Application of compound heterozygous mutation of pathogenic gene ASPM causing MCPH5 type microcephaly and detection reagent and application thereof

Abstract

The present invention provides an application of a compound heterozygous mutation of the pathogenic gene ASPM that causes MCPH5 type microcephaly, and a detection reagent and application thereof, belonging to the field of medical diagnosis technology. The present invention first discovered that compound heterozygous mutations of ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3 and ASPM:NM_018136.5:exon18:c.6684_6685delAA:p.R2230Kfs*8 sites can cause MCPH5 type microcephaly (MIM 608716). The reagent for detecting the gene mutation site of the present invention is used for genetic diagnosis and eugenics guidance of MCPH5 type microcephaly, provides a new basis and approach for the study of the pathogenesis of MCPH5 type microcephaly, provides a new theoretical basis for the treatment of MCPH5 type microcephaly, and can provide a possible drug target for the treatment of MCPH5 type microcephaly.

Description

Technical Field

[0001] The present invention belongs to the technical field of medical diagnosis, and in particular relates to an application of a compound heterozygous mutation of a pathogenic gene ASPM that causes MCPH5 type microcephaly, and a detection reagent and application thereof. Background Art

[0002] Primary microcephaly, also known as true microcephaly or autosomal recessive primary microcephaly (MCPH), is a developmental disorder of the nervous system. Its main clinical feature is a decrease in head circumference accompanied by a certain degree of non-progressive intellectual deterioration.

[0003] Clinical features: The development of the brain includes the fetal stage and the postnatal stage. MCPH mainly affects the development of the brain in the fetal stage. As early as about 24 weeks of pregnancy, ultrasound technology and magnetic resonance imaging can be used to find that the head circumference and brain volume of the child are lower than those of normal fetuses of the same age. Although head circumference measurement is difficult to accurately reflect the size of brain volume compared with objective standards such as cranial MRI and CT, head circumference measurement after birth is still one of the most commonly used methods for diagnosing microcephaly due to its simple and easy method. In clinical practice, a head circumference that is 3 standard deviations smaller than the normal head circumference of children of the same age is often used as the standard for diagnosing microcephaly. When using head circumference measurements as the standard for diagnosing microcephaly, attention should be paid to the correction of relevant factors such as age, gender and race. Clinically, moderate to mild intellectual degeneration is also used as an important auxiliary diagnosis basis. In reports, there are individuals with head circumferences less than 3 standard deviations of normal values ​​and normal intelligence, while individuals with head circumferences less than 4 standard deviations of normal values ​​and normal intelligence are very rare. Microcephaly is divided into primary and secondary. The important sign of this classification is that the intellectual degeneration and brain volume deficiency of primary microcephaly are relatively static after birth, while secondary microcephaly often presents with progressive brain degeneration. Primary microcephaly includes non-genetic primary microcephaly and hereditary microcephaly (MCPH). The causes of non-genetic primary microcephaly include congenital Toxoplasma infection and excessive alcohol intake during maternal pregnancy. MCPH is a type of autosomal recessive genetic disease caused by gene mutation, excluding secondary factors and non-genetic microcephaly. So far, multiple MCPH-related gene loci have been discovered, such as ASPM, CEP152, microcephalin, WDR62, CDK5RAP2, CNPJ, STIL, etc. Mutations in the ASPM gene (MIM 605481) can cause autosomal recessive microcephaly type 5 (MCPH5), which is characterized by a reduced occipital-frontal circumference (OFC) present at birth and is associated with intellectual disability and delayed language development. Other features may include short stature or mild epileptic seizures.

[0004] The ASPM gene (MIM 605481) is located on chromosome 1q31.3, including 28 exons and 27 introns. The gene is 63.4kb long and encodes the 3477 amino acids of the human abnormal spindle-like microcephaly-related protein ASPM. The N-terminus of ASPM contains a microtubule binding region, a calmodulin homology region (CH), and 81 isoleucine-glutamine motifs (IQ) that bind to calmodulin. The number of IQ motifs varies in different mammals, which is related to the enlargement of the cerebral cortex during evolution. The ASPM protein plays a role in maintaining symmetric division during mitosis. The N-terminus and C-terminus of the ASPM protein are located at the spindle pole and the midbody, respectively, in mitosis. ASPM plays an important role in the realization of mitotic spindle function and the orientation of the division plane. The expression of the ASPM gene is related to cell proliferation. It is expressed most highly in progenitor cells and gradually downregulated as cell differentiation proceeds. When the gene mutates, it affects the function of ASPM protein, thereby inhibiting the self-renewal and proliferation ability of cells, causing asymmetric division of neural progenitor cells during proliferation, thereby affecting the development of the cerebral cortex and further affecting brain capacity.

[0005] Therefore, gene mutation is an important genetic basis for the occurrence and development of the disease, and genetic diagnosis is an important genetic standard for diagnosing microcephaly. Clinically, it is necessary to establish corresponding detection technologies for different mutations to achieve disease diagnosis in advance. However, the types of gene mutations currently used in clinical diagnosis of microcephaly are very limited. For example, the patent with publication number CN112795642A discloses the diagnosis and differentiation of simple FEVR and FEVR with microcephaly by detecting whether the KIF11 gene sequence contains c.1271dupA, IVS11+5G>A and c.C247T mutations. However, there is currently no report on the mutation site of the pathogenic gene for MCPH5 type microcephaly. Summary of the invention

[0006] In view of this, the purpose of the present invention is to provide an application of a compound heterozygous mutation of the pathogenic gene ASPM that causes MCPH5 type microcephaly, to develop a new type of compound heterozygous mutation of the pathogenic gene that can be used as a biomarker for diagnosing MCPH5 type microcephaly, and to distinguish MCPH5 type microcephaly patients, carriers and normal people.

[0007] The present invention also aims to provide a reagent and application for detecting compound heterozygous mutations of the pathogenic gene ASPM that causes MCPH5 type microcephaly, so as to facilitate the screening and diagnosis of MCPH5 type microcephaly gene mutations.

[0008] The present invention provides an application of a compound heterozygous mutation site of a gene ASPM in preparing a diagnostic reagent for MCPH5 type microcephaly or a drug for preventing and treating MCPH5 type microcephaly. The compound heterozygous mutation site of the pathogenic gene ASPM is ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3 and ASPM:NM_018136.5:exon18:c.6684_6685delAA:p.R2230Kfs*8.

[0009] The present invention provides a reagent for detecting the compound heterozygous mutation site of the pathogenic gene ASPM of MCPH5 type microcephaly, comprising a primer for detecting the mutation site c.3692delC of the pathogenic gene ASPM and a primer for detecting the mutation site c.6684_6685delAA of the pathogenic gene ASPM;

[0010] The primers for detecting the mutation site c.3692delC of the pathogenic gene ASPM include ASPM-1F with a nucleotide sequence as shown in SEQ ID NO: 1 and ASPM-1R with a nucleotide sequence as shown in SEQ ID NO: 2;

[0011] The primers for detecting the mutation site c.6684_6685delAA of the pathogenic gene ASPM include ASPM-2F with a nucleotide sequence as shown in SEQ ID NO:3 and ASPM-2R with a nucleotide sequence as shown in SEQ ID NO:4.

[0012] Preferably, it also includes sequencing primers;

[0013] The sequencing primers include a sequencing primer for the pathogenic gene ASPM mutation site c.3692delC and / or a sequencing primer for the pathogenic gene ASPM mutation site c.6684_6685delAA;

[0014] The sequencing primers for the pathogenic gene ASPM mutation site c.3692delC include ASPM-Seq1F with a nucleotide sequence as shown in SEQ ID NO: 5 and ASPM-Seq1R with a nucleotide sequence as shown in SEQ ID NO: 6;

[0015] The sequencing primers for the pathogenic gene ASPM mutation site c.6684_6685delAA include ASPM-Seq2F with a nucleotide sequence as shown in SEQ ID NO:7 and ASPM-Seq2R with a nucleotide sequence as shown in SEQ ID NO:8.

[0016] The invention provides a MCPH5 type microcephaly diagnosis kit, comprising the reagent and a PCR amplification reagent.

[0017] Preferably, the PCR amplification reagent includes dNTP, 10×PCR buffer, magnesium ions and Tap polymerase;

[0018] The 10×PCR buffer contains an aqueous solution of the following components: 500 mmol / L KCl, 100 mmol / L Tris-Cl at pH 8.3, and 15 mmol / L MgCl 2 .

[0019] The present invention provides application of the reagent in preparing a kit for detecting mutation sites of the pathogenic gene ASPM of MCPH5 type microcephaly.

[0020] The invention provides an application of primers for detecting compound heterozygous mutation sites of a pathogenic gene ASPM in preparing a kit for auxiliary diagnosis of MCPH5 type microcephaly, wherein the compound heterozygous mutation sites of the pathogenic gene ASPM are ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3 and ASPM:NM_018136.5:exon18:c.6684_6685delAA:p.R2230Kfs*8.

[0021] Preferably, the primer is the reagent described in the above scheme.

[0022] Preferably, the method for assisting in the diagnosis of MCPH5 type microcephaly comprises the following steps: using the kit to detect the genotype of the gene mutation site in the sample to diagnose whether the individual has the risk of MCPH5 type microcephaly:

[0023] When the detected genotype is "c.3692delC heterozygous + c.6684_6685delAA heterozygous", it is judged that the ASPM gene has a compound heterozygous mutation and the individual is a patient;

[0024] If the detected genotype is a single heterozygous mutation "c.3692delC heterozygous mutation" or "c.6684_6685delAA heterozygous mutation", the individual is a carrier;

[0025] If no mutation occurs at the detected mutation site, the ASPM gene is judged to be wild type and the individual is normal.

[0026] Preferably, the sample is at least one of blood, amniotic fluid and biopsy tissue.

[0027] The present invention provides an application of a compound heterozygous mutation site of a gene ASPM in the preparation of a diagnostic reagent for MCPH5 type microcephaly or a drug for the prevention and treatment of MCPH5 type microcephaly, wherein the compound heterozygous mutation site of the pathogenic gene ASPM is ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3ASPM:NM_018136.5:exon18:c.6684_6685delAA:p.R2230Kfs*8. The present invention first discovered ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3 and exon18:c.6684_6685delAA:p.R2230Kfs*8 through exome sequencing technology.

[0028] The compound heterozygous mutation of delAA:p.R2230Kfs*8 site can lead to the onset of MCPH5 type microcephaly. On the one hand, by detecting whether the subject carries the above mutation, it is used to screen or diagnose the genetic diagnosis of MCPH5 type microcephaly to guide treatment. In particular, the diagnostic kit provided by the present invention can be used to quickly and effectively predict or diagnose MCPH5 type microcephaly. On the other hand, the present invention lays an important foundation for the study of the pathogenesis of MCPH5 type microcephaly and provides a new theoretical basis for the treatment of patients with MCPH5 type microcephaly. On the third aspect, the present invention can provide possible drug targets for the treatment of MCPH5 type microcephaly.

[0029] The present invention also provides a kit for detecting the mutation site of the pathogenic gene ASPM of MCPH5 microcephaly, comprising the reagent and a PCR amplification reagent. By optimizing the primers and reaction system for detecting the mutation site of the pathogenic gene ASPM, the accuracy and reliability of the test results are greatly improved, which greatly helps the screening and diagnosis of MCPH5 microcephaly gene mutations, and provides new technical support for its drug screening, efficacy evaluation and targeted treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the genetic map of the MCPH5 type microcephaly family No. 1; among them, represents a male carrier, indicates a female carrier, ■ indicates a male patient, ◇ indicates a fetus, and ↗ indicates a proband;

[0031] Figure 2 This is the result of using Sanger sequencing to detect the genotype of ASPM:NM_018136.5:exon 15:c.3692delC:p.P1231Lfs*3 locus, in which the proband, the proband's mother, and the fetus of family 1 were "c.3692delC heterozygous mutations", and the proband's father was wild type (the arrow in the sequencing diagram indicates the mutation location);

[0032] Figure 3 This is the result of using Sanger sequencing to detect the genotype of ASPM:NM_018136.5:exon 18:c.6684_6685delAA:p.R2230Kfs*8 locus, in which the proband and the father of family No. 1 were "c.6684_6685delAA heterozygous mutation", and the mother of the proband and the fetus were wild type (the arrow in the sequencing diagram indicates the mutation location);

[0033] Figure 4 This is the genetic map of the MCPH5 type microcephaly family No. 2; among them, represents a male carrier, indicates female carrier, ● indicates female patient, ↗ indicates proband;

[0034] Figure 5 This is the result of using the kit to detect the genotype of ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3 locus in Family 2, in which the proband and the proband's mother in Family 2 were "c.3692delC heterozygous mutations", and the proband's father was wild type (the arrow in the sequencing diagram indicates the mutation location);

[0035] Figure 6 This is the result of using the kit to detect the genotype of the ASPM:NM_018136.5:exon18:c.6684_6685delAA:p.R2230Kfs*8 site of Family No. 2, in which the proband and the proband's father of Family No. 2 were "c.6684_6685delAA heterozygous mutation", and the proband's mother was wild type (the arrow in the sequencing image indicates the location of the mutation). DETAILED DESCRIPTION

[0036] The present invention provides an application of a compound heterozygous mutation site of a gene ASPM in preparing a diagnostic reagent for MCPH5 type microcephaly or a drug for preventing and treating MCPH5 type microcephaly. The compound heterozygous mutation site of the pathogenic gene ASPM is ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3 and ASPM:NM_018136.5:exon18:c.6684_6685delAA:p.R2230Kfs*8.

[0037] In the present invention, exon sequencing is first used to screen pathogenic gene mutations that are highly associated with MCPH5 type microcephaly. In order to avoid false positive results, Sanger sequencing is then used for verification, and finally the pathogenic gene compound heterozygous mutations of MCPH5 type microcephaly are obtained, specifically ASPM: NM_018136.5: exon15: c.3692delC: p.P1231Lfs*3 and exon18: c.6684_6685delAA: p.R2230Kfs*8. The pathogenic gene compound heterozygous mutation can be used as a biomarker for diagnosing MCPH5 type microcephaly, and distinguishing MCPH5 type microcephaly patients, carriers and normal people. The ASPM:NM_018136.5:exon15:c.3692delC mutation refers to the deletion of C at base 3692 of exon 15 of the wild-type ASPM gene, forming an ASPM gene mutant. The nucleotide sequence of the ASPM gene mutant is preferably as shown in SEQ ID NO: 9 (aatac□tgcta, the box indicates the location of the deletion mutation, the bold underlined letters indicate the amino acid sequence after the frameshift mutation, and * indicates the stop codon). Compared with the protein encoded by the wild-type ASPM gene, the ASPM mutant protein of the present invention has a mutation of proline (P) to leucine (L) at position 1231, and a frameshift mutation occurs, and terminates after the next 2 amino acids, that is, the ASPM mutant protein contains a mutation of p.P1231Lfs*3, which is caused by the frameshift mutation of c.3692delC; the amino acid sequence of the ASPM mutant protein is shown in SEQ ID NO: 10 (LGGILL*, the bold underlined letters are the amino acid sequence after the frameshift mutation, and * is the termination codon). The ASPM: NM_018136.5: exon15: c.6684_6685delAA mutation refers to the deletion of the 6684th and 6685th base AA of the 18th exon of the wild-type ASPM gene, forming an ASPM gene mutant, and the nucleotide sequence of the ASPM gene mutant is preferably shown in SEQ ID NO: 11 (AAAGA□GAAAC, the box is the position where the deletion mutation occurs). Compared with the protein encoded by the wild-type ASPM gene, the ASPM mutant protein of the present invention has a lysine (K) replaced by arginine (R) at position 2230, and a frameshift mutation occurs, and terminates after the next 6 amino acids, that is, the ASPM mutant protein contains a mutation of p.R2230Kfs*8, which is caused by a frameshift mutation of c.6684_6685delAA; the amino acid sequence of the ASPM mutant protein is shown in SEQ ID NO: 12 (KEKHTISKV*, the bold underlined letters are the amino acid sequence after the frameshift mutation, and * is the termination codon).

[0038] In the present invention, specific amplification primers or specific detection probes are designed according to the upstream and downstream sequences of the two mutation sites of ASPM to prepare diagnostic reagents.

[0039] The invention provides a reagent for detecting a compound heterozygous mutation site of a pathogenic gene ASPM of MCPH5 type microcephaly, comprising a primer for detecting a mutation site c.3692delC of the pathogenic gene ASPM and a primer for detecting a mutation site c.6684_6685delAA of the pathogenic gene ASPM; the primer for detecting the mutation site c.3692delC of the pathogenic gene ASPM comprises an ASPM-1F having a nucleotide sequence as shown in SEQ ID NO:1 (TCCACCATTACCATCCT) and an ASPM-1R having a nucleotide sequence as shown in SEQ ID NO:2 (CTCATACCTCCCCAACC); the primer for detecting the mutation site c.6684_6685delAA of the pathogenic gene ASPM comprises an ASPM-2F having a nucleotide sequence as shown in SEQ ID NO:3 (AGGGCAGCCACTTTTATT) and an ASPM-2R having a nucleotide sequence as shown in SEQ ID NO:4 (CGCATCCTTTTCCTTATC).

[0040] In the present invention, the reagent preferably further comprises a sequencing primer. The sequencing primer comprises a sequencing primer for the pathogenic gene ASPM mutation site c.3692delC and / or a sequencing primer for the pathogenic gene ASPM mutation site c.6684_6685delAA. The sequencing primer for the pathogenic gene ASPM mutation site c.3692delC comprises an ASPM-Seq1F as shown in the nucleotide sequence SEQ ID NO:5 (TTTCTCCTTTCCTCCTGC) and an ASPM-Seq1R as shown in the nucleotide sequence SEQ ID NO:6 (CCTGATGGCGTTTGAGAT); the sequencing primer for the pathogenic gene ASPM mutation site c.6684_6685delAA comprises an ASPM-Seq2F as shown in the nucleotide sequence SEQ ID NO:7 (GGCAAGTTTTAGAGGAGTAA) and an ASPM-Seq2R as shown in the nucleotide sequence SEQ ID NO:8 (ACAAAGATGTGCCCGATA). The present invention has no particular limitation on the source of the primers, and primer synthesis methods well known in the art may be used.

[0041] The invention provides a MCPH5 type microcephaly diagnosis kit, comprising the reagent and a PCR amplification reagent.

[0042] In the present invention, the PCR amplification reagent preferably includes dNTP, 10×PCR buffer, magnesium ions and Tap polymerase. The 10×PCR buffer contains an aqueous solution of the following components: 500mmol / L KCl, 100mmol / L Tris-Cl at pH 8.3 and 15mmol / LMgCl2.

[0043] The present invention provides application of the reagent in preparing a kit for detecting mutation sites of the pathogenic gene ASPM of MCPH5 type microcephaly.

[0044] In the present invention, the method for detecting the mutation site of the ASPM gene causing MCPH5 type microcephaly preferably comprises the following steps:

[0045] Extracting genomic DNA from samples to be tested;

[0046] Using genomic DNA as a template, the ASPM gene sequence was amplified using the reagents described in the above protocol;

[0047] The amplified product of ASPM gene was subjected to DNA sequencing;

[0048] The DNA sequencing results of the sample to be tested are compared with the normal human genome DNA sequence. When the results are completely consistent, it means that the ASPM gene in the sample to be tested has not mutated to the wild type. When the comparison results show that one allele in the chromosome has a C deletion at position 3692 of exon 15 of the ASPM gene (NM_018136.), and the other allele is not mutated, the genotype of the mutation site is "c.3692delC heterozygous mutation". Similarly, one allele on the chromosome has AA deletions at positions 6684 and 6685 of exon 18, and the other allele is not mutated, the genotype of the mutation site is "c.6684_6685delAA heterozygous mutation".

[0049] In the present invention, the reaction system for amplifying the ASPM gene sequence is preferably 2.0 μL of 10×PCR buffer, 0.4 μL of 10 mmol / L dNTPs, 0.5 μL of 100 ng / μL ASPM-1F (or ASPM-2F), 0.5 μL of 100 ng / μL ASPM-1R (or ASPM-2R), 1.0 μL of 100 ng / μL extracted DNA, 0.2 μL of 5 U / μL Taq enzyme, and 15.4 μL of ddH2O. The PCR amplification reaction program for the ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3 mutation site is preferably as follows: first step: 95°C, 5 minutes; second step: 30 cycles (95°C, 30 seconds → 49°C, 30 seconds → 72°C, 60 seconds); third step: 72°C, 7 minutes; fourth step: 4°C insulation. The reaction program for the ASPM:NM_018136.5:exon18:c.6684_6685delAA:p.R2230Kfs*8 mutation site is as follows: first step: 95°C, 5 minutes; second step: 30 cycles (95°C, 30 seconds → 52°C, 30 seconds → 72°C, 60 seconds); third step: 72°C, 7 minutes; fourth step: 4°C insulation.

[0050] The invention provides an application of primers for detecting compound heterozygous mutation sites of a pathogenic gene ASPM in preparing a kit for auxiliary diagnosis of MCPH5 type microcephaly, wherein the compound heterozygous mutation sites of the pathogenic gene ASPM are ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3 and ASPM:NM_018136.5:exon18:c.6684_6685delAA:p.R2230Kfs*8.

[0051] In the present invention, specific primers are designed based on the upstream and downstream sequences of the ASPM mutation site of the pathogenic gene, and the primers are used to amplify the DNA fragment containing the mutation site, and the genotype of the DNA fragment is used to determine whether there is a risk of MCPH5 type microcephaly. In an embodiment of the present invention, the primer is preferably the reagent described in the above scheme.

[0052] In the present invention, the method for auxiliary diagnosis of MCPH5 type microcephaly preferably includes the following steps: using the kit to detect the genotype of the gene mutation site in the sample to diagnose whether the individual has the risk of MCPH5 type microcephaly: when the detected genotype is "c.3692delC heterozygous + c.6684_6685delAA heterozygous", it is judged that the ASPM gene has a compound heterozygous mutation and the individual is a patient; if the detected genotype is a single heterozygous mutation "c.3692delC heterozygous mutation" or "c.6684_6685delAA heterozygous mutation", the individual is a carrier; if the detected mutation site has not mutated, it is judged that the ASPM gene is wild type and the individual is a normal person.

[0053] In the present invention, the sample is preferably at least one of blood, amniotic fluid and biopsy tissue.

[0054] In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the molecular genetics, nucleic acid chemistry and molecular biology related terms and laboratory operation procedures used herein are widely used terms and conventional procedures in the corresponding fields. At the same time, in order to better understand the present invention, the definitions and explanations of the relevant terms are provided below.

[0055] The term "diagnosis" as used herein includes prediction of disease risk, diagnosis of whether a disease has occurred, and assessment of disease prognosis.

[0056] The term "mutation" herein refers to a change in a wild-type polynucleotide sequence to form a variant, which may be naturally occurring or non-naturally occurring.

[0057] In the present invention, the term "heterozygous mutation" means that the mutation exists in only one gene in a pair of alleles.

[0058] In the present invention, the term "compound heterozygous mutation" refers to a heterozygous mutation in which each allele has one or more mutations, that is, a biallelic mutation, and each chromosome has a mutation.

[0059] The term "prenatal diagnosis" in this article refers to the clear diagnosis of high-risk fetuses based on genetic counseling, mainly through genetic testing and imaging examinations, and the purpose of fetal selection is achieved through selective abortion of sick fetuses, thereby reducing the birth defect rate and improving the quality of eugenics and population quality.

[0060] In the present invention, "primer" refers to a polynucleotide fragment used to amplify a target nucleic acid in a PCR reaction, which is usually an oligonucleotide, for example, a polynucleotide fragment containing at least 5 bases, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more bases. The primer does not have to be completely complementary to the target gene to be amplified or its complementary strand, as long as it can specifically amplify the target gene. As used herein,

[0061] The term "specific amplification" means that the primer can amplify the target gene through PCR reaction without amplifying other genes. For example, specific amplification of ASPM gene means that in PCR reaction, the primer only amplifies ASPM gene without amplifying other genes.

[0062] The application of the compound heterozygous mutation of the pathogenic gene ASPM causing MCPH5 type microcephaly provided by the present invention, as well as the detection reagent and application are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0063] The experimental methods in the following examples where specific conditions are not specified are generally carried out according to conventional conditions such as those described in Sambrook et al., Molecular Cloning ALABORATORY MANUAL 1 SECOND EDITION (New York: Cold Spring Harbor Laboratory Press, 2014), or according to the conditions recommended by the manufacturer.

[0064] Example 1

[0065] Sample acquisition

[0066] The inventors discovered a MCPH5 type microcephaly pedigree (referred to as Family 1). The clinical information of some members of the family is shown in Table 1. Figure 1 Family tree, including Indicates male carriers, indicates a female carrier, ■ indicates a male patient, ◇ indicates a fetus, and ↗ indicates a proband.

[0067] 1. Diagnostic criteria:

[0068] Please refer to the 2010 edition of Human Single Gene Inherited Diseases:

[0069] The diagnostic criteria for MCPH are:

[0070] 1) MCPH is a congenital disease, and the head circumference at birth is 4 standard deviations less than that of normal children of the same age;

[0071] 2) Non-progressive intellectual deterioration, generally not accompanied by other neurological abnormalities, such as epilepsy, persistent spasms, etc. If neurological abnormalities occur, they cannot be used as exclusion criteria;

[0072] 3) Weight, height, and appearance are basically normal, and there are no abnormalities in genomic examination and brain structure. However, for individuals with MCPH1 mutations, there is often insufficient height development and periventricular neuronal cell ectopia.

[0073] Table 1 Clinical information of the members of the MCPH5 type 5 microcephaly family 1

[0074]

[0075] like Figure 1 As shown, the numbering is Ⅰ (first generation) and Ⅱ (second generation).

[0076] Peripheral blood DNA from family members Ⅰ1 (father of the proband), Ⅰ2 (mother of the proband), Ⅱ1 (proband) and amniotic fluid DNA from Ⅱ2 (fetus) were used for sequencing analysis.

[0077] Example 2

[0078] Exome sequencing

[0079] 1. Instruments and equipment are shown in Table 2.

[0080] Table 2 List of instruments and equipment

[0081] Instrument Name Manufacturer High-throughput sequencer NextSeq500 Illumina QubitFluorometer Nucleic Acid Quantification Invitrogen PCR instrument Bio-RAD Centrifuge 5810R Eppendorf Centrifuge 5424 Eppendorf 5418 small high speed centrifuge Eppendorf Biological Safety Cabinets Su Jing Clean bench Su Jing Ice Maker Grant UPS Power Supply Santa MilliQ Ultrapure Water Analyzer Millipore High-performance computers (including servers, cabinets, switches, storage, etc.) DELL -25 degree refrigerator Meiling Ultra-low temperature refrigerator Eppendorf Micro-wave oven Midea

[0082] 2. Reagents and consumables

[0083] Human whole exome sequencing kit (Agilent), DNA 1000 kit (Agilent), 96-well plate (Axygen), different types of pipette tips (Axygen), 200 μL centrifuge tubes (Eppendorf), 1.5 mL centrifuge tubes (Eppendorf), capillary electrophoresis buffer (Thermo), sequencing standards (Thermo), anhydrous ethanol (Thermo), BigDyeTerminatorV3.1 (Thermo), peripheral blood gDNA extraction kit (TIANGEN), agarose (TIANGEN), EB stain (Amresco).

[0084] 3. Reagent Formulation

[0085] 5×TBE electrophoresis buffer stock solution was prepared according to Table 3.

[0086] Table 3 5×TBE electrophoresis buffer formula

[0087] Reagents Volume / Weight Tris 5.4g Boric acid 750mg EDTA (pH 8.0, 0.5 mol / L) 2mL <![CDATA[ddH2O]]> 90mL

[0088] Adjust the final volume to 100 mL with ddH2O.

[0089] 0.5×TBE electrophoresis working solution can be diluted 10 times with ddH2O.

[0090] 10× red blood cell lysis buffer was prepared according to Table 4.

[0091] Table 4 10× red blood cell lysis buffer formula

[0092] Reagents Volume / Weight <![CDATA[NH4Cl]]> 82.9g <![CDATA[KHCO3]]> 10g EDTA 0.37g <![CDATA[Add dH2O]]> Up to 1000mL

[0093] Autoclave and store at 4°C.

[0094] 1× cell nuclear lysis buffer was prepared according to Table 5.

[0095] Table 5 1× Cell Nuclear Lysis Solution Formula

[0096] Reagents Volume / Weight 2M Tris-HCl, pH 8.2 0.5mL 4MNaCl 10mL 2mM EDTA 0.4mL

[0097] 4. Experimental Procedure

[0098] After the informed consent was signed, 3-5 mL of peripheral blood and 5-10 mL of amniotic fluid were collected from members Ⅰ1 (father of the proband), Ⅰ2 (mother of the proband), and Ⅱ1 (proband) of family No. 1, and Ⅱ2 (fetus).

[0099] 4.1 Sample DNA extraction

[0100] 1) For heparin anticoagulated peripheral blood samples, place 3-5 mL of peripheral blood into a 15 mL centrifuge tube, add 2-3 times the volume of 1× red blood cell lysis buffer, mix well, and place on ice for 30 minutes until the solution becomes transparent.

[0101] 2) Centrifuge at 4℃, 3000 rpm for 10 minutes, and carefully remove the supernatant. Add 1mL 1× nuclear lysis buffer to the precipitate, mix well, then add 2mL 1× nuclear lysis buffer and 150μL 20% SDS, shake well until it becomes viscous and transparent. Add 10μL 20mg / mL proteinase K, shake well. Digest at 37℃ for more than 6 hours or overnight.

[0102] 3) Add an equal volume of saturated phenol, shake gently to mix, and centrifuge at 3000 rpm for 10 minutes at room temperature.

[0103] 4) Carefully transfer the supernatant to another centrifuge tube, add an equal volume of phenol / chloroform (1:1 v / v) and mix well, and centrifuge at 3000 rpm for 10 minutes at room temperature.

[0104] 5) Carefully transfer the supernatant. If the supernatant is not clear and transparent, extract again with an equal volume of chloroform.

[0105] 6) Transfer the supernatant to another centrifuge tube, add two times the volume of anhydrous ethanol, shake well, and white flocculent DNA will be seen. Use a flame-sterilized glass hook to hook out the DNA, wash twice with 70% ethanol, dry at room temperature for 5 minutes, and then dissolve the DNA in 200μL 1×TE and dissolve overnight in a drum. Measure the OD value by UV.

[0106] 7) DNA dissolved in TE can be stored at 4°C for one year. If long-term storage is required, add 2 times the volume of anhydrous ethanol and store at -70°C.

[0107] 4.2 Exome sequencing

[0108] Refer to the instructions of the Human Whole Exome Sequencing Kit (Agilent) and the operating instructions of Molecular Cloning A LABORATORY MANUAL 1 SECOND EDITION; New York: Cold Spring Harbor Laboratory Press, 2014.

[0109] 1) Take 2 μg DNA, mechanically shear it to a fragment size of about 200 bp, and cut the gel to recover 150-250 bp fragments;

[0110] 2) DNA fragments are end-repaired and 3' end A is added;

[0111] 3) Connect the sequencing adapter, purify the connection product, perform PCR amplification, and purify the amplified product;

[0112] 4) The probe of the Agilent kit is added to the purified amplified product for hybridization capture. The hybridized product is eluted and recovered for PCR amplification. The final product is then recovered and a small sample is taken for agarose gel electrophoresis for quality control analysis.

[0113] 5) NextSeq500 sequencer sequencing and data analysis.

[0114] 4.3 Results

[0115] Finally, a pathogenic compound heterozygous gene mutation ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3 and exon18:c.6684_6685delAA:p.R2230Kfs*8 was obtained; the c.3692delC mutation was a deletion of the C at the 3692th base, resulting in a frameshift mutation, causing the 1231st amino acid to mutate from proline (P) to leucine (L); the c.6684_6685delAA mutation was a deletion of the AA at the 6684th and 6685th bases, resulting in a frameshift mutation, and the 2230th amino acid mutated from arginine (R) to lysine (K). In the patient (proband) of Family No. 1, the genotype of ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3 and exon18:c.6684_6685delAA:p.R2230Kfs*8 loci is a compound heterozygous mutation of "c.3692delC heterozygous + c.6684_6685delAA heterozygous". In the carriers of Family No. 1, the genotype of this locus is a heterozygous mutation of "c.3692delC" or a heterozygous mutation of "c.6684_6685delAA".

[0116] Example 3

[0117] Sanger sequencing validation

[0118] The exome sequencing results were further verified by Sanger sequencing for ASPM: NM_018136.5: exon15: c.3692delC: p.P1231Lfs*3 and exon18: c.6684_6685delAA: p.R2230Kfs*8. The genotypes of ASPM: NM_018136.5: exon15: c.3692delC: p.P1231Lfs*3 and exon18: c.6684_6685delAA: p.R2230Kfs*8 were detected for 4 persons including Ⅰ1 (father of the proband), Ⅰ2 (mother of the proband), Ⅱ1 (proband), and Ⅱ2 (fetus) in line 1 in Example 1 and 100 normal persons outside the family.

[0119] The specific steps are as follows:

[0120] 1. DNA extraction

[0121] The genomic DNA was extracted according to the method of Example 1.

[0122] 2. Design, verification and optimization of candidate primers

[0123] 2.1 Candidate primer design was based on the human genome sequence database hg19 / build36.3 (https: / / www.ncbi.nlm.nih.gov / genome, or http: / / genome.ucsc.edu / cgi-bin / hgGateway?redirect=manual&source=genome.ucsc.edu).

[0124] 2.2 16 pairs of candidate primers were designed for c.3692delC and c.6684_6685delAA sites (see Table 6), and PCR experiments were used to verify and evaluate the advantages and disadvantages of each pair of candidate primers

[0125] Table 6 Basic information of each pair of candidate primers and the results of verification experiments

[0126]

[0127]

[0128]

[0129]

[0130] Note: Normal PCR amplification results only have one specific band after electrophoresis. If primer dimer bands or non-specific product bands appear, they are the result of abnormal primer reactions. Target primers should avoid such situations as much as possible. In addition, refer to the following principles to comprehensively evaluate and select the optimal primer pair:

[0131] ① The primer length is 15-30nt, usually around 20nt;

[0132] ② The G+C content should be 40-60%. Too little G+C will result in poor amplification, while too much G+C will result in non-specific bands. ATGC is best distributed randomly;

[0133] ③ Avoid references to strings of more than 5 purine or pyrimidine nucleotides;

[0134] ④ There should be no complementary sequence inside the primer;

[0135] ⑤ There should be no complementary sequences between the two primers, especially avoid complementary overlap at the 3' end;

[0136] ⑥ The homology between the primer and the sequence of the non-specific amplification region should not exceed 70%, and the 8 consecutive bases at the 3' end of the primer should not have completely complementary sequences outside the region to be amplified, otherwise it will easily lead to non-specific amplification;

[0137] 2.3 Candidate Primer PCR Verification Reaction

[0138] Carry out PCR according to the reaction system in Table 7 and keep the reaction system on ice; set up 8 reaction test tubes for each pair of primers (sequence numbers 1 to 8 in Table 7).

[0139] Table 7 Primer detection PCR reaction system

[0140]

[0141]

[0142] Reaction conditions: Place the above test reaction tube into the PCR instrument and perform the following reaction program:

[0143] Step 1: 95°C, 5 minutes;

[0144] Step 2: 30 cycles (95°C, 30 seconds → Tm, 30 seconds → 72°C, 60 seconds); (Set PCR amplification parameters according to the Tm values ​​of each primer in Table 6. If it is a double primer, take the average Tm value).

[0145] Step 3: 72°C, 7 minutes;

[0146] Step 4: 4°C until sampling.

[0147] 2.4 The PCR results of candidate primers were tested by agarose gel electrophoresis to evaluate the effectiveness and specificity of the primer reaction:

[0148] 1) Seal both ends of the cleaned and dried gel sampler with tape, place it on a flat surface, and place a comb about 1 cm from one end of the sampler.

[0149] 2) Weigh 2 g of agar powder into a conical flask, add 100 mL of 0.5×TBE electrophoresis buffer, shake well, and heat in a microwave oven or electric stove (with asbestos mesh). After boiling, take out and shake well, and heat again until the gel is completely melted, then take out and cool at room temperature.

[0150] 3) When the gel cools to about 50°C, pour it into the sealed gel sampler to make the thickness about 5mm.

[0151] 4) After the gel solidifies, remove the tape and place the gel and sampler into the electrophoresis tank.

[0152] 5) Add electrophoresis buffer so that the liquid level is 1 to 2 mm above the gel surface, and pull out the comb upwards; use a micropipette to mix the sample and DNA size standard with the loading solution respectively, and add them to each well. Since the specific gravity of sucrose in the loading solution is relatively large, the DNA sinks to the bottom of the well.

[0153] 6) Cover the electrophoresis tank, turn on the power, adjust to the appropriate voltage, and start electrophoresis. According to the indication of bromophenol blue in the sample loading solution, determine the approximate position of the sample and decide whether to terminate the electrophoresis.

[0154] 7) Turn off the power, take out the gel, and place it in a 0.5 g / mL EB aqueous solution for staining for 10 to 15 minutes.

[0155] 8) Place the gel under a transmission UV irradiator to observe the results at a wavelength of 254 nm, and take photos with a camera equipped with a red filter or use a gel scanning system to record the electrophoresis results.

[0156] 2.5 Result evaluation:

[0157] 1) If only one bright and clear target band appears in tube 7 and no other bands are present, it is judged that the primer pair and reaction system have good effectiveness and strong specificity;

[0158] 2) If no target band appears in tube 7, the primer pair and reaction system are considered invalid;

[0159] 3) If primer-dimer bands other than the target band appear in tube 7, and primer-dimer bands also appear in some tubes 2, 3, 4, 5, and 6, it is judged that the effectiveness of the primer pair and reaction system is poor;

[0160] 4) If a non-specific band other than the target band appears in tube 7, and non-specific bands also appear in some tubes 5 and 6, it is judged that the primer pair and reaction system have poor specificity;

[0161] 5) If primer dimers and non-specific bands outside the target band appear in tube 7, and primer dimers and non-specific bands also appear in some tubes 2, 3, 4, 5, and 6, it is judged that the effectiveness and specificity of this pair of primers and reaction system are poor.

[0162] 2.6 According to the statistical results after the verification test in Table 6, the best pair (No. 1 in Table 6) is selected as the primer for mutation family detection.

[0163] The PCR primer sequences for ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3 site are as follows:

[0164] 5'-TCCACCATTACCATCCT-3' (SEQ ID NO: 1);

[0165] 5'-CTCATACCTCCCCAACC-3' (SEQ ID NO: 2).

[0166] The primer sequences for ASPM:NM_018136.5:exon18:c.6684_6685delAA:p.R2230Kfs*8 are as follows:

[0167] 5'-AGGGCAGCCACTTTTATT-3' (SEQ ID NO: 3);

[0168] 5'-CGCATCCTTTCCTTATC-3' (SEQ ID NO: 4).

[0169] Other candidate primers have poor PCR effects due to the presence of hairpin structures, primer dimers, or non-specific binding amplification. Therefore, the first pair of candidate primers is selected for each gene mutation site for subsequent detection.

[0170] 3. PCR amplification of mutation sites in family members No. 1 and 100 non-family members

[0171] Carry out PCR according to the reaction system in Table 8 and keep the reaction system on ice.

[0172] Table 8 Mutation site PCR reaction system

[0173] Reagents volume 10× PCR buffer 2.0μL 10mmol / L dNTPs 0.4μL 100ng / μL ASPM-1F (or ASPM-2F) 0.5μL 100ng / μL ASPM-1R (or ASPM-2R) 0.5μL 100ng / μL DNA extracted from peripheral blood 1.0μL 5U / μL Taq enzyme 0.2μL ddH2O 15.4μL

[0174] Reaction conditions: Place the reaction system into the PCR instrument and perform the following reaction procedure:

[0175] For ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3 site, the reaction procedure is as follows:

[0176] Step 1: 95°C, 5 minutes;

[0177] Step 2: 30 cycles (95°C, 30 seconds → 49°C, 30 seconds → 72°C, 60 seconds);

[0178] Step 3: 72°C, 7 minutes;

[0179] Step 4: 4°C until sampling.

[0180] For ASPM:NM_018136.5:exon18:c.6684_6685delAA:p.R2230Kfs*8 site, the reaction procedure is as follows:

[0181] Step 1: 95°C, 5 minutes;

[0182] Step 2: 30 cycles (95°C, 30 seconds → 52°C, 30 seconds → 72°C, 60 seconds);

[0183] Step 3: 72°C, 7 minutes;

[0184] Step 4: 4°C until sampling.

[0185] 4. Agarose gel electrophoresis detection

[0186] Refer to step 2.4 above.

[0187] 5. Enzymatic purification of PCR products: Add 0.5 μL of exonuclease I (Exo I) and 1 μL of alkaline phosphatase (AIP) to 5 μL of PCR product, digest at 37°C for 15 minutes, and inactivate the enzyme at 85°C for 15 minutes.

[0188] 6. BigDye reaction

[0189] The BigDye reaction system is shown in Table 9.

[0190] Table 9 BigDye reaction system

[0191] Reagents Dosage PCR product purified DNA 2.0μL 3.2pmol / μL sequencing primer 1.0μL BigDye 0.5μL 5×BigDye sequencing buffer 2.0μL <![CDATA[ddH2O]]> 4.5μL

[0192] Sequencing PCR cycling conditions:

[0193] Step 1: 96°C, 1 minute;

[0194] Step 2: 33 cycles (96°C, 30 sec → 55°C, 15 sec → 60°C, 4 min);

[0195] Step 3: 4°C until sampling.

[0196] 7. Purification of BigDye reaction products:

[0197] 1) Add 1 μL 125 mM EDTA (pH 8.0) to each tube until it reaches the bottom of the tube, then add 1 μL 3 mol / L NaAc (pH 5.2);

[0198] 2) Add 70 μL of 70% alcohol, shake and mix 4 times, and leave at room temperature for 15 minutes;

[0199] 3) Centrifuge at 3000g, 4°C for 30 minutes; immediately invert the 96-well plate and centrifuge at 185g for 1 minute;

[0200] 4) Leave at room temperature for 5 minutes to allow the residual alcohol to evaporate, add 10 μL Hi-Di formamide to dissolve the DNA, denature at 96°C for 4 minutes, quickly place on ice for 4 minutes, and sequence on the machine.

[0201] 8. Sequencing

[0202] The purified BigDye reaction product was subjected to DNA sequencing. The sequencing primers were designed as nested primers based on the above-mentioned preferred PCR primers (the second set of primers was designed within the product sequence range amplified by the first set of primers). The sequencing primer sequence for ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3 site is as follows:

[0203] 5'-TTTCTCCTTTCCTCCTGC-3' (SEQ ID NO: 5);

[0204] 5'-CCTGATGGCGTTTGAGAT-3' (SEQ ID NO: 6);

[0205] The sequencing primer sequence for ASPM:NM_018136.5:exon18:c.6684_6685delAA:p.R2230Kfs*8 site is as follows:

[0206] 5'-GGCAAGTTTTAGAGGAGTAA-3' (SEQ ID NO: 7);

[0207] 5'-ACAAAGATGTGCCCGATA-3' (SEQ ID NO: 8).

[0208] 9. Results Analysis

[0209] Figure 2 The Sanger sequencing results showed that the genotype of the ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3 locus of the three people in Family 1 was "c.3692delC heterozygous". Figure 2 The position indicated by the arrow in the sequencing diagram shows that the genotype of ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3 site in layers A, C, and D is the "c.3692delC heterozygous" mutation; Figure 2 The position indicated by the arrow in the sequencing diagram shows that the genotype of the B layer individual is wild type.

[0210] Figure 3 The Sanger sequencing results showed that the genotype of the two members of Family 1 at the ASPM:NM_018136.5:exon18:c.6684_6685delAA:p.R2230Kfs*8 locus was "c.3692delC heterozygous". Figure 3The position indicated by the arrow in the sequencing diagram shows that the genotype of ASPM:NM_018136.5:exon18:c.6684_6685delAA:p.R2230Kfs*8 locus of individuals in layers B and C is the "c.6684_6685delAA heterozygous" mutation; Figure 3 The position indicated by the arrow in the sequencing diagram shows that the genotypes of individuals in layers A and D are wild type.

[0211] Based on the above test results, the ASPM genotype of the proband was a compound heterozygous mutation of c.3692delC and c.6684_6685delAA.

[0212] Example 4

[0213] ASPM gene c.3692delC, c.6684_6685delAA mutation diagnosis kit and application

[0214] 1. Kit composition:

[0215] 1) Amplification primers (1.2 μg each): as shown in Example 3

[0216] 2) Buffer (500 μL of 10×PCR buffer: 500 mmol / L KCl, 100 mmol / L Tris-Cl (pH 8.3), 15 mmol / L MgCl2)

[0217] 3) Taq enzyme (20U)

[0218] 4) dNTPs (4 mM each of the four dNTPs)

[0219] 5) ASPM: c.3692delC, c.6684_6685delAA positive mutation reference DNA. This reference is a double-stranded DNA. The specific sequence of the c.3692delC positive mutation reference DNA is as follows:

[0220]

[0221] The specific sequence of the c.6684_6685delAA positive mutation reference DNA is as follows:

[0222]

[0223]

[0224] Among them, the single underlined bases are the upstream and downstream primer positions for PCR amplification, the bases in the boxes are the mutation sites, and the double underlined bases are the upstream and downstream sequencing primer positions.

[0225] 6) Sequencing primers: as shown in Example 3

[0226] 2. Usage:

[0227] A total of 104 individuals from 23 intellectual disability families were screened and tested, and a family matching the present invention was found again. The application of the gene mutation detection kit was described using the patient from family No. 2 as an example (see Table 10).

[0228] Table 10 Clinical information of the members of the 2nd family with MCPH5 microcephaly

[0229]

[0230] like Figure 4 As shown, the numbering is Ⅰ (first generation) and Ⅱ (second generation).

[0231] Peripheral blood DNA from family members Ⅰ1 (father), Ⅰ2 (mother) and Ⅱ1 (proband) was used for kit detection.

[0232] 1) Genomic DNA extraction: Extract genomic DNA from samples.

[0233] 2) First, the PCR amplification reaction is performed using the above-mentioned PCR amplification primers, Taq enzyme, buffer, dNTPs, sample genomic DNA, etc., as in Example 3;

[0234] 3) Purify the PCR amplification product;

[0235] 4) using the above sequencing primers to perform BigDye reaction on the purified PCR product;

[0236] 5) Purification of BiyDye reaction products;

[0237] 6) Sequence the BiyDye reaction product and compare the sequence with the normal sequence.

[0238] Figure 5 The test results of the kit showed that the genotype of the ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3 locus of the mother and proband of family No. 2 was "c.3692delC heterozygous". Figure 5 The position indicated by the arrow in the sequencing diagram shows that the genotype of the ASPM:NM_018136.5:exon15:c.3692delC:p.P1231Lfs*3 site in the B and C layers is the "c.3692delC heterozygous" mutation; Figure 5 The position indicated by the arrow in the sequencing diagram shows that the genotype of the individuals in layer A is wild type. Figure 6The test results of the kit showed that the genotype of the father and proband of family No. 2 ASPM:NM_018136.5:exon18:c.6684_6685delAA:p.R2230Kfs*8 locus was "c.6684_6685delAA heterozygous". Figure 6 The position indicated by the arrow in the sequencing diagram shows that the genotype of the ASPM:NM_018136.5:exon18:c.6684_6685delAA:p.R2230Kfs*8 site in the A and C layers is the "c.6684_6685delAA heterozygous" mutation; Figure 6 The position indicated by the arrow in the sequencing diagram shows that the genotype of the individual in layer B is wild type. The test results confirmed that the proband was a patient with MCPH5 type microcephaly, and his mother and father were carriers of the mutant gene; the genetic counseling opinion was that the couple's chance of giving birth to another MCPH5 type microcephaly patient was 1 / 4, the chance of giving birth to a carrier offspring was 1 / 2, and the chance of giving birth to a normal individual was 1 / 4. It was recommended that the couple undergo preimplantation genetic diagnosis when planning to have another child and come to the hospital for prenatal diagnosis after pregnancy.

[0239] It can be seen from the results of the above examples that the present invention has discovered a new ASPM gene mutant and confirmed that the new mutant is closely related to the onset of MCPH5 type microcephaly. The pathogenic mutant can be used for the molecular diagnosis of MCPH5 type microcephaly and the differential diagnosis of related diseases.

[0240] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A reagent for detecting compound heterozygous mutation sites of the pathogenic gene ASPM of MCPH5 type microcephaly, characterized in that: The reagents include a primer combination for detecting the mutation site c.3692delC of the pathogenic gene ASPM and a primer combination for detecting the mutation site c.6684_6685delAA of the pathogenic gene ASPM; The primer combination for detecting the mutation site c.3692delC of the pathogenic gene ASPM is a primer set with a nucleotide sequence as shown in SEQ ID NO: 1-2 and a sequencing primer set with a nucleotide sequence as shown in SEQ ID NO: 5-6; The primer combination for detecting the mutation site c.6684_6685delAA of the pathogenic gene ASPM is a primer set with a nucleotide sequence as shown in SEQ ID NO: 3-4 and a sequencing primer set with a nucleotide sequence as shown in SEQ ID NO: 7-8.

2. A diagnostic kit for MCPH5 type microcephaly, characterized in that: The kit comprises the reagent according to claim 1 and a PCR amplification reagent.

3. The kit according to claim 2, characterized in that: The PCR amplification reagents include dNTP, 10×PCR buffer and Taq polymerase; The 10×PCR buffer contains an aqueous solution of the following components: 500 mmol / L KCl, 100 mmol / L Tris-Cl with a pH of 8.3, and 15 mmol / L MgCl 2 .

4. Use of the reagent according to claim 1 in preparing a kit for auxiliary diagnosis of MCPH5 type microcephaly.

Images