieties. Summary of the Invention

[0003] The technical problem to be solved by this invention is how to quickly and accurately regulate the height of plant spikes and / or the flowering period.

[0004] To address the aforementioned technical problems, the present invention provides a method for increasing the ear height of maize, the method comprising increasing the ear height of maize by knocking out the gene encoding the following protein in maize.

[0005] The protein may be as follows: A1), A2), or A3).

[0006] A1) The amino acid sequence of this protein is that of SEQ ID No. 1;

[0007] A2) A protein that has more than 80% identity with and has the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 1;

[0008] A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0009] In the above method, the corn may include a corn inbred line.

[0010] In the above method, the knockout can be performed using a CRISPR / Cas9 system.

[0011] In the above method, the CRISPR / Cas9 system may include a vector expressing sgRNA that targets the coding gene of the protein described above.

[0012] Furthermore, in the method described, knocking out the gene encoding the aforementioned protein in maize can be achieved by performing at least one of the following mutations on the maize DNA molecule whose coding sequence is shown in SEQ ID No. 2:

[0013] F1) The DNA molecule shown in SEQ ID No. 2 is mutated to Zm00001d010894 / -55bp, wherein Zm00001d010894 / -55bp is obtained by deleting nucleotides from positions 1 to 55 of the DNA molecule shown in SEQ ID No. 2, while keeping the other nucleotide sequences of sequence 2 unchanged;

[0014] F2) The DNA molecule shown in SEQ ID No. 2 is mutated to Zm00001d010894 / -53bp, wherein Zm00001d010894 / -53bp is obtained by deleting nucleotides from positions 1 to 53 of the DNA molecule shown in SEQ ID No. 2, while keeping the other nucleotide sequences of sequence 2 unchanged.

[0015] The present invention also provides the application of the above method in the creation of maize mutant plants and / or maize breeding.

[0016] To address the aforementioned technical problems, the present invention also provides the application of a protein or a substance that regulates the expression of the protein-encoding gene or a substance that regulates the activity or content of the protein, wherein the application may be any of the following:

[0017] D1) The application of proteins or substances that regulate the expression of the protein-encoding genes or substances that regulate the activity or content of the proteins in regulating plant ear height and / or flowering period.

[0018] D2) The use of proteins or substances that regulate the expression of the protein-encoding genes or substances that regulate the activity or content of the proteins in the preparation of products that regulate plant ear height and / or flowering period.

[0019] D3) The use of proteins or substances that regulate the expression of the protein-encoding genes or substances that regulate the activity or content of the proteins in the preparation of products that cultivate plants with early flowering and / or low spike position.

[0020] D4) The application of proteins or substances that regulate the expression of the protein-encoding genes or substances that regulate the activity or content of the proteins in plant breeding.

[0021] The protein may be as follows: A1), A2), or A3).

[0022] A1) The amino acid sequence of this protein is that of SEQ ID No. 1;

[0023] A2) A protein that has more than 80% identity with and has the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 1;

[0024] A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0025] The protein mentioned above comes from corn.

[0026] SEQ ID No.1 consists of 1060 amino acid residues.

[0027] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0028] The protein tag refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag protein tag, His protein tag, MBP protein tag, HA protein tag, myc protein tag, GST protein tag, and / or SUMO protein tag, etc.

[0029] Furthermore, in the aforementioned application, the substance regulating the expression of the protein-coding gene or the substance regulating the activity or content of the protein is a biological material, which may be any one of B1) to B9) below:

[0030] B1) Nucleic acid molecules that encode the above proteins;

[0031] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0032] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0033] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0034] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0035] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0036] B7) A transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3);

[0037] B8) Nucleic acid molecules that inhibit or reduce the expression of the gene encoding the protein or that inhibit or reduce the activity of the protein;

[0038] B9) Expression cassettes, recombinant vectors, recombinant microorganisms or transgenic plant cell lines containing the nucleic acid molecules described in B8).

[0039] Furthermore, in the above application, the nucleic acid molecule described in B1) can be any of the DNA molecules shown in b1) to b3) below:

[0040] b1) The coding sequence of the coding strand is the DNA molecule shown in SEQ ID No. 2;

[0041] b2) The nucleotide sequence of the coding strand is the DNA molecule shown in SEQ ID No. 2;

[0042] b3) DNA molecules that have 80% or more identity with the nucleotide sequence defined by b1) or b2) and encode the aforementioned proteins;

[0043] In the above applications, the nucleic acid molecule described in B8) is a DNA molecule expressing a gRNA that targets the protein-coding gene or is a gRNA that targets the protein-coding gene.

[0044] In the above applications, identity refers to the similarity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained.

[0045] In the above applications, the 80% or more of identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0046] In the above applications, the DNA molecule expressing the gRNA targeting the protein-coding gene can be any of the following:

[0047] g1) A DNA molecule whose coding sequence is as shown in positions 437-542 of SEQ ID No. 4; and / or,

[0048] g2) A DNA molecule whose coding sequence is as shown in positions 437-542 of SEQ ID No. 5; and / or,

[0049] g3) A DNA molecule whose coding sequence is as shown in positions 437-542 of SEQ ID No. 6; and / or,

[0050] The gRNA targeting the above-mentioned protein-coding genes can be the RNA molecules encoded by g1), g2) or g3) mentioned above.

[0051] Furthermore, the target sequence of the above gRNA may be: the nucleotide shown in positions 1020-1039 of SEQ ID No. 3 (i.e., 5'-CGGCTCCAAGATCACAAGAC-3'), and / or the nucleotide shown in positions 1107-1126 of SEQ ID No. 3 (i.e., 5'-CTCGTAGAACTAGAGCATGG-3'), and / or the nucleotide shown in positions 1171-1190 of SEQ ID No. 3 (i.e., 5'-GCAGAACAGGAGTGCGACCA-3').

[0052] Furthermore, in the aforementioned application, the substance that regulates the expression of the protein-coding gene or the substance that regulates the activity or content of the protein may be the biological material described in B8) or B9), and the regulation of plant ear height and / or flowering period is to increase the ear height of the plant.

[0053] Furthermore, the plant mentioned in the above applications can be any one of the following P1)-P5):

[0054] P1) Monocotyledons;

[0055] P2) Plants of the order Poales;

[0056] P3) Gramineae plants;

[0057] P4) Plants of the genus *Zea*;

[0058] P5) Corn.

[0059] Furthermore, in the above applications, the substance that regulates the expression of the protein-coding gene or the substance that regulates the activity or content of the protein can be any one of the biological materials from B1) to B7), and the regulation of plant ear height and / or flowering period is to shorten the flowering period of the plant.

[0060] Furthermore, in the above applications, the plant can be any one of the following (E1)-E5):

[0061] E1) Dicotyledons;

[0062] E2) Plants of the order Papaverales;

[0063] E3) Cruciferous plants;

[0064] E4) Plants of the genus *Mucor*

[0065] E5) Arabidopsis thaliana.

[0066] In the above applications, the substance regulating gene expression can be a substance that performs at least one of the following six types of regulation: 1) regulation at the gene transcription level; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of gene translation; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0067] In the above applications, the regulation of gene expression can be achieved by inhibiting or reducing gene expression, which can be achieved by gene knockout or gene silencing.

[0068] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.

[0069] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0070] In the above applications, the substance regulating gene expression can be a reagent that inhibits or reduces the expression of the gene. The reagent that inhibits or reduces the expression of the gene can be a gene knockout reagent, such as a reagent that knocks out the gene through homologous recombination or a reagent that knocks out the gene through CRISPR-Cas9. The reagent that inhibits or reduces the expression of the gene can contain a polynucleotide that targets the gene, such as siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0071] The knockout experiment based on the CRISPR-Cas9 system successfully obtained transgenic maize plants with the above-mentioned protein-coding genes knocked out. The results of phenotypic identification and comparison between the homozygous plants obtained by self-pollination of transgenic positive plants and wild-type plants showed that knocking out the Zm00001d010894 gene can increase the ear height of maize inbred lines, while overexpression of the Zm00001d010894 gene in Arabidopsis can shorten the flowering period of Arabidopsis, thus proving that the Zm00001d010894 gene has important biological functions in the flowering period and ear height phenotypes.

[0072] Compared with the prior art, the present invention has the following advantages:

[0073] (1) After knocking out the gene encoding the Zm00001d010894 protein of the present invention, the ear height of maize was significantly increased.

[0074] (2) This invention provides a more precise, efficient and safe technical method for creating maize mutant plants and / or maize breeding, and realizes precise improvement of ear height and / or flowering time. It can promote the commercial maize breeding process, overcome the shortcomings of traditional breeding, shorten the breeding cycle and not affect other traits. Attached Figure Description

[0075] Figure 1 The loci where DA, EH, and EP are located on chromosome 8 are: DA represents the day toanthesis, defined as the date when more than 50% of the plants in the plot are flowering, in days; EH represents ear height, calculated as the average of all plants in the plot, in cm; EP represents relative ear height, calculated as EP = EH / PH, where PH represents plant height, calculated as the average of all plants in the plot, in cm.

[0076] Figure 2The relative expression levels of the Zm00001d010894 gene at different developmental stages for extreme materials at flowering and ear position are shown; where V5 represents the 5th leaf fully expanded (pulvinus visible), V6 represents the 6th leaf fully expanded (pulvinus visible), V7 represents the 7th leaf fully expanded (pulvinus visible), V8 represents the 8th leaf fully expanded (pulvinus visible), V10 represents the 10th leaf fully expanded (pulvinus visible), and V12 represents the 12th leaf fully expanded (pulvinus visible).

[0077] Figure 3 A schematic diagram of the construction of the recombinant vector pCAMBIA3301-Zm00001d010894 and a vector map of the recombinant vector.

[0078] Figure 4 The flowering phenotype of Arabidopsis thaliana lines transformed by Zm00001d010894 was shown. The results indicated that the flowering period of Arabidopsis thaliana lines OE-1, OE-5, and OE-10 transformed by Zm00001d010894 was significantly shorter than that of the wild type.

[0079] Figure 5 This diagram illustrates the construction of the recombinant vector CPB-sgRNA and shows the vector map of the recombinant vector.

[0080] Figure 6 The mutant plant genotype obtained in Example 4; wherein, Figure 6 In the image, 'a' represents the agarose gel electrophoresis pattern of the genomic DNA of the mutant strain. Figure 6 In the text, b represents the mutant genotype of the mutant strain.

[0081] Figure 7 The mutant plant phenotype obtained in Example 4 is shown. Detailed Implementation

[0082] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0083] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0084] Maize inbred line B104 was obtained from the US National Plant Germplasm System (https: / / npgsweb.ars-grin.gov / gringlobal / search).

[0085] The maize inbred line B73 was derived from the National Germplasm Resource Bank.

[0086] Arabidopsis Col-0, Columbia ecotype Arabidopsis, is a product of the Arabidopsis Biological Resource Center. For details, please visit http: / / abrc.osu.edu / .

[0087] The vector pCAMBIA3301 was purchased from Beijing Zhuangmeng International Biotechnology Co., Ltd., catalog number ZK868.

[0088] The CPB vector was provided by Xie Chuanxiao's research group at the Institute of Crop Science, Chinese Academy of Agricultural Sciences, and is disclosed in the literature "Zhao, Y., Zhang, C., Liu, W. et al. An alternative strategy for targeted gene replacement in plants using a dual-sgRNA / Cas9 design. Sci Rep 6, 23890 (2016)." The public can obtain the above-mentioned biological material from the applicant. The obtained biological material is only used for repeating the experiments of this invention and cannot be used for other purposes.

[0089] The pLB vector was purchased from Tiangen Biotech (Beijing) Co., Ltd., catalog number VT205.

[0090] Fast-T1 Escherichia coli competent cells were purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number C505-03.

[0091] EHA105 Agrobacterium competent cells were purchased from Beijing Bomed Gene Technology Co., Ltd., catalog number BC303.

[0092] The following examples used SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA test was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.

[0093] Example 1: Identification of the Target Gene

[0094] 1.1 Determination of ear height and flowering time traits and genome-wide association analysis

[0095] 1604 maize inbred lines were planted in the field using a completely randomized block design with two replicates. Each line was planted in a single row, 3 meters long and 0.6 meters wide, with 13 maize plants per row. The silking (Days to silk, DS) and pollen-shedding (Days to anthesis, DA) periods were recorded, defined as the date when more than 50% of the plants in the plot reached flowering, in days. Simultaneously, plant height (PH) and ear height (EH) at maturity were measured, and the average of all measurements in the plot was taken, in cm. The relative ear height was calculated using the formula: EP = EH / PH.

[0096] Plant height (PH) and ear height (EH) of mature maize were measured, and the average value of all measurements within the plot was taken. The plant height and ear height data were then used to calculate...

[0097] 1.2 Identification of Zm00001d010894, a gene related to maize kernel size and weight.

[0098] Genome-wide association analysis identified a cluster of associated signal peaks on chromosome 8 that controls flowering time, ear height, and relative ear height, such as... Figure 1 As shown. Further analysis of this peak cluster revealed three distinct peak clusters at this location. The significantly associated SNPs of the first and third peak clusters are located in genes that control flowering time, as previously reported. ZmZCN8 and ZmRap 2.7 The second peak cluster's significantly associated SNP is located within the Zm00001d010894 gene. Furthermore, from the 1604 materials used in this study, 20 extreme materials with different flowering times and ear heights (10 early-flowering, low-ear-height materials and 10 late-flowering, high-ear-height materials) were selected for qRT-PCR to detect the relative expression level of the Zm00001d010894 gene in maize plants at different developmental stages. Significant differences in the expression level of Zm00001d010894 were found between the two groups at maize stages V5 and V6. Figure 2 As shown in the figure. Therefore, we believe that Zm00001d010894 is a candidate gene controlling flowering time and ear height. Based on this, we conducted functional verification of this gene.

[0099] The genomic sequence of the Zm00001d010894 gene is a DNA molecule as shown in SEQ ID No. 3, its coding sequence is a DNA molecule as shown in SEQ ID No. 2, and its encoded amino acid sequence is a protein as shown in SEQ ID No. 1. The encoded protein is named Zm00001d010894 protein or protein Zm00001d010894.

[0100] Example 2: Amplification and recovery sequencing of the Zm00001d010894 genome and its coding genes.

[0101] 2.1 Obtaining the full-length genome and cDNA of candidate genes

[0102] 2.1.1 Preparation of plant materials required for amplifying candidate genes

[0103] Select plump seeds from the maize inbred line B73 and plant three seedlings in each pot filled with nutrient soil. Place the pots in a light incubator (28 ℃, light). When the seedlings reach the six-leaf stage, collect leaves. Use some leaves for genomic DNA extraction; use the remaining leaves for RNA extraction and store at -80 ℃.

[0104] 2.1.2 Extraction of genomic DNA from maize materials

[0105] 1) Quickly place the leaves into a sterilized mortar and grind them thoroughly with liquid nitrogen, adding liquid nitrogen continuously during the process. After grinding, add the mixture to a 2.0 ml centrifuge tube, filling it to 1 / 3 full.

[0106] 2) Preheat the pre-prepared CTAB extraction solution in a 65 ℃ water bath. Then add 800 μl of preheated CTAB buffer to the centrifuge tube from the previous step and shake vigorously to mix thoroughly.

[0107] 3) Place the mixed extract in a 65 ℃ constant temperature water bath for 30 min, shaking it every 10 min to ensure a full reaction.

[0108] 4) Take out the centrifuge tube that has undergone sufficient reaction, add an equal volume of chloroform / isoamyl alcohol (volume ratio 24:1), mix slowly for 15 min, and let stand for 10 min.

[0109] 5) Place the centrifuge tubes into the centrifuge and centrifuge at 12,000 rpm for 20 minutes.

[0110] 6) Carefully aspirate the supernatant into another clean 2.0 ml centrifuge tube, add an equal volume of pre-cooled (-20 ℃) ​​isopropanol, gently mix, and place the centrifuge tube in a -20 ℃ freezer for 30 min until a large amount of white precipitate forms.

[0111] 7) Use a sterilized pipette tip to remove the white precipitate and place it in another clean centrifuge tube. Add 500 μL of 75% ethanol and rinse 2-3 times.

[0112] 8) Centrifuge, discard 75% of the ethanol, remove excess ethanol with a pipette tip, and dry at room temperature. Dissolve the DNA in 1×TE.

[0113] 9) Add RNase for purification (final concentration 10 ug / ul), and incubate at 37 ℃ for 1 h.

[0114] 10) Add an equal volume of phenol / chloroform / isoamyl alcohol (volume ratio 25:24:1) for extraction once, centrifuge at high speed (12000 rpm) for 10 min, carefully aspirate the supernatant, and extract again with an equal volume of chloroform / isoamyl alcohol (volume ratio 24:1), centrifuge at high speed (12000 rpm) for 10 min.

[0115] 12) Precipitate the DNA with pre-cooled anhydrous ethanol and centrifuge (12000 rpm) for 10 min.

[0116] 13) Discard the ethanol, air dry completely to avoid inhibiting the downstream PCR reaction, add an appropriate amount of TE to dissolve, and store in a -20 ℃ refrigerator for later use.

[0117] 2.1.3 Extraction and purification of total RNA from maize materials

[0118] Total RNA was extracted from plants using the Gene-better Polysaccharide-Polyphenol Plant Total RNA Extraction Kit (with gDNA filter). The specific procedure is as follows (all experimental instruments used were sterilized at high temperature to remove RNase):

[0119] 1) Pour liquid nitrogen into an RNase-free mortar that has been treated at 180℃, then take out the frozen leaves from the -76℃ ultra-low temperature freezer, add liquid nitrogen and grind them thoroughly, continuously replenishing liquid nitrogen during the process until they are fully ground.

[0120] 2) Before adding the sample to the centrifuge tube, immerse the 1.5 ml RNase-free centrifuge tube completely in liquid nitrogen for quick freezing. Then quickly add the ground sample. Do not add too much sample, generally add to 1 / 3 (about 50 mg). Add 500 μL of lysis buffer and 50 μL of PLANTaid to the centrifuge tube and vortex for 20 seconds to ensure complete lysis.

[0121] 3) Centrifuge the lysate at 13,000 rpm for 10 minutes to precipitate unlysed fragments and PLANTaid bound with polysaccharides and polyphenols.

[0122] 4) Transfer the supernatant of the lysate to a new centrifuge tube. Add an equal volume of anhydrous ethanol to the supernatant and immediately mix by pipetting; do not centrifuge.

[0123] 5) Add the mixture (less than 720 μL each time, which can be added in two batches) to a genomic DNA filter, centrifuge at 13,000 rpm for 2 min, and discard the waste liquid.

[0124] 6) Place the genomic DNA filter in a clean 2 ml centrifuge tube, add 500 μL of lysis buffer RLT PLUS to the filter, centrifuge at 13000 rpm for 30 s, collect the filtrate, estimate the filtration volume accurately with a pipette, and add 0.5 times the volume of anhydrous ethanol. Precipitation may occur at this point, but it will not affect the extraction process. Immediately mix by pipetting and do not centrifuge.

[0125] 7) Immediately add the mixture to an adsorption column RA, centrifuge at 13000 rpm for 2 min, and discard the waste liquid.

[0126] 8) Add 700 μL of protein solution RW1, incubate at room temperature for 1 min, centrifuge at 13000 rpm for 30 s, and discard the waste liquid.

[0127] 9) Add 500 μL of wash buffer RW, centrifuge at 13000 rpm for 30 s and discard the waste liquid. Add 500 μL of wash buffer RW and repeat once. Place the adsorption column RA back into the empty collection tube, centrifuge at 13000 rpm for 2 min to remove as much wash buffer as possible to avoid residual ethanol in the wash buffer inhibiting the downstream reaction.

[0128] 10) Take out the RA adsorption column, put it into an RNase-free centrifuge tube, add 30-50 μL of RNase-free water in the middle of the adsorption membrane, let it stand at room temperature for 1 min, and centrifuge at 13,000 rpm for 1 min.

[0129] The quality of the extracted RNA was determined by 1% agarose gel electrophoresis for 18 min, and the concentration of the extracted RNA was determined by spectrophotometer. An appropriate amount of RNA was used for purification and reverse mixing, and the remaining RNA was stored at -76℃ for long-term storage.

[0130] 2.1.4. Reverse transcription to synthesize first-strand cDNA

[0131] Using the total RNA extracted in section 2.1.3 as a template, cDNA was synthesized by reverse transcription according to the Transgen One-Step gDNA Removal and cDNA Synthesis SuperMix instruction manual. The procedure is as follows:

[0132] 20 μL reverse transcription reaction system (placed in a 0.2 ml RNase-free centrifuge tube)

[0133] Total RNA (50ng-5ug) 4ul

[0134] Anchored Oligo (dT) 20 Primer (0.5ug / ul) 1ul

[0135] 2×TS-Uni Reaction Mix 10ul

[0136] Uni RT / RI Enzyme Mix1ul

[0137] gDNA Remover1ul

[0138] RNase-free ddH2O3ul

[0139] Total 20ul

[0140] Incubate at 50 °C for 30 min, then heat at 85 °C for 5 s to inactivate the enzyme, and quickly transfer to ice. Dilute the cDNA stock solution 5-fold, perform PCR amplification using the internal control gene GADPH, check the reverse conversion efficiency, and store at -20 °C for later use.

[0141] 2.1.5 Amplification of candidate genomic DNA

[0142] Download the candidate gene sequence corresponding to B73 of the reference genome from the Maize GDB database (https: / / www.maizegdb.org / ). Primers were designed using Primer5 software in the 5'UTR and 3'UTR regions of the genome. The full-length candidate genome DNA was amplified using the genomic DNA extracted in section 2.1.2 as a template. The amplification system is as follows:

[0143]

[0144] The candidate gene is 7300 bp in length. Due to its long length, primers were designed to amplify the gene in segments. The full gene length and the upstream and downstream 500 bp sequences were used as reference sequences in primer design. The primer sequences are as follows:

[0145] Forward Primer1:5'-GGTATCGCCTTCGCCACTC-3'

[0146] Reverse Primer1:5'-CATAGCAACATAACCCCTG-3'

[0147] Forward Primer2: 5'-AAAGTGAGAGGATAAAATG-3'

[0148] Reverse Primer2: 5'-AAGTCAGCAAAAGTAGGTA-3'

[0149] Forward Primer3: 5'- TCTTGATTCCTCTTCTATT-3'

[0150] Reverse Primer3: 5'-CTTCCAGTTATGTGTCTT-3'

[0151] Forward Primer4: 5'- CAAGAACAACAGACACAAT-3'

[0152] Reverse Primer4: 5'- TCACGATACAACAAAGAAG-3'

[0153] The PCR amplification procedure is as follows:

[0154]

[0155] 2.1.6 Amplification of full-length cDNA of candidate genes

[0156] Primers were designed based on the amplified genomic DNA sequence. Using the cDNA obtained in section 2.1.4 as templates for gene amplification, primers were designed to amplify the full-length cDNA sequence of the gene. The amplification system is as follows:

[0157]

[0158] The primer sequences are as follows:

[0159] Forward Primer: 5'-GTTACGACGGCGTAGGG-3'

[0160] Reverse Primer: 5'-GAGCCAGAACGAGTTGACC-3'

[0161] The PCR amplification procedure is as follows:

[0162]

[0163] 2.2 Recovery and sequencing of candidate genomic DNA and cDNA fragments

[0164] 2.2.1 Recovery of candidate genomic DNA and cDNA fragments

[0165] For fragment recovery, refer to the instruction manual of the FastPure Gel DNAExtraction Mini Kit from Beijing Novizan Biotechnology Co., Ltd.:

[0166] 1) Add 1 g of agarose to 100 ml of TAE solution, heat to boiling in a microwave oven, then add 10 μl of 10000×GelStain dye, pour into a plate with a comb, and prepare a 1% agarose gel. Perform agarose gel electrophoresis (125 v) on the PCR products of 2.1.5 and 2.1.6 with loading buffer added for 25 min. Under long-wave ultraviolet light, cut the target bands and put them into 1.5 ml centrifuge tubes.

[0167] 2) Add 400 μL of Buffer GDP to the centrifuge tube for sol-gel preparation.

[0168] 3) Place the centrifuge tubes in a 55 ℃ water bath and incubate. Invert the tubes every 5 minutes to mix until the gel is completely melted and the solution turns pale yellow. Allow the solution to stand at room temperature until it cools down to room temperature before proceeding to the next step of the reaction.

[0169] 4) Transfer the solution from the centrifuge tube in the previous step into the adsorption column, place the centrifuge tube in a centrifuge, centrifuge at 12000 rpm for 30 s, discard the waste liquid, and then put the adsorption column back into the empty collection tube.

[0170] 5) Add 300 μL of Buffer GDP to the adsorption column, let stand for 1 min, add the centrifuge tube to the centrifuge, centrifuge at 12000 rpm for 30 s, and discard the waste liquid.

[0171] 6) Place the adsorption column in the collection tube, add 700 μL of Buffer GW to the adsorption column, centrifuge at 12,000 rpm for 30 seconds; discard the filtrate. Wash twice.

[0172] 7) Place the adsorption column back into the empty collection tube and centrifuge at 12,000 rpm for 2 min.

[0173] 8) Remove the adsorption column and place it in a clean 1.5 ml sterile centrifuge tube. Let it stand at room temperature for 5 min. Add 25 μl of elution buffer to the middle of the adsorption membrane. Let it stand at room temperature for 5 min. Centrifuge at 12,000 rpm for 2 min and collect the precipitate.

[0174] 9) Repeat step 8.

[0175] 2.2.2 Sequencing of candidate genomic DNA and cDNA fragments

[0176] Referring to the instructions for Tiangen Biotech's pLB zero-background rapid cloning kit, the operating steps are as follows:

[0177] 1) Ligate the recovered DNA fragment obtained in 2.2.1 to the pLB vector, and gently tap the centrifuge tube to mix the reaction solution. The ligation system is as follows:

[0178] Candidate gene recovery fragment 3 ul

[0179] pLB vector 1 ul

[0180] 2×Reaction Solution5 ul

[0181] T4 DNA ligase 1 μL

[0182] Total 10ul

[0183] 2) Place the mixed reaction solution in a 22 ℃ constant temperature metal bath and react for 15 min. After the reaction is complete, place the centrifuge tube on ice for subsequent conversion experiments.

[0184] 3) Prepare LB agarose plates containing ampicillin at a final concentration of 100 ug / ml, and place the plates at 37℃ for 20 min.

[0185] 4) Add 10 μL of the ligation product to 100 μL of E. coli TOP10 competent cells (the competent cells were taken out of the -80℃ freezer and placed on ice. The ligation product was added when the cells were just thawed). Gently tap the cells to mix them and incubate on ice for 30 min.

[0186] 5) Then place the centrifuge tubes in a 42 ℃ water bath for 90 s, and immediately place them in an ice bath for 5 min.

[0187] 6) Add 500 μL of LB (antibiotic-free) medium to the centrifuge tube and incubate at 150 rpm and 37 °C for 60 min with shaking to allow the bacteria to recover.

[0188] 7) Mix the bacterial culture in the centrifuge tube thoroughly, add 100 μL to LB solid agar medium containing ampicillin, and gently spread the bacterial culture with a sterile bent glass rod. After the surface of the plate is dry, invert the plate and incubate at 37 °C for 12 h.

[0189] 8) Remove the plate, pick the milky white positive single clones onto 600 μl of LB liquid medium (containing 100 ug / ml ampicillin antibiotic), and incubate at 37℃ with shaking for 8 h. Perform bacterial PCR using pLB vector universal primers. Clones identified as positive by agarose gel electrophoresis are sequenced for verification, and plasmids are extracted for subsequent experiments.

[0190] The universal primer sequences for the pLB vector are as follows:

[0191] Forward Primer: 5'-CGACTCACTATAGGGAGAGCGGC-3'

[0192] Reverse Primer: 5'-AAGAACATCGATTTTCCATGGCAG-3'

[0193] Example 3: Transformation of Arabidopsis thaliana Col-0 by Zm00001d010894

[0194] 3.1 Construction of plant expression vectors for candidate genes

[0195] The steps for constructing the pCAMBIA3301-Zm00001d010894 vector are as follows:

[0196] 1) Linearization of pCAMBIA3301 vector

[0197] The vector pCAMBIA3301 was digested with Nco I and BstE II restriction enzymes in a 37°C water bath, as follows:

[0198] plasmid 1ug

[0199] Nco I1ul

[0200] BstE II1 ul

[0201] Buffer10 ul

[0202] The rubber was then washed in a 37°C water bath for 3 hours, and then cut and recycled.

[0203] 2) Preparation of Zm00001d010894 fragment

[0204] Using the cDNA recovered in 2.2.1 as a template, the gene fragment encoding Zm00001d010894 was amplified by PCR. The primers used included target fragment-specific primers and vector overlapping sequences. The primer sequences are as follows:

[0205] LF: 5'- ACGGGGGACTCTTGAC ATGGAGGAACTACGGTGTCT-3'

[0206] LR: 5'- ATTCGAGCTGGTCAC TCAAAGGCTTCTCATATACT-3'

[0207] The underlined part is the carrier overlap sequence.

[0208] The PCR reaction system is as follows:

[0209]

[0210] The PCR amplification procedure is as follows:

[0211]

[0212] The amplified products were validated by electrophoresis and recovered by gel cutting.

[0213] 3) The linear fragment of the vector obtained in step 1) and the target gene fragment obtained in step 2) are ligated to generate a recombinant vector. The ligation principle is in-fusion, and the reagent used is the Seamless Assembly Cloning Kit from Clone Smarter Technologies. The ligation system is as follows:

[0214]

[0215] Mix gently and react at 50°C for 15 min.

[0216] 4) Transformation

[0217] Thaw Fast-T1 competent cells on ice, add 10 μL of recombinant product to 100 μL of competent cells, gently tap the centrifuge tube to mix, place on ice for 30 min, then heat shock in a 42 °C water bath for 30 s, immediately transfer to ice to cool for 2 min, add 450 μL of LB medium at room temperature, then culture in a shaker at 37 °C and 200 rpm for 1 hour. After that, take 100 μL of cells and spread them evenly on a kanamycin-resistant LB plate, and incubate overnight in a 37 °C incubator.

[0218] 5) Screening for positive clones

[0219] Use the following primers to perform positive clone PCR screening, and extract plasmids from the bacterial cultures that have been sequenced correctly for later use.

[0220] LF: 5'- ACGGGGGACTCTTGAC ATGGAGGAACTACGGTGTCT-3'

[0221] LR: 5'- ATTCGAGCTGGTCAC TCAAAGGCTTCTCATATACT-3'

[0222] Sequencing results indicate that the recombinant vector pCAMBIA3301-Zm00001d010894 is created by replacing the 5'- gene in pCAMBIA3301 with the gene from Zm00001d010894 shown in SEQ ID No. 2. ACGGGGGACTCTTGAC -3' and 5'- GTGACCAGCTCGAAT A small fragment between -3' was extracted, keeping the other nucleotides of pCAMBIA3301 unchanged, to obtain a recombinant expression vector expressing the Zm00001d010894 gene. The promoter for Zm00001d010894 is CaMV 35Spromoter.

[0223] A schematic diagram of the construction of the recombinant vector pCAMBIA3301-Zm00001d010894 and a vector map of the recombinant vector are shown below. Figure 3 As shown.

[0224] 3.2 Preparation of Agrobacterium infection solution

[0225] 1) Take Agrobacterium EHA105 competent cells stored at -70 ℃ and thaw them on ice.

[0226] 2) Add 1 μg of plasmid DNA to competent cells, mix gently, and incubate on ice for 5 min.

[0227] 3) Place the centrifuge tubes in liquid nitrogen for quick freezing for 5 minutes, then quickly place them in a 37°C water bath for 5 minutes without shaking the water surface; then place the centrifuge tubes back on the ice and keep them in an ice bath for 5 minutes.

[0228] 4) Under aseptic conditions, add 800 μL of antibiotic-free LB liquid medium and shake the medium at 28 °C for 2-3 hours to revive the bacteria.

[0229] 5) Centrifuge at 5000 rpm for 1 min to collect the bacteria, keep 100 μL of supernatant, gently resuspend the bacteria by pipetting, spread on LB agar plates containing the appropriate antibiotic, and incubate upside down in a 28 °C incubator for 48-72 hours.

[0230] 3.3 Agrobacterium infection in Arabidopsis thaliana

[0231] 1) Pick a single colony with an inoculation needle and incubate it in 50 ml LB liquid medium (containing 50 ug / ml Kan) at 28 ℃ for 2 days.

[0232] 2) Centrifuge at 5000 rpm for 8 min and collect the bacterial cells.

[0233] 3) Resuspend the bacterial cells; first prepare a bacterial resuspension solution (100ml ddH2O, 5g sucrose, 10ul Silwet L-77), then resuspend the bacterial cells using the resuspension solution to achieve the final OD. 600nm The value is 0.8.

[0234] 4) Select Arabidopsis thaliana plants that have grown for about 4 weeks, are developing normally, and have just started to flower. First, remove the pods from the plant, pour the prepared bacterial suspension into a petri dish, and immerse the entire inflorescence in the bacterial suspension for 10 seconds.

[0235] 5) Soaked Arabidopsis ecotype col-0 (hereinafter referred to as wild Arabidopsis) plants were treated in the dark for 24 hours, and then normal light was restored.

[0236] 6) After the Arabidopsis thaliana matures, the seeds (T1) are harvested, dried, disinfected with 6% sodium hypochlorite, planted on MS medium containing 50 ug / ml glufosinate herbicide, and the Arabidopsis thaliana is cultured to obtain positive transformation plants (T1). The seeds of Arabidopsis thaliana T2 are then harvested.

[0237] 3.4 Overexpression of Zm00001d010894 leads to earlier flowering in Arabidopsis thaliana.

[0238] The phenotypes of T2 generation plants derived from the transgenic Arabidopsis thaliana lines OE-1, OE-5, and OE-10 (Zm00001d010894) were investigated. The transgenic lines and wild-type (WT) plants were planted in small pots and grown in a greenhouse at 22°C (16 h light / 8 h dark), and their flowering time was observed. Results are as follows: Figure 4 As shown, the results indicate that the flowering period of all three transgenic lines was significantly shorter than that of the wild-type material, suggesting that Zm00001d010894 can advance the flowering period of Arabidopsis thaliana.

[0239] Example 4: Construction of the CRISPR / Cas9 transgenic maize line Zm00001d010894

[0240] 4.1 Constructing the knockout vector for Zm00001d010894

[0241] 1) Linearization of CPB vector

[0242] The CPB vector was linearized by digesting it with HindIII restriction enzyme at 37 ℃. The enzyme digestion system is as follows:

[0243] plasmid 1ug

[0244] HindⅢ1ul

[0245] Buffer10 ul

[0246] The rubber was then washed in a 37°C water bath for 3 hours, and then cut and recycled.

[0247] 2) Screening of target genes for Zm00001d010894 gene

[0248] Generate a target list using the online target prediction website (http: / / crispor.tefor.net / ), and select the following targets:

[0249] T1:5'-CGGCTCCAAGATCACAAGAC-3',

[0250] T2: 5'-CTCGTAGAACTAGAGCATGG-3'

[0251] T3: 5'-TGGTCGCACTCCTGTTCTGC-3'

[0252] 3) Construction of sgRNA expression cassette

[0253] The sgRNA expression cassette template is shown in Sequence 7. The target sequences T1, T2, and T3 are replaced at positions nnnnnnnnnnnnnnnnnn in Sequence 7 to obtain the sgRNA1, sgRNA2, and sgRNA3 sequences. These are then sent to a biotechnology company for synthesis.

[0254] The expression cassette of sgRNA1 is a DNA molecule with the nucleotide sequence shown in SEQ ID No. 4, the expression cassette of sgRNA2 is a DNA molecule with the nucleotide sequence shown in SEQ ID No. 5, and the expression cassette of sgRNA3 is a DNA molecule with the nucleotide sequence shown in SEQ ID No. 6.

[0255] 4) The linear fragment of the CPB vector obtained in step 1) and the sgRNA expression cassette fragment obtained in step 3) were ligated using homologous recombination. The ligation principle is in-fusion, and the reagent used was the Seamless Assembly Cloning Kit from Clone Smarter Technologies. The ligation system is as follows:

[0256] 2*Assembly Mix5ul

[0257] CPB linearized carrier 2 ul

[0258] sgRNA1 / 2 / 3 expression cassette fragment 3 μL

[0259] Total 10 ul

[0260] Gently mix and react at 50°C for 15 minutes to obtain recombinant vectors CPB-sgRNA1, CPB-sgRNA2, and CPB-sgRNA3, respectively.

[0261] 5) Transformation

[0262] Thaw Fast-T1 competent cells on ice. Add 10 μL of the recombinant vector obtained in step 4) to each 50 μL competent cell. Gently tap the centrifuge tube to mix. Place on ice for 30 minutes. Then heat shock in a 42 °C water bath for 30 seconds. Immediately transfer to ice to cool for 2 minutes. Add 450 μL of LB medium at room temperature. Then culture in a shaker at 37 °C and 250 rpm for 1 hour. Then take 100 μL of cells and spread them evenly on LB plates containing kanamycin resistance. Incubate overnight in a 37 °C incubator.

[0263] 6) Screening for positive clones

[0264] The bacterial cells obtained from step 5) are screened for positive clones, and plasmids are extracted from the bacterial cultures that have been sequenced correctly for later use.

[0265] Sequencing results show that:

[0266] The recombinant vector CPB-sgRNA1 is formed by inserting the gene from positions 18-542 of SEQ ID No. 4 into the 5′- of CPB. TCACGCTGCACTGCACA -3′ and 5′- CTTGGCACTGGCCGTCGTTTTACAAC Between -3′, a recombinant expression vector expressing sgRNA1 was obtained.

[0267] The recombinant vector CPB-sgRNA2 is created by inserting the gene from positions 18-542 of SEQ ID No. 5 into the 5′- of CPB. TCACGCTGCACTGCACA -3′ and 5′- CTTGGCACTGGCCGTCGTTTTACAAC Between -3′, a recombinant expression vector expressing sgRNA2 was obtained.

[0268] The recombinant vector CPB-sgRNA3 is created by inserting the gene from positions 18-542 of SEQ ID No. 6 into the 5′- of CPB. TCACGCTGCACTGCACA -3′ and 5′- CTTGGCACTGGCCGTCGTTTTACAAC Between -3′, a recombinant expression vector expressing sgRNA3 was obtained.

[0269] 4.2 Obtaining EHA105 / CPB-sgRNA1, EHA105 / CPB-sgRNA2, and EHA105 / CPB-sgRNA3

[0270] Recombinant vectors CPB-sgRNA1, CPB-sgRNA2, and CPB-sgRNA3 were introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium, which were named EHA105 / CPB-sgRNA1, EHA105 / CPB-sgRNA2, and EHA105 / CPB-sgRNA3.

[0271] A schematic diagram of the construction of the recombinant vector CPB-sgRNA and a vector map of the recombinant vector are shown below. Figure 5 As shown.

[0272] 4.3 Obtaining T0 generation maize with Zm0000d010894 gene knocked out

[0273] The transformation method using Agrobacterium-mediated transformation of maize embryos was employed. EHA105 / CPB-sgRNA1, EHA105 / CPB-sgRNA2, and EHA105 / CPB-sgRNA3 prepared in section 4.2 were transferred into B104 to obtain T0 generation transgenic maize. Basta was applied to the leaves of the T0 generation transgenic maize plants; plants whose leaves grew normally (resistant seedlings) were identified as T0 generation transgenic plants. The transgenic T0 plants were self-pollinated, and harvested after maturity to obtain T1 generation transgenic seeds, including knockout lines KO#1 and KO#2 mutant plants.

[0274] 4.4 Genotype and Phenotype of the Zm00001d010894 Knockout Line

[0275] Seeds of maize inbred line B104 (WT) and T1 generation transgenic seeds of knockout lines were planted in two rows for each material, with a row length of 3 meters, a plant spacing of 0.25 meters, a row spacing of 0.6 meters, and three replicates.

[0276] Leaves from transgenic plants were collected for DNA extraction. DNA extraction was performed using the same method as described in section 2.1.2. DNA level detection was performed on positive plants of the Zm00001d010894 gene knockout mutant. Genomic DNA was extracted from the knockout mutant plants and used as a template, with F2 and R2 primers for amplification. Wild-type plant genomic DNA and ddH2O served as negative controls. The reaction system is as follows:

[0277] ddH2O6 μL

[0278] 2×Mix 10 μL

[0279] 5' primer (10 pmol / μL) 1 μL

[0280] 3' primer (10 pmol / μL) 1 μL

[0281] Template 2 μL

[0282] Total volume 20 μL

[0283] The nucleotide sequences of F2 and R2 are as follows:

[0284] F2: 5'-GGGAACGGATTGATTTGATGTA-3′

[0285] R2: 5'-AATGAAATGGTGATGGATCAACTTA-3′

[0286] The amplification reaction program was as follows: Round 1: denaturation at 95℃ for 5 min; Round 2: denaturation at 95℃ for 10 sec, annealing at 56℃ for 15 sec, extension at 72℃ for 15 sec, 35 cycles; Round 3: extension at 72℃ for 5 min. After the program, the amplification was detected by 2.0% agarose gel electrophoresis. Figure 6 As shown in Figure a, compared to the wild-type material, the bands of the mutant plants in the transgenic plant material are smaller, indicating that the transgenic plants have small fragment deletions. Further extraction of the target band for sequencing revealed that the main mutant genotypes in the transgenic positive plants are... Figure 6 The two types shown in b:

[0287] There are two types of mutations, one of which is Figure 6 Bands 4, 5, and 8 of sequence 'a' in the Zm00001d010894 genome contain a 13-base deletion between positions 1029-1041 and a 71-base deletion between positions 1107-1177. The DNA molecule obtained by keeping the rest of sequence 3 unchanged encodes a DNA molecule obtained by deleting 55 bases (positions 1-55) of sequence 2 in the sequence listing while keeping the rest of sequence 2 unchanged. This mutation prevents translation. Another possibility is... Figure 6 The DNA molecule obtained by deleting 139 nucleotides (positions 1037-1175) from the Zm00001d010894 genome in bands 13 and 14 of sequence 'a', while keeping the other nucleotide sequences of sequence 3 unchanged, is a DNA molecule that encodes a DNA molecule obtained by deleting 53 nucleotides (positions 1-53) from sequence 2 in the sequence listing, while keeping the other nucleotide sequences of sequence 2 unchanged. This mutation prevents translation from taking place.

[0288] The plant height, ear height, and flowering period of the T2 generation plants were investigated. The results showed that, compared to the wild-type B104, the knockout plants of KO#1 and KO#2 had higher ear heights, larger relative ear heights, and longer pollen shedding periods. Figure 7The results showed that knockout of the Zm00001d010894 gene significantly increased ear height, relative ear height, and prolonged flowering period in maize; thus proving that the target gene has an important biological function in regulating ear height and flowering period in maize.

[0289] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. sequence list <110> Institute of Crop Science, Chinese Academy of Agricultural Sciences <120> Proteins that regulate ear height and flowering time in maize, their encoding genes, and their applications <160> 7 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1060 <212> PRT <213> Corn (Zea mays) <400> 1 Met Glu Glu Leu Arg Cys Leu Ser Thr Val Ala Glu Ser Asp Asp Ala 1 5 10 15 Pro Ala Glu Gln Glu Cys Asp His Phe Ser Leu Arg Leu Gly Ser Pro 20 25 30 Gly Cys Leu Gly Asp Lys Ala Thr Thr Val His Gln Gly Glu Leu Gly 35 40 45 Thr Pro Glu Arg Leu Val Leu Leu Thr Val Asp Gly Phe Val Arg Gly 50 55 60 Tyr Val Ala Met Leu Gln Lys Lys Asp Pro Lys Leu Cys Ser His Ile 65 70 75 80 Phe His Asn Gln Pro Gln Tyr Asp Glu His His Asp Ser Ser Pro Val 85 90 95 Leu Val Ser Lys Tyr His Arg Trp Asp Cys Ser Arg Cys Leu Asp Ser 100 105 110 Val Glu Val Ser Gly His Arg Pro Thr Ser Glu Asn Val Ser Met Gln 115 120 125 Gln Asn Gly Met Asn Asp Gly Cys Ser Ile Ser Ile Val Arg Ile Leu 130 135 140 Pro Asn Ser Val Asp Ser Arg Arg Leu Phe Ser Cys Thr Gln Gln Ser 145 150 155 160 Ser Gln Gly Asn Asp Arg Leu Thr Leu Ser Lys Thr Ala Gln Glu Cys 165 170 175 Asn Ser Lys Cys Ser Ser Pro Gly Asn Lys Ala Ile Thr Ala Met Asn 180 185 190 Val Pro Val Ala Glu Glu Asn Val Pro Glu Ala Leu Val Asp Thr Arg 195 200 205 Val Pro Ser Ile Glu Val Leu Gln Ala Ser Pro Asn Ser Ile Asp Leu 210 215 220 Ser Ala Asn Ile Leu Asn Ala Val Ser Lys Asn Val Arg Asp Leu Pro 225 230 235 240 Asp Asp Val Glu Glu Asn Gly Thr Gln Asn Pro His Ser Leu Lys Pro 245 250 255 Cys Val Ala Pro Asn Glu Asp Glu Asn Asn Ile Ala Asn Asp Asp Leu 260 265 270 Asn Glu Pro Asn Val Cys Lys Pro Val Ser Gly His Lys Ser Lys Gln 275 280 285 Val Cys Asn Met Gly Pro Arg Arg Ala Ser Ser Lys Arg Asn Val Glu 290 295 300 Ser Asp Gly Ser Glu Gln Val Gly Val Ser Ala Asp Ala Val Gln Val 305 310 315 320 Asp His Thr Asn Ser Val Asp Leu Cys Glu Gly Gly Lys Arg Lys Met 325 330 335 His Leu Glu Val Gly Lys Gly Asn Asp Thr Thr Asn Gln Gln Val Asp 340 345 350 Glu Ile Gln Ser Arg Ala Val Lys Asn Lys Ala Lys Tyr Thr Gly Val 355 360 365 Asp Lys Leu Glu Asp Gly Ser Ser Leu Met Asn Trp Leu Lys Ser Thr 370 375 380 Asn Lys Lys Val Arg Thr Lys Lys Lys Asp Ser Glu His Lys Asn Leu 385 390 395 400 Asp Ser Ser Ser Ile Ser Arg Ser Tyr Pro Asp Ile Val Ala Ser Asn 405 410 415 Asp Met His His Asp Phe Leu Pro Ser Val Gly Asp Val Gly Gln Ala 420 425 430 Asn Val Pro Ser Thr Thr Ser Ala Lys His Gly Asn Gly Asn Ala Gln 435 440 445 Asn Asp Lys Leu Glu Gln Asn Met Gln Lys Met Asp Gly Leu Cys Glu 450 455 460 Asn Glu Ser Arg Asn Leu Lys Gln Arg Phe Phe Ser Asn Glu Lys Ser 465 470 475 480 Thr Ile Leu Leu Lys Arg Lys Leu Leu Ser Thr Ser Val Val His Asp 485 490 495 Glu Asn Ile Glu Asn Ser Asn Ile Lys Arg Asp Met Leu Arg Ser Asp 500 505 510 Asp Leu Pro Gln Met Glu Pro Glu Gly Ser Val Gln Arg Cys Leu Ala 515 520 525 Lys Val Ser Leu Gly Lys Gln Lys Ile Gln Asn Val Ser Gly Leu His 530 535 540 Lys Lys Asn Ile Pro Lys Asn Lys Lys Gly Lys Gln Lys Val His Lys 545 550 555 560 Lys Gln Asn Val Ile Asp Asp Phe Pro Met Asp Ile Val Glu Leu Leu 565 570 575 Ala Arg Asn Gln His Glu Arg Gln Leu Met Thr Asp Thr Asn Ser Leu 580 585 590 Glu Asn Cys His Thr Gln Pro Lys Val Ala Gln Val Asp Cys Ala Ala 595 600 605 Phe Ala Ala Lys Gly Cys Pro Thr Asn Ala Ser Asn Glu Phe Asn Thr 610 615 620 Asn Phe Gln Lys Ser Leu Ala Ser Glu Ser Lys Gln Lys Ser Leu Gln 625 630 635 640 Asp Gln Ala Ser Pro Ser Thr Glu Ala Ala Asn Val Asn Pro Gln Asp 645 650 655 Leu His Thr Gln Lys Ser Ser Gln Cys His Ala Ala Ser Ser Thr Ser 660 665 670 Thr Glu Val Pro Asn Gly Gln Pro Pro Glu Ser Gln Met Gln Asn Ser 675 680 685 Leu Gln Val His Val Leu Pro Ile Lys Arg Ser Phe Ile Val Tyr Pro 690 695 700 Ser Lys Leu Pro Val Leu Asp Asp Ile Leu Glu Cys Thr Gln Glu Gln 705 710 715 720 Gln Thr Gln Phe His Arg Asp Gly Gly Val Thr Ile Ala Cys Thr Ser 725 730 735 Pro Met Phe Ser His His Gln His Ile Ala Glu Val Pro Ala Arg Ser 740 745 750 Trp Arg Asn Asn Gly Glu Lys Lys Leu Met Trp Asp Ser Phe Lys Thr 755 760 765 Ala Ser Arg Asn Ser Pro Thr Ser Ser Tyr Gly Phe Gln Phe Gly Asn 770 775 780 Arg Leu Gln Glu Val His Ser Ser Pro Ser His Ala Tyr Gly Ala Ser 785 790 795 800 Ser Asn Tyr Ala Ala His Gln Pro Val Ile Val Ala Val Asp Gln Pro 805 810 815 Arg Ser Val Pro Ser Thr Thr Ser Thr Met Glu Ala Gly Arg Leu Tyr 820 825 830 Asp Arg Arg Ile Pro Gly Gln Ser Gly Leu Tyr Pro Lys Glu Pro Met 835 840 845 Pro Ala Thr His Leu Leu Arg Leu Met Asp Ser Ser Thr Ala Pro Asp 850 855 860 Phe Thr Asn Tyr Gln Arg Ala Asn Arg Arg Gln Met Glu His Gln Thr 865 870 875 880 Gln Thr Leu Asp Ser Gln Tyr Thr Gln His Asp Gln Tyr Asn Gly Ser 885 890 895 Leu Ser Thr Ser Tyr Gly Arg His Ile Thr Gly Lys Val Pro Pro Thr 900 905 910 Leu Gln Asp Leu Ser Arg Arg Gln Val Gln Gln Asn Leu His Arg Pro 915 920 925 Leu Arg Pro His Pro Arg Val Gly Val Leu Gly Ser Leu Leu Gln Gln 930 935 940 Asp Ile Ala Asn Trp Tyr Glu Asn Cys Gly Pro Pro Gln Ser Gly Tyr 945 950 955 960 Arg Leu Gly Val Ser Lys Gly Thr Ala Ser Leu Asp Met Asn Arg His 965 970 975 Gly Asn Tyr Glu Thr Leu Asn Ser Gly Val Phe Thr Ala Gly Trp Asn 980 985 990 Ala Leu Gln Leu Gly Ser Val Ser Ser Leu Ala Asp Pro Glu Tyr Arg 995 1000 1005 Leu Pro Arg Tyr Gly Thr Gly Gln Pro Cys Thr Gly Gly Asn Gly Arg 1010 1015 1020 Thr Val His Pro Leu Asp Lys Leu Val Arg Lys Asp Ile Cys Val Thr 1025 1030 1035 1040 Asn Arg Asn Pro Ala Asp Phe Thr Val Ile Ser Asp Met Asn Glu Tyr 1045 1050 1055 [[ID=—13]]Met Arg Ser Leu 1060 <210> 2 <211> 3183 <212> DNA <213> Zea mays <400> 2 atggaggaac tacggtgtct atctacagtc gctgaatctg atgacgctcc agcagaacag 60 gagtgcgacc acttctccct gaggctgggt tcacctggat gcctaggtga caaggctaca 120 actgttcacc aaggtgagct gggtacacct gaacgcctag tcttattgac ggttgatggt 180 tttgtcaggg gttatgttgc tatgcttcag aagaaggatc caaaactttg ctctcatatt 240 ttccataacc agccacaata tgatgagcac catgattcgt ccccagtttt ggtgtcaaag 300 tatcatcgat gggattgctc aagatgtctt gatagtgtgg aagtttcagg ccataggcca 360 Note: In the translation of line 13, there seems to be a hyphen in the original text which is not present in the English translation. It should be "Met Arg Ser Leu". Also, in line 23, "玉米(Zea mays)" is translated as "Zea mays". These are standard translations for these biological terms. The numbers and tags are kept as they are according to the requirements.acatcggaaa atgtttctat gcagcagaat ggaatgaatg atggctgctc tatttcaatt 420 gttcggattt tgcctaatag tgttgattcc agaagactgt tttcttgcac acagcaatca 480 tctcaaggga atgatcgatt gaccctttca aagactgccc aagaatgcaa ttcaaaatgc 540 agttctcctg gcaacaaagc aattactgcg atgaatgttc footgctga agaaaatgtt 600 ccagaggcac tcgttgatac gagggttcca tctatagaag tttacaggc ctctcccaat 660 agtattgatt tgtcagcaaa catcttgaat gctgtctcga agaatgtccg cgatttacct 720 gatgatgttg aagaaaatgg cacacagaat ccacacagtc taaaaccttg tgtggcgcca 780 aatgaagatg agaataacat agctaatgat gacctcaatg agcctaatgt ttgtaaacca 840 gtatctgggc acaaaagcaa acaagtctgc aacatgggtc cacgccgagc atcgtcaaaa 900 agaaatgttg aatctgatgg ttctgaacag gtaggggttt ctgcagatgc cgttcaagtg 960 gaccatacta acagtgttga tctctgtgag ggtggtaaaa gaaaaatgca ccttgaggtt 1020 ggaaaaggta atgacactac taatcagcaa gtggacgaaa tccagtcaag agctgtcaag 1080 aaaggcaa atacacagg agtagacaag ttagagatg gatccctctct atgaactgg 1140 ctgaaaagca ctaatagaa agttagaaaaaaaag actcagaaca ctgaatctt 1200 gattcccttt ctatttcaag gtcttaccca gatatagttg ctctaatga tatgcatcat 1260 gatttctac cctcagttgg ggatgtggc caggcaatg taccatctac taccagtgcc 1320 aagcatggga atggaatgc acagaatgac aactggagc aaatatgca gagatggat 1380 ggcctgtgtg aaaatgaatc tagaacttg aaacagaggt tctctcaa tgaaaaatca 1440 acgattttgc taaagagaaa gctactgtcc acttcggttg tccatgatga gaacattgag 1500 aacagtaata taagagaga tatgctcagg tcagatgat tgcctcaat ggaacctgaa 1560 ggctctgtac agagatgttt ggcaaggtt tctctgta aaaaagat ccagaatgtg 1620 tctggcctcc acaagaattaccaaag aagaaag gaaagcaag ggtgcacaag 1680 aaacagaatg tgatagacga cttccccatg gatatgttg aacttctcgc cagaaatcag 1740 catgagagac agttgatgac tgacaccaat tcttggaaa actgtcatac tcaacccaag 1800 gtagctcaag ttgattgtgc tgcattgca gccaagggtt gtcccaccaa tgcatcaat 1860 gagttcaca ctaatttcca aaaatctttg gcatcggaaa gtaagcagaa gtccttacag 1920 gatcagcat cacccagtac agaggctgcc aatgtgaatc cgcaggattt actactcag 1980 aagtcatcac agtgtcatgc agcatccagc accagcaccg agttccaaa tggtcagcct 2040 ccagaatcac aaatgcaaaa ttcgctcag gttcatgtgt tacccatca acggtctttc 2100 attgtgtacc cttcaaaatt acctgtcctt gatgacattt tggagtgtac ccaagaacaa 2160 cagacacaat tccacaggga tggaggttc accattgcat gtacctcacc tatgttttca 2220 catcatcaac atttgctga agtgcctgct cggagctgga ggaatacgg ggaaagaag 2280 ttaatgtggg attctttca gandagcttca agaattcac icacatcgtc atatggtttt 2340 caattcggaa acaggctca agaagttcat tcatctccca gtcatgctta tggacttct 2400 agtaactatg cagctcacca gccagtaatt gtggctgtag atcagccgag aagtgttcca 2460 agcacacat cgactatgga ggctggtagg ttgtatgatc gaaggattcc tggacagtca 2520 ggcctctacc caaaagagcc tatgcctgca acacatcttc tgagattgat ggactcatca acagctccag acttcacaaa ctatcaaaga gctaacaggc gccagatgga acatcaaaca 2700. 2700. 2700. 2700. 2700. 2700. 2700. 2700. 2700. 2700 2760. tatggaagac acataactgg aaaggttcca ccgacactgc aagacttatc tcggcgtcag gtccagcaaa acctgcacag gcctttacgc cctcatcctc gggtggggcgt gcttggttcg 2820 ttgctgcagc aggatatcgc aaactggtat gaaaactgcg ggccgccaca gtctggatac 2880 aggctgggcg tttctaaagg gacggcatcg cttgatatga acagacatgg aaactacgag accttgaact caggagtgtt cacagcagga tggaatgccc ttcaattggg ttctgttagc tctcttgccg atccagagta ccggttgcca aggtatggta caggtcagcc ttgtacaggt 3060 ggcaatggga gaacggttca cccgttggat aagcttgtgc gaaggatat ctgtgtgact 3120. aacagaaacc cagctgattt tactgtaatt agtgacatga atgagtatat gagaagcctt from 3183 <210> 3 <211> 7300 <212> DNA <213> Zea mays <400> 3 ggcccgcagc gaaataacaa aaatggaaaa aaaaaactcg cccctctcgc ggtatcgcct 60 tcgccactcc gcctctcggc tcggctctcg cgtgaaattc cactttcccc atccgcgtcc 120 gctgcccccg ggccctccgc gctagctacc gctccctccg ccgccgcccc cgccctattc 180 cccaccgctg ccggcgcgcg cgtgctcgac tgattccgcg cccccacccc gcagcggatt 240 tcacctcccg tcgcggatct ggtccgtggc agcgggggaa caaggcgaag aacccgaccg 300 cggttacgac ggcgtagggg gccatcaacg acgacctagc tggggacgac gtccgtcggc 360 gcagctcagc cacgcccgac cccttaagcg cgacggcaac agcaagggcg gcactggtaa 420 aaatcaatat tttaactctt gcagtcggct cgggtctttg gtttccgaag ccttttctgc 480 ttaacgactt gttagatcat ttttgctacg cacgacgtcg actttagctc tactttcgct 540 gctgttctag gacctcctta gtccttattc tgcacacact cctgtgaaac ctcactctga 600 ctgcatggaa gccgtggccg cctatatttc atgtcgcgaa aaacgcgggc tttgcctgta 660 ctcagtaaac cctgtcacag ttaacacagc agcctcgctg gcatacacgt gcatggaagc 720 taatcgtgtt ctatctatcg ctgccttatt tggcaatcga cgttgcgttt ttatttttac 780 atgtactctg ggaacggatt gatttgatgt acaggttgta ttcatttctt ccctttgttg 840 cggtgtccgc atggctcgtt atgctagttc ctgattcctt ttgtacgtac attcttcgtt 900 tccgcgtaca ctagctatct ctttctgcag cctcgacgaa acaatagatg tgtagaataa 960 gtcatgcaat gcttcctgtt tttttcttta tcaggcggct atgcacaagg tattcggttc 1020 ggctccaaga tcacaagact ggagtaacaa agttgtgctt cgcgctgcgc tgcgctgctt 1080 ctagcgaatg gaagcggctg ctcttgctcg tagaactaga gcatggagga actacggtgt 1140 ctatctacag tcgctgaatc tgatgacgct ccagcagaac aggagtgcga ccacttctcc 1200 ctgaggtaac cattttctat gtccaatagt agtgtgtttg gtttgaggaa tgagatagtc 1260 catcatcttc ttacttctca tttttcttgt ttgatttatg gaattcttct tacttctcat 1320 tttcttgttt gatttataga atggaataag ttgatccatc accatttcat tcattgcatg 1380 ctcataatta gtaataatgt gaggaatgag ttcactccac caaacttgtg gaatagacat 1440 atgaatatga tgcatgcacc acctcatcta gaatggattg actcttcaaa ccaaacaccc 1500 cctagatgtc tgcatttctc cattgactgc cattcaacga tgcatctcta tctatctagc 1560 agtgtagcac tgtttagtgg gtactgtgtg agcatggtta attaagccta cttattatac 1620 agtcatttgt tgtatgcaag catgatacat tgccattatt gtgacaatga ttattcaacg 1680 tccaggtgag catggtttgt catctttctg ccctatacag tcatatactc atatgttgtc 1740 tgcaagcatg gcacaagcat gttgcatgta aggagtgagg tggtcaacta gagcagaatg 1800 ccatgtgtaa tttttatatt gtttttttgg attgtcttga gtcatttaat aaagtgttta 1860 gacagtccag agttaatatt attattatat attccctttg ttagcctttc ggttttgtaa 1920 tgattacact aaatcctcca tcctccttat ttatggttag tatgccagct agctgttgcc 1980 tcactaatgt atttcttcca ctaaagtgta aatcactttt ttcacagaag gtttcaatta 2040 gtcttttata ttataatttt ataacacaag caactggatt tgcgcatata tgttgtctct 2100 tcattcgatg gatagatctg gcatatggtc tagtatgttt atgctccaca caactacctt 2160 ctatagtaga cattacttttt ttcacaaaag gagtgcatac tttgaataaa gttatatatg 2220 gaattttgta tttgctgaga tggttcagtt tggtctctat accttaaaat tggtcattaa 2280 acccatggtt tcaaatgtga tgtgaaggct gggttcacct ggatgcctag gtgacaaggc 2340 tacaactgtt caccaaggtg agctgggtac acctgaacgc ctaggtgaca cctttgaaac 2400 atagattgaa cccatatcct tccgataact atctttatat gctttttgtgc tctcagtttg 2460 aaacgtctga cattatactt gatgatttta gccatatggt tcttcctttc tgtttaatac 2520 cagctaagta aaaatgaacg aatgatataa atgtttcttt ctttattaca cattcacaaa 2580 gtgagaggat aaaatgacat ccatgagtga aactgcctat gcataactat tgattgggaa 2640 ttgcttttgg atattgattc tttcttttt ctagagcaaa catttgatga ttcgtctatg 2700 catatatctt aagtcttatt gacggttgat ggttttgtca ggggttatgt tgctatgctt 2760 cagaagaagg atccaaaact ttgctctcat atttccata accagccaca atatgatgag 2820 caccatgatt cgtccccagt tttggtgtca aagtatcatc gatgggattg ctcaagatgt cttgatagtg tggaagtttc aggccatagg ccaacatcgg aaaatgtttc tatgcagcag aatggaatga atgatggctg ctctatttca attgttcgga ttttgcctaa tagtgttgat tccagaagac tgttttcttg cacacagcaa tcatctcaag ggaatgatcg attgaccctt tcaaagactg cccaagaatg caattcaaaa tgcagttctc ctggcaacaa agcaattact gcgatgaatg ttccagtagc tgaagaaaat gttccagagg cactcgttga tacgagggtt ccatctatag aaggtatggc tgagcatgtt gattcttaa ttattacttt ttgttgtata caacaagcta atatgacagt attttctcag ttttacaggc ctctcccaat agtattgatt tgtcagcaaa catcttgaat gctgtctcga agaatgtccg cgatttacct gatgatgttg aagaaaatgg cacacagaat ccacacagtc taaaaccttg tgtggcgcca aatgaagatg 3480. ttgtaacca gtatctgggc 3480. ttgtaacca gtatctgggc acaaaagcaa acaagtctgc aacatgggtc cacgccgagc atcgtcaaaa agaaatgttg aatctgatgg taagaggaaa aggaataaat ctactaaact gcctggtatt tcagatctca 3600 aatttgtca gagaaagcca aaaaaagaca aggctgttat cagaactcat aggttctgaa 3660 caggtagggg tttctgcaga tgccgttcaa gtggaccata ctaacagtgt tgatctctgt 3720 gagggtggta aaagaaaaat gcaccttgag gttggaaaag gtaatgacac tactaatcag 3780 caagtggacg aaatccagtc aagagctgtc aagaacaagg caaaatacac aggagtagac 3840 aagttagaag atggatcctc tctaatgaac tggctgaaaa gcactaataa gaaagttaga 3900 acaaagaaaa aagactcaga acacaagaat cttgattcct cttctatttc aaggtcttac 3960 ccagatatag ttgcttctaa tgatatgcat catgattttc taccctcagt tggggatgtg 4020 ggccaggcaa atgtaccatc tactaccagt gccaagcatg ggaatggaaa tgcacagaat 4080 gacaaactgg agcaaaatat gcagaagatg gatggcctgt gtgaaaatga atctagaaac 4140 ttgaaacaga ggttcttctc aaatgaaaaa tcaacgattt tgctaaagag aaagctactg 4200 tccacttcgg ttgtccatga tgagaacatt gagaacagta atataaagag agatatgctc 4260 aggtcagatg atttgcctca aatggaacct gaaggctctg tacagagatg ttggcaag 4320 gtatgatta actaagaa ttctactgaa atttataat tagatta cattcattta 4380 cgtgttttac ctactttgc tgacttgaat tgggacctt tgtccagcat aggattttta 4440 atccctttaa tgttaatgca ttgtgtcta tgccactttg ctcccatacc atccatgctt 4500 tccgttgtgt acaccactag gattttttga cactttttat gatattgag ttcacaagtt 4560 tgcacgcatg ccaacgaac tagttattg tgtgtgacta gttgggatg tcatgagca 4620 attagcgaat cccaaatgac atttactctct tttaaacta tatatataga cacacaca 4680 cacacaatgg tgcaagcaat aggaatccg tactgaattt actctgcttg tatacaata 4740 ttgtactctc ttctcgttac cacaggtttc tcttggtaaa caaagatcc agaatgtgtc 4800 tggcctccac aagaata taccaagaaaagcagaagg tgcacagaa 4860 acagaatgtg atagacgact tcccatgga cattgttgaa cttctcgcca gaaatcagca 4920 tgagagacag ttgatgactg acaccaattc tttggaaac tgtcatactc aacccaatt 4980 agctcaagtt gattgtgctg catttgcagc caagggttgt cccaccaatg catcaaatga 5040 gttcaacact aatttccaaa aatctttggc atcggaaagt aagcagaagt ccttacagga 5100 5160 gtcatcacag tgtcatgcag catccagcac cagcaccgag gttccaaatg gtcagcctcc 5220 agaatcaaa atgcaaaatt cgcttcaggt tcatgtgtta cccatcaaac ggtctttcat 5280 5340 gacacaattc cacagggatg gaggggtcac cattgcatgt acctcaccta tgttttcaca 5400 tcatcaacat attgctgaag tgcctgctcg gagctgggagg aataacgggg aaaagaagtt 5460 aatgtgggat tctttcaaga cagcttcaag aaattcacca acatcgtcat atggttttca 5520 attcggaaac aggcttcaag aagttcattc atctcccagt catgcttatg gagcttctag 5580 taactatgca gctcaccagc cagtaattgt ggctgtagat cagccgagaa gtgttccaag 5640 caacacatcg actatggagg ctggtaggtt gtatgatcga aggattcctg gacagtcagg 5700 cctctaccca aaagagccta tgcctgcaac acatcttctg agattgatgg actcatcaac 5760 agctccagac ttcacaaact atcaaagagc taacaggcgc cagatggaac atcaaacaca 5820 aactctggat tcacaatata cacagcatga tcagtataat gggtcactga gcacatcata 5880 tggaagacac ataactggaa aggttccacc gacactgcaa gacttatctc ggcgtcaggt 5940 ccagcaaaac ctgcacaggc ctttacgccc tcatcctcgg gtgggcgtgc ttggttcgtt 6000 gctgcagcag gatatcgcaa actggtatga aaactgcggg ccgccacagt ctggatacag 6060 gctgggcgtt tctaaaggga cggcatcgct tgatatgaac agacatggaa actacgagac 6120 cttgaactca ggagtgttca cagcaggatg gaatgccctt caattgggtt ctgttagctc 6180 tcttgccgat ccagagtacc ggttgccaag gtatggtaca ggtcagcctt gtacaggtgg 6240 caatgggaga acggttcacc cgttggataa gcttgtgcga aaggatatct gtgtgactaa 6300 cagaaaccca gctgatttta ctgtaattag tgacatgaat gagtatatga gaagcctttg 6360 agtgtgaggc agggaggagc gttgtagttg aatacgttta gatcgataaa tttcacctta 6420 tcagtgccaa gcaatcatca ttgatataga ggaaggcttt gtcgaatctt ctgcaaggta 6480 aaaaaaaaaa agatcctgtc ttccctctta tttctatttg ttaacagaat cacttagatg 6540 aaacttgaag catttcttac tttagatgga tggtgcatgc aggctctttg taagacattg 6600 atggatgttc tgtttcctgg aggcagagca acagctacca tagagccagg tgcagcctcc 6660 agttcattgt ctgcaaatgt tttatacata ggcgaagaac tgatgtcggg ttgccatgga 6720 aaaccctaat aaacttatat tttgtagata agcaaatgta caagggaagc atgtgagttt 6780 ttttttggg tactcctgtc ccagaataaa ctgcattctg cagttcaaaa tttgccccaa 6840 aggaatggcc catataggtt tgagatctaa tgcactctag tctagcaggt gtaccagctt 6900 actgtaccaa caaaaacaat tctgacttgt cagaaaaaaa atccctccgt ccggagtatg 6960 taccaaaggg ggtaagctat gtcatgtggt tgagcaatgt tggtcaactc gttctggctc 7020 cgagtgttgt atagcatcag actgccctga tgaacagcct attaaaagac tgcactgatg 7080 attcttcttt gttgtatcgt gatctaagtc tgaaaacgca gctggatttc agaagtcatg 7140 gagtccgaac tgtcaggagc cgctcacgcg gtccagtagg acatcatgga tgtagtgtta atgtgatccc acaacacaag ctccagatcc aggttcagtc agtctgtctc taacaggaga ctatacactt ctctattcta wishes aaatttcatt 7300 <210> 4 <211> 568 <212> DNA <213> Artificial Sequence <400> 4 tcacgctgca ctgcacaatc gggaattcgt aatcatgtca aaattggccc ttacaaaata gctagacgtg caggtggctg gatgtgcgct ccctgaat caacttgtgt ctcctccgat 180. tcagtccgca gatgaaactt ggtaataact gcagctgatc cgtcgtcatt catgctatgc aggggattcg atcttcagca tgtgcagtgc aggcaacaac aatctacgtt gtctgggctt gcgataggta cacgaccacg agggaaggca acgcgtgatg tatgggccgc gcctaagcat ccagcccacg cgggcgtgcg cgtcgtcgct acggcttgcg ggggaggga tcaagggacg 360 aaccgagaac tagtaccaga ccggccagcg agcattgcag acaccggctt ataagttcag ctgcgaccac cgctcccggc tccaagatca caagacgttt tagagctaga aatagcaagt taaaataagg ctagtccgtt atcaacttga aaaagtggca ccgagtcggt gcttttttta 540 agcttggcac tggccgtcgt tttacaac 568 <210> 5 <211> 568 <212> DNA <213> Artificial Sequence <400> 5 tcacgctgca ctgcacaatc gggaattcgt aatcatgtca aaattggccc ttacaaaata 60 gctagacgtg caggtggctg gatgtgcgct ccctgaatat caacttgtgt ctcctccgat 120 tcagtccgca gatgaaactt ggtaataact gcagctgatc cgtcgtcatt catgctatgc 180 aggggattcg atcttcagca tgtgcagtgc aggcaacaac aatctacgtt gtctgggctt 240 gcgataggta cacgaccacg agggaaggca acgcgtgatg tatgggccgc gcctaagcat 300 ccagcccacg cgggcgtgcg cgtcgtcgct acggcttgcg ggggaaggga tcaagggacg 360 aaccgagaac tagtaccaga ccggccagcg agcattgcag acaccggctt ataagttcag 420 ctgcgaccac cgctccctcg tagaactaga gcatgggttt tagagctaga aatagcaagt 480 taaaataagg ctagtccgtt atcaacttga aaaagtggca ccgagtcggt gcttttttta 540 agcttggcac tggccgtcgt tttacaac 568 <210> 6 <211> 568 <212> DNA <213> Artificial Sequence <400> 6 tcacgctgca ctgcacaatc gggaattcgt aatcatgtca aaattggccc ttacaaaata 60 gctagacgtg caggtggctg gatgtgcgct ccctgaatat caacttgtgt ctcctccgat 120 tcagtccgca gatgaaactt ggtaataact gcagctgatc cgtcgtcatt catgctatgc 180 aggggattcg atcttcagca tgtgcagtgc aggcaacaac aatctacgtt gtctgggctt 240 gcgataggta cacgaccacg agggaaggca acgcgtgatg tatgggccgc gcctaagcat 300 ccagcccacg cgggcgtgcg cgtcgtcgct acggcttgcg ggggaaggga tcaagggacg 360 aaccgagaac tagtaccaga ccggccagcg agcattgcag acaccggctt ataagttcag 420 ctgcgaccac cgctcctggt cgcactcctg ttctgcgttt tagagctaga aatagcaagt 480 taaaataagg ctagtccgtt atcaacttga aaaagtggca ccgagtcggt gcttttttta 540 agcttggcac tggccgtcgt tttacaac 568 <210> 7 <211> 568 <212> DNA <213> Artificial Sequence <400> 7 tcacgctgca ctgcacaatc gggaattcgt aatcatgtca aaattggccc ttacaaaata 60 gctagacgtg caggtggctg gatgtgcgct ccctgaatat caacttgtgt ctcctccgat 120 tcagtccgca gatgaaactt ggtaataact gcagctgatc cgtcgtcatt catgctatgc 180 aggggattcg atcttcagca tgtgcagtgc aggcaacaac aatctacgtt gtctgggctt 240 gcgataggta cacgaccacg agggaaggca acgcgtgatg tatgggccgc gcctaagcat 300 ccagcccacg cgggcgtgcg cgtcgtcgct acggcttgcg ggggaaggga tcaagggacg 360 aaccgagaac tagtaccaga ccggccagcg agcattgcag acaccggctt ataagttcag 420 ctgcgaccac cgctccnnnn nnnnnnnnnn nnnnnngttt tagagctaga aatagcaagt 480 taaaataagg ctagtccgtt atcaacttga aaaagtggca ccgagtcggt gcttttttta 540 agcttggcac tggccgtcgt tttacaac 568

Claims

1. A method for increasing ear height of maize, comprising increasing ear height by knocking out a gene encoding a protein in maize, wherein the protein is as follows A1) or A2) : A1) a protein with an amino acid sequence of SEQ ID No. 1; A2) a fusion protein with a tag linked to N-terminal and / or C-terminal of A1), and wherein the gene encoding the protein in maize is mutated by at least one of the following mutations on a DNA molecule with a coding sequence of SEQ ID No. 2 encoding a coding strand of the maize: F1) mutating the DNA molecule of SEQ ID No. 2 into Zm00001d010894 / -55bp, wherein the Zm00001d010894 / -55bp is a DNA molecule obtained by deleting nucleotides at positions 1-55 of the DNA molecule of SEQ ID No. 2, and keeping other nucleotide sequences of SEQ ID No. 2 unchanged; F2) mutating the DNA molecule of SEQ ID No. 2 into Zm00001d010894 / -53bp, wherein the Zm00001d010894 / -53bp is a DNA molecule obtained by deleting nucleotides at positions 1-53 of the DNA molecule of SEQ ID No. 2, and keeping other nucleotide sequences of SEQ ID No. 2 unchanged.

3. Use of the method of claim 1 or 2 in preparing mutant plants of maize and / or in breeding of maize.

4. Use of the protein of claim 1, a biological material for regulating expression of the gene encoding the protein, or a biological material for regulating activity or content of the protein, wherein the use is any of the following: D1) use in increasing ear height of maize and / or prolonging flowering period of maize; D2) use in preparing a reagent for increasing ear height of maize and / or prolonging flowering period of maize; and wherein the biological material is any of the following B1') and / or B2') : B1') a nucleic acid molecule for inhibiting expression of the gene encoding the protein, wherein the nucleic acid molecule is a DNA molecule expressing a gRNA targeting the gene encoding the protein, or is a gRNA targeting the gene encoding the protein, and wherein the nucleotide sequence of the target sequence of the gRNA is as shown in positions 1020-1039 of SEQ ID No. 3, positions 1107-1126 of SEQ ID No. 3, and / or positions 1171-1190 of SEQ ID No. 3; B2') an expression cassette, a recombinant vector, a recombinant microorganism, or a transgenic plant cell line containing the DNA molecule of B1').

5. Use of the protein of claim 1, or a biological material for regulating expression of the gene encoding the protein, or a biological material for regulating content of the protein, in advancing flowering period of Arabidopsis thaliana, and wherein the biological material is any of the following B1) to B7) : B1) a nucleic acid molecule encoding the protein; B2) an expression cassette containing the nucleic acid molecule of B1) ; B3) a recombinant vector containing the nucleic acid molecule of B1) or containing the expression cassette of B2) ; B4) a recombinant microorganism containing the nucleic acid molecule of B1) or containing the expression cassette of B2) ; B5) a transgenic plant cell line containing the nucleic acid molecule of B1) or containing the expression cassette of B2) ; B6) a transgenic plant containing the nucleic acid molecule of B1) or containing the expression cassette of B2) ; B7) a transgenic plant containing the recombinant vector of B3).

2. The method of claim 1, wherein, ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ B4) a recombinant microorganism containing the nucleic acid molecule of B1), a recombinant microorganism containing the expression cassette of B2) or a recombinant microorganism containing the recombinant vector of B3); B5) a transgenic plant cell line containing the nucleic acid molecule of B1) or a transgenic plant cell line containing the expression cassette of B2); B6) a transgenic plant tissue containing the nucleic acid molecule of B1) or a transgenic plant tissue containing the expression cassette of B2); B7) a transgenic plant organ containing the nucleic acid molecule of B1) or a transgenic plant organ containing the expression cassette of B2).

6. Use according to claim 5, characterized in that: B1) the nucleic acid molecule is a DNA molecule whose coding sequence in the coding strand is represented by SEQ ID No. 2.

Images