Gastric cancer circRNA markers and uses thereof

By using hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438 circRNA biomarkers, combined with quantitative real-time PCR and overexpression technology, the challenges of early diagnosis and treatment of gastric cancer have been solved, achieving efficient and stable diagnostic and treatment results.

CN116004817BActive Publication Date: 2026-02-10SHANGHAI CUTSEQ BIOMEDICAL TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210972076.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-12
Publication Date
2026-02-10
Estimated Expiration
2042-08-12

AI Technical Summary

Technical Problem

There is a lack of effective molecular markers for early diagnosis and treatment of gastric cancer in current technologies, and traditional methods have problems such as false positive risk and insignificant treatment effects.

Method used

Four circRNAs, hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438, were used as biomarkers for diagnosis using quantitative real-time PCR. Overexpression of these circRNAs was also used to inhibit the proliferation of gastric cancer cells.

Benefits of technology

It achieves highly specific and low false-positive diagnosis of gastric cancer, significantly inhibits the growth of gastric cancer cells, provides an effective therapeutic target, and has good prospects for clinical application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116004817B_ABST
    Figure CN116004817B_ABST
Patent Text Reader

Abstract

The application discloses a gastric cancer circRNA marker and application thereof, and belongs to the technical field of biology. The circRNA marker is at least one of hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624 and hsa_circ_0043438. The four kinds of circular RNAs are found to be related to the occurrence of gastric cancer for the first time, are significantly reduced in the serum of a gastric cancer patient, can well predict the occurrence of gastric cancer, and can be used as a gastric cancer diagnosis marker. In addition, the four markers can significantly inhibit the proliferation capacity of gastric cancer cells after overexpression, and can be used as a potential target for gastric cancer treatment.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a gastric cancer circRNA marker and application thereof. BACKGROUND

[0002] Gastric cancer is a multi-stage, slow and multi-factor pathological process. Helicobacter pylori infection, obesity, excessive intake of salt and nitrate are associated with increased incidence of gastric cancer. In addition, gene mutation, epigenetic changes and abnormal molecular signaling pathways are also involved in the occurrence and metastasis of gastric cancer. Therefore, it is crucial to determine the molecular pattern of gastric cancer and its specific biomarkers to develop treatment methods targeting specific tumor behaviors. SUMMARY

[0003] The purpose of the present application is to provide a gastric cancer circRNA marker and application thereof, which can well predict the occurrence of tumors and inhibit the proliferation of gastric cancer cells after overexpression, thus suggesting that it can be used as a marker for the diagnosis of gastric cancer and as a potential way for the treatment of gastric cancer.

[0004] The inventive concept of the present application is:

[0005] A large number of studies have confirmed that many non-coding RNAs (ncRNAs) such as microRNAs (miRNAs) and long non-coding RNAs (lncRNAs) are associated with the carcinogenic process of gastric cancer and can be used as biomarkers for early risk assessment, clinical treatment and survival assessment. In addition, circRNAs are important members of the non-coding RNA family discovered in recent years. More and more evidence shows that circRNAs are involved in the occurrence and development of various diseases, including gastric cancer. Studies have found that most circRNAs are involved in the occurrence and development of some tumors and are abnormally expressed in a tissue-specific manner under pathological conditions. These characteristics make circRNAs important targets and potential markers for tumor diagnosis and treatment.

[0006] DNAJC6 (DnaJ Heat Shock Protein Family (Hsp40) Member C6, DnaJ Heat Shock Protein Family (Hsp40) Member C6) belongs to the evolutionarily conserved DNAJ / HSP40 protein family and regulates chaperone activity by stimulating ATPase activity. DNAJ proteins can have up to three different domains: a conserved 70-amino acid J domain, usually at the N-terminus, a glycine / phenylalanine (G / F)-rich region, and a cysteine-rich domain containing four zinc-finger-like motif domains. Studies have reported that DNAJC6 promotes hepatocellular carcinoma progression by inducing epithelial-mesenchymal transition (Yang T, 2014).

[0007] TDRD3 (Tudor Domain Containing 3) is a scaffold protein that specifically recognizes and binds dimethylarginine-containing proteins. TDRD3 is in the nucleus, acting as a coactivator: recognizing and binding to asymmetric dimethylation on core histone tails (H3R17me2a and H4R3me2a) associated with transcriptional activation, and recruiting proteins at these arginine methylation loci. TDRD3 is in the cytoplasm, possibly playing a role in the assembly and / or disassembly of mRNA stress granules and the regulation of target mRNA translation by binding to Arg / Gly-rich motifs (GAR) in dimethylarginine-containing proteins. TDRD3 promotes DHX9 chromatin recruitment and R-loop release (Wei Yuan, 2021). TDRD3 promotes tumorigenesis and invasive capacity of breast cancer cells (Alan Morettin, 2017).

[0008] GON4L(Gon-4 Like, Gon-4 like protein) is predicted to have transcription co-regulator activity, GON4L drives cancer growth through YY1-androgen receptor-CD24 axis(Neeraj Agarwal, 2016), but its role in gastric cancer is not clear. MED1(Mediator Complex Subunit 1) encodes a protein that is a subunit of the CRSP(SP1 activation required cofactor) complex, which is essential for efficient activation of SP1 along with TFIID, MED1 is also a component of other multi-subunit complexes, such as thyroid hormone receptor (TR)-associated proteins, which interact with TR and facilitate TR function on DNA templates along with initiation factors and cofactors, it also regulates p53-dependent apoptosis, is essential for lipogenesis. Studies have found that MED1 phosphorylated MED1 is a targetable driver of Pol II recycling disorder in cancer(Zhong Chen, 2022), MED1 is also involved in the process of CDK7 inhibitor inhibiting the progression of castration-resistant prostate cancer(Reyaz Ur Rasool, 2019), these results all indicate that MED1 plays a key role in tumors, but its role in gastric cancer is not clear. In the study of circRNA derived from the above four genes, we found that four circRNAs(hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624 and hsa_circ_0043438) were significantly underexpressed in gastric cancer, and overexpression significantly inhibited the proliferation, invasion and migration phenotype of gastric cancer cells. This suggests that the phenomenon of four circRNAs being significantly underexpressed in gastric cancer makes them have application value as diagnostic markers for gastric cancer, and the effect of inhibiting the progression of gastric cancer after overexpression suggests that they can be used as nucleic acid drugs for the treatment of gastric cancer.

[0009] The present application is realized by the following technical solutions:

[0010] In a first aspect, the present application provides a gastric cancer circRNA marker, the circRNA marker is at least one of hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624 and hsa_circ_0043438;

[0011] The nucleotide sequence of hsa_circ_0002454 is shown as SEQ ID No. 1;

[0012] The nucleotide sequence of hsa_circ_0003441 is shown as SEQ ID No. 2;

[0013] The nucleotide sequence of the hsa_circ_0014624 is shown as SEQ ID No. 3.

[0014] The nucleotide sequence of the hsa_circ_0043438 is shown as SEQ ID No. 4.

[0015] In a second aspect, the present application provides a use of a reagent for detecting the gastric cancer circRNA marker in the preparation of a kit for diagnosing gastric cancer.

[0016] Further, in a preferred embodiment of the present application, the reagent comprises a primer set specifically amplifying any one of the hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624 and hsa_circ_0043438.

[0017] Further, in a preferred embodiment of the present application, the primer set of the hsa_circ_0002454 comprises a forward primer and a reverse primer;

[0018] The nucleotide sequence of the forward primer is shown as SEQ ID NO. 5: TGACATTCGAAGCTTTTTGG.

[0019] The nucleotide sequence of the reverse primer is shown as SEQ ID NO. 6: ATAGCTGGGCTCCATGTCTG.

[0020] Further, in a preferred embodiment of the present application, the primer set of the hsa_circ_0003441 comprises a forward primer and a reverse primer;

[0021] The nucleotide sequence of the forward primer is shown as SEQ ID NO. 7: TGGATTCCTGCTCTTGAATG.

[0022] The nucleotide sequence of the reverse primer is shown as SEQ ID NO. 8: TTTGTCTGGAGAGCTTGTGC.

[0023] Further, in a preferred embodiment of the present application, the primer set of the hsa_circ_0014624 comprises a forward primer and a reverse primer;

[0024] The nucleotide sequence of the forward primer is shown as SEQ ID NO. 9: CCTCACCCAAGATGAGGAAG.

[0025] The nucleotide sequence of the reverse primer is shown as SEQ ID NO. 10: CTAGCACCATCAGCCATGTG.

[0026] Further, in the preferred embodiment of the present application, the primer set of hsa_circ_0043438 includes a forward primer and a reverse primer.

[0027] The nucleotide sequence of the forward primer is shown as SEQ ID NO. 11: TAATGGTCATTTAA.

[0028] The nucleotide sequence of the reverse primer is shown as SEQ ID NO. 12: TTCTCATGCAAAATGATG.

[0029] In a specific application, it also includes the forward primer and reverse primer of the internal reference GAPDH:

[0030] Internal reference GAPDH Primer F: GGAGCGAGATCCCTCCAAAAT (SEQ ID NO. 13);

[0031] Internal reference GAPDH Primer R: GGCTGTTGTCATACTTCTCATGG (SEQ ID NO. 14).

[0032] Further, in the preferred embodiment of the present application, the reagent also includes: reverse transcription PCR reagent and fluorescent quantitative PCR reagent; preferably, the reverse transcription PCR reagent includes: 2X RT Mix, RT Enzyme Mix and RNA free ddH2O;

[0033] Preferably, the reaction system and conditions for reverse transcription of RNA into cDNA are as follows:

[0034] Total RNA 2 μg Random Primer 0.5 μL 2X RT Mix 5 μL RT Enzyme Mix 1 μL RNA free ddH2O Add up to 10 μL

[0035] The reaction conditions are: 37°C for 10 min, 42°C for 20 min, 85°C for 5 min, and 4°C for 2 min.

[0036] Preferably, the fluorescent quantitative PCR reagent includes: 2X PCR Master Mix and RNA free ddH2O.

[0037] Preferably, the reaction system and reaction conditions for fluorescent quantitative PCR amplification detection are as follows:

[0038] cDNA 1 μL Upstream Primer (10 μM) 0.2 μL Downstream Primer (10 μM) 0.2 μL 2X PCR Master Mix 10 μL RNA free ddH2O Add up to 20 μL

[0039] The fluorescent quantitative PCR reaction conditions are: denaturation at 95°C for 5 min; 95°C for 10 s, 60°C for 35 s; 40 cycles.

[0040] In a third aspect, the present application further provides a gastric cancer diagnosis kit, comprising specific primers for the above-mentioned circRNA markers.

[0041] In a fourth aspect, the present application further provides use of an expression promoter of the above-mentioned gastric cancer circRNA markers in the preparation of a medicament for treating gastric cancer.

[0042] Compared with the prior art, the present application has at least the following technical effects:

[0043] The present application first discovers that four circular RNAs, hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624 and hsa_circ_0043438, are related to the occurrence of gastric cancer, and their expression in the serum of gastric cancer patients is significantly reduced, thus indicating that the four circular RNAs can well predict the occurrence of gastric cancer and can be used as a gastric cancer diagnosis marker. The circRNA marker can be quantitatively detected by fluorescence quantitative PCR method, and the diagnosis of gastric cancer is realized. The use of the circRNA marker for the diagnosis of gastric cancer has strong specificity, high sensitivity, stable results, and no false positives, and has a good clinical application prospect.

[0044] In addition, the overexpression of the four markers hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624 and hsa_circ_0043438 can significantly inhibit the proliferation ability of gastric cancer cells, thus indicating that the four circular RNA genes can be used as potential targets for the treatment of gastric cancer, i.e. using their expression promoters to develop drugs for treating gastric cancer, which is beneficial to the effective treatment of gastric cancer. BRIEF DESCRIPTION OF DRAWINGS

[0045] Figure 1 FIG. 1 is a diagram for identification of circular RNA hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624 and hsa_circ_0043438 in Example 1 of the present application.

[0046] Figure 2 FIG. 2 is a fluorescence quantitative PCR detection result diagram of the decrease of expression of hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624 and hsa_circ_0043438 in the serum of gastric cancer in Example 2 of the present application.

[0047] Figure 3The figure shows that hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624 and hsa_circ_0043438 in Example 2 of the present application have good marker performance in serum of gastric cancer;

[0048] Figure 4 The figure shows the experimental results of hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624 and hsa_circ_0043438 in Example 3 of the present application on inhibiting proliferation of gastric cancer cells; DETAILED DESCRIPTION

[0049] The embodiments of the present application will be described in detail below with reference to the examples, but those skilled in the art will understand that the following examples are only for illustration of the present application and should not be regarded as limiting the scope of the present application. The specific conditions not mentioned in the examples are carried out according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments not mentioned by the manufacturer are all conventional products that can be purchased on the market.

[0050] The specific embodiments of the present application will be described in detail below. It should be understood that the specific embodiments described herein are only for illustration and explanation of the present application, and are not intended to limit the present application.

[0051] Example 1

[0052] Identification of hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624 and hsa_circ_004348

[0053] (1) 1 ml trizol was added to the plasma of gastric cancer patients and healthy people;

[0054] (2) 200 μL chloroform was added, and it was shaken vigorously for 10 seconds and placed at room temperature for 10 minutes;

[0055] (3) Centrifugation at 12,000 g for 10 min at 4°C, the solution was divided into three layers, the RNA was dissolved in the water phase, and the water phase was transferred to another new RNase free EP tube;

[0056] (4) 1 volume of isopropanol was added and vortexed thoroughly;

[0057] (5) Centrifugation at 12,000 g for 15 min at 4°C, RNA precipitate appeared at the bottom of the tube after centrifugation, and the supernatant was discarded;

[0058] (6) Add 1 ml 75% ethanol, gently invert by hand, 12,000g centrifuge for 5 min, discard the supernatant;

[0059] (7) Dry at room temperature, add 20 μL DEPC water to dissolve the precipitate.

[0060] 2. Genomic DNA removal

[0061] To remove the residual genomic DNA in total RNA, DNA digestion enzyme is used, and the specific reaction system and conditions are as follows, the total volume of the reaction solution is 10 μL, and the following components are composed:

[0062] RNA 6 μL (3 μg) DNase I 1 μL 10X buffer 1 μL RNA free H2O 2 μL

[0063] After 40 min of digestion at 37℃ in the reaction solution, inactivate the DNA digestion enzyme at 85℃ for 3 min.

[0064] 3. Reverse transcription of RNA into CDNA

[0065] The reaction system and conditions of reverse transcription of RNA into cDNA are as follows:

[0066] Total RNA 2 μg Random Primer 0.5 μL 2X RT Mix 5 μL RT Enzyme Mix 1 μL RNA free ddH2O Add up to 10 μL

[0067] The reaction conditions are: 37℃ for 10 min, 42℃ for 20 min, 85℃ for 5 min, and 4℃ for 2 min.

[0068] 4. Design of reverse amplification PCR primer to amplify circRNA interface and flanking sequence DNA sequencing verification

[0069] According to the reference sequence provided in the Circbase database, the reverse PCR amplification primer is designed to amplify the interface and flanking sequence of hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438. The primer sequence is shown in Table 1:

[0070] Table 1. Primer sequence of gastric cancer circRNA marker

[0071]

[0072] Primers amplified a 350 bp partial sequence of the circular RNA hsa_circ_0002454. Using cDNA as a template, PCR amplified partial sequences flanking the circularization interface of the circular RNA hsa_circ_0002454. Separation was achieved by 1.2% nucleic acid agarose gel electrophoresis, and the PCR product was purified and verified by DNA sequencing. The results showed that the circular RNA hsa_circ_0002454 is a circular RNA molecule formed by the first-order ligation of exons 2, 3, and 4 of the DNAJC6 gene. The circular sequence of hsa_circ_0002454 was confirmed by first-generation Sanger sequencing after amplification. Figure 1 A) The full length of hsa_circ_0002454 is 350 bases, and the full-length sequence is:

[0073] GTGCCTCATCTCCAGACATGGAGCCCAGCTATGGGGGAGGTCTCTTTGACATGGTAAAAGGAGGTGCAGG

[0074] GAGGCTCTTTAGTAACCTAAAGGACAACTTGAAAGACACCCTCAAAGACACATCTTCTAGAGTGATACAATC

[0075] TGTGACCAGCTACACAAAGGGAGATTTAGACTTCACTTATGTTACCTCCAGAATTATTGTGATGTCCTTTCCTC

[0076] TGGACAATGTTGACATAGGATTCAGGAATCAGGTTGATGACATTCGAAGCTTTTTGGATTCCAGACATCTTGACCACTACACAGTATACAATCTGTCACCTAAGTCTTATCGAACTGCCAAGTTTCACAGCCGG (SEQ ID NO. 1). Primers amplified a partial sequence of the circular RNA hsa_circ_0003441, which was 450 bp in size. Using cDNA as a template, PCR amplified partial sequences flanking the circular interface of the circular RNA hsa_circ_0003441. Separation was achieved by 1.2% nucleic acid agarose gel electrophoresis, and the PCR product was purified and verified by DNA sequencing. The results showed that the circular RNA hsa_circ_0003441 molecule is a circular RNA molecule formed by the first-order ligation of exons 2, 3, 4, and 4 of the TDRD3 gene. After amplification, the circular sequence of hsa_circ_0003441 was confirmed by first-generation Sanger sequencing. Figure 1B), the full length of hsa_circ_0003441 is 450 bases, and the full length sequence is:

[0077] GAAAAGCTCGAAGGTCCATGTGTTTTGCAAATTCAAAAAATTCGCAATGTTGCTGCACCAAAGGATAATGAA

[0078] GAAAAGCTCGAAGGTCCATGTGTTTTGCAAATTCAAAAAATTCGCAATGTTGCTGCACCAAAGGATAATGAA

[0079] GAAAAGCTCGAAGGTCCATGTGTTTTGCAAATTCAAAAAATTCGCAATGTTGCTGCACCAAAGGATAATGAA

[0080] GAAAAGCTCGAAGGTCCATGTGTTTTGCAAATTCAAAAAATTCGCAATGTTGCTGCACCAAAGGATAATGAA

[0081] GAAAAGCTCGAAGGTCCATGTGTTTTGCAAATTCAAAAAATTCGCAATGTTGCTGCACCAAAGGATAATGAA

[0082] GAAAAGCTCGAAGGTCCATGTGTTTTGCAAATTCAAAAAATTCGCAATGTTGCTGCACCAAAGGATAATGAA

[0083] The size of the partial sequence of the circular RNA hsa_circ_0014624 amplified by the primer is 1710bp; the partial sequence of the circular RNA hsa_circ_0014624 on both sides of the circular interface is amplified by PCR with cDNA as a template, and the PCR product is purified and verified by DNA sequencing. The results show that the circular RNA hsa_circ_0014624 molecule is a circular RNA molecule connected by the first nucleotide of the 21st exon of the GON4L gene. After amplification, the circular sequence of hsa_circ_0014624 is confirmed by first-generation Sanger sequencing Figure 1 C), the full length of hsa_circ_0014624 is 1710 bases, and the full length sequence is:

[0084] GCCAGTCTGCCATCCATCCAGGAAGAACTGCGGCACATGGCTGATGGTGCTAGAGAGGTAGGAAATATGAC

[0085] TGGAACCACTGAGATCAACTCAGATCGAAGCCTAGAAAAAGACAATTTGGAGTTGGGGAGTGAATCTCGGT

[0086] ACCCACTGCTATTGCCTAAGGGTGTAGTCCTGAAACTGAAGCCAGTTGCCACCCGTTTCCCCAGGAAGGCTT

[0087] GGAGACAGAAGCGTTCATCAGTCCTGAAGCCCCTCCTTATCCAACCCAGCCCCTCTCTCCAGCCCAGCTTCA

[0088] ACCCTGGGAAAACACCAGCCCGATCAACTCATTCAGAAGCCCCTCCGAGCAAAATGGTGCTCCGGATTCCTC

[0089] ACCCAATACAGCCAGCCACTGTTTTACAGACAGTTCCAGGTGTCCCTCCACTGGGGGTCAGTGGAGGTGAG

[0090] AGTTTTGAGTCTCCTGCAGCACTGCCTGCTGTGCCCCCTGAGGCCAGGACAAGCTTCCCTCTGTCTGAGTCC

[0091] CAGACTTTGCTCTCTTCTGCCCCTGTGCCCAAGGTAATGCTGCCCTCCCTTGCCCCTTCTAAGTTTCGAAAGC

[0092] CATATGTGAGACGGAGACCCTCAAAGAGAAGAGGAGTCAAGGCCTCTCCCTGTATGAAACCTGCCCCTGTT

[0093] ATCCACCACCCTGCATCTGTTATCTTCACTGTTCCTGCTACCACTGTGAAGATTGTGAGCCTTGGCGGTGGCT

[0094] GTAACATGATCCAGCCTGTCAATGCGGCTGTGGCCCAGAGTCCCCAGACTATTCCCATCACTACCCTCTTGGT

[0095] TAACCCTACTTCCTTCCCCTGTCCATTGAACCAGTCCCTTGTGGCCTCCTCTGTCTCACCCTTAATTGTTTCTGG

[0096] CAATTCTGTGAATCTTCCTATACCATCCACCCCTGAAGATAAGGCCCACGTGAATGTGGACATTGCTTGTGCT

[0097] GTGGCTGATGGGGAAAATGCCTTTCAGGGCCTAGAACCCAAATTAGAGCCCCAGGAACTATCTCCTCTCTCT

[0098] GCTACTGTTTTCCCGAAAGTGGAACATAGCCCAGGGCCTCCACTAGCAGATGCAGAGTGCCAAGAAGGATT

[0099] GTCAGAGAATAGTGCCTGTCGCTGGACCGTTGTGAAAACAGAGGAGGGGAGGCAAGCTCTGGAGCCGCT

[0100] CCCTCAGGGCATCCAGGAGTCTCTAAACAACCCTACCCCTGGGGATTTAGAGGAAATTGTCAAGATGGAAC

[0101] CTGAAGAAGCTAGAGAGGAAATCAGTGGATCCCCTGAGCGTGATATTTGTGATGACATCAAAGTGGAACAT

[0102] GCTGTGGAATTGGACACTGGTGCCCCAAGCGAGGAGTTGAGCAGTGCTGGAGAAGTAACGAAACAGACA

[0103] GTCTTACAGAAGGAAGAGGAGAGGAGTCAGCCAACTAAAACCCCTTCATCTTCTCAAGAGCCCCCTGATGA

[0104] AGGAACCTCAGGGACAGATGTGAACAAAGGATCATCAAAGAATGCTTTGTCCTCAATGGATCCTGAAGTGA

[0105] GGCTTAGTAGCCCCCCAGGGAAGCCAGAAGATTCATCCAGTGTTGATGGTCAGTCAGTGGGGACTCCAGTT

[0106] GGGCCAGAAACTGGAGGAGAGAAGAATGGGCCAGAAGAAGAGGAAGAAGAGGACTTTGATGACCTCACCCAAGATGAGGAAGATGAAATGTCATCAGCTTCTGAGGAATCTGTGCTTTCTGTCCCAGAACTCCAG (SEQ ID NO. 3).

[0107] Primers amplified a 90 bp portion of the circular RNA hsa_circ_0043438. Using cDNA as a template, PCR amplified partial sequences flanking the circularization interface of hsa_circ_0043438, separated by 1.2% nucleic acid agarose gel electrophoresis, and the purified PCR product was verified by DNA sequencing. The results showed that the circular RNA hsa_circ_0043438 molecule is a circular RNA molecule formed by the first-to-last connection of exon 10 of the MED1 gene. The circular sequence of hsa_circ_0043438 was confirmed by first-generation Sanger sequencing after amplification. Figure 1 D), hsa_circ_0043438 has a full length of 90 bases, and its full-length sequence is:

[0108] GTCATTTAATGAACCTGAAGTACTATGTCTCTCCTTCTGACCTACTGGATGACAAGACTGCATCTCCCATCATTTGCATGAGAATAATG (SEQ ID NO. 4).

[0109] Example 2

[0110] Quantitative PCR detection of circRNA biomarkers

[0111] The method for detecting the expression of circular hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438 molecules in the plasma of gastric cancer patients and healthy individuals by real-time quantitative PCR is as follows:

[0112] Total RNA was extracted according to the method described in Example 1, and residual genomic DNA in the extracted RNA was removed using DNase. The RNA was then reverse transcribed into cDNA. Finally, quantitative real-time PCR was used for amplification and detection. The primer sequences for quantitative real-time PCR are shown in SEQ ID NO. 5-14 in Table 1. The reaction system and reaction conditions for quantitative real-time PCR amplification and detection of the expression of circular RNA molecules hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438 in the plasma of gastric cancer patients and healthy individuals are as follows:

[0113] cDNA 1 μL Upstream Primer (10 μM) 0.2 μL Downstream Primer (10 μM) 0.2 μL 2X PCR Master Mix 10 μL RNA free ddH2O Add up to 20 μL

[0114] The reaction conditions for real-time PCR were: denaturation at 95℃ for 5 minutes; 95℃ for 10 seconds, 60℃ for 35 seconds; 40 cycles.

[0115] Quantitative real-time PCR was used to detect the expression of circular RNAs hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438 in the plasma of gastric cancer patients and healthy individuals. The results are as follows: Figure 2 and Figure 3 As shown:

[0116] in, Figure 2 A represents the expression level of hsa_circ_0002454 in the plasma of gastric cancer patients and healthy individuals. As shown in the figure, the expression of hsa_circ_0002454 in the plasma of gastric cancer patients is significantly reduced.

[0117] Figure 2 B represents the expression level of hsa_circ_0003441 in the plasma of gastric cancer patients and healthy individuals. As shown in the figure, the expression of hsa_circ_0003441 in the plasma of gastric cancer patients is significantly reduced.

[0118] Figure 2 C represents the expression level of hsa_circ_0014624 in the plasma of gastric cancer patients and healthy individuals. As shown in the figure, the expression of hsa_circ_0014624 in the plasma of gastric cancer patients is significantly reduced.

[0119] Figure 2 D represents the expression level of hsa_circ_0043438 in the plasma of gastric cancer patients and healthy individuals. As shown in the figure, the expression of hsa_circ_0043438 in the plasma of gastric cancer patients is significantly reduced.

[0120] Figure 3A, hsa_circ_0002454, showed good biomarker performance in serum of gastric cancer, with an AUC of 0.7598.

[0121] Figure 3 B, hsa_circ_0003441, showed good biomarker performance in the serum of gastric cancer, with an AUC of 0.8408.

[0122] Figure 3 C represents hsa_circ_0014624, which shows good biomarker performance in gastric cancer serum, with an AUC of 0.8288.

[0123] Figure 3 D represents hsa_circ_0043438, which shows good biomarker performance in gastric cancer serum, with an AUC of 0.7788.

[0124] The results are summarized in the table below:

[0125] Marker AUC hsa_circ_0002454 0.7598 hsa_circ_0003441 0.8408 hsa_circ_0014624 0.8288 hsa_cire_0043438 0.7788

[0126] This indicates that hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438 can be used as tumor diagnostic markers. hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438 are significantly reduced in the serum of gastric cancer patients and can effectively predict the occurrence of tumors.

[0127] The quantitative real-time PCR detection method of the present invention can ideally detect the expression of circular RNAs hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438 in organisms.

[0128] Example 3

[0129] CCK8 assay to detect the effect of circRNAs on cell proliferation

[0130] To investigate the effects of hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438 on cell proliferation, overexpression vectors for hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438 were first constructed to effectively upregulate their expression in gastric cancer cell lines BGC-823 and SGC-7901. The "Control" group refers to the group transfected with the empty vector plasmid during cell transfection, i.e., the control group. "hsa_circ_0002454", "hsa_circ_0003441", "hsa_circ_0014624", and "hsa_circ_0043438" refer to the groups transfected with the overexpression vectors hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438, respectively. Logarithmically growing gastric cancer cells BGC-823 and SGC-7901 were seeded into six-well plates at a cell suspension of 2 × 10⁴ cells / mL and cultured for 24 hours at 37°C, 5% CO₂. The six-well plates were then removed, the old culture medium was discarded, and 1.5 mL of serum-free culture medium was added, preparing the plates for liposome transfection. The cells were transfected with the overexpression vectors hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438, respectively. Gastric cancer cell lines BGC-823 and SGC-7901, transfected for 24 hours and in logarithmic growth phase, were removed from six-well plates. The old culture medium was discarded, cells were washed with PBS, and trypsin was added to digest the cells. The cells were then resuspended in 1640 medium containing 10% FBS to stop digestion. Cell counts were performed using a hemocytometer, and 100 μL of cell suspension was added to 96-well plates, seeding approximately 1000 cells per well. Three to five replicates were set up for each well group (plates and control group). Cells were incubated. One well of the 96-well plate was examined at 0 hours (6 hours after plating when cells were fully adhered), 24 hours, 48 ​​hours, and 72 hours. Add 10 μL of CCK-8 reagent to each well, gently shake to mix, and incubate at 37°C. Incubate for one hour. Measure the absorbance at 450 nm using a microplate reader.Based on the obtained absorbance values, the data were analyzed and cell growth curves were plotted to evaluate the effects of overexpression of hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438 on cell proliferation.

[0131] After overexpressing hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438 in gastric cancer cell lines BGC-823 and SGC-7901, cell proliferation was detected by CCK8 assay. The results are as follows: Figure 4 As shown: Among them, Figure 4 Figure A shows the results of detecting the cell proliferation ability of hsa_circ_0002454 after overexpression in gastric cancer cell lines BGC-823 and SGC-7901. As can be seen from the figure, gastric cancer cells were significantly inhibited, with inhibition rates of 29% and 30%, respectively.

[0132] Figure 4 B represents the results of detecting the cell proliferation ability of hsa_circ_0003441 after overexpression in gastric cancer cell lines BGC-823 and SGC-7901. As shown in the figure, gastric cancer cells were significantly inhibited, with inhibition rates of 26% and 38%, respectively.

[0133] Figure 4 C represents the results of detecting the cell proliferation ability of hsa_circ_0014624 after overexpression in gastric cancer cell lines BGC-823 and SGC-7901. As shown in the figure, gastric cancer cells were significantly inhibited, with inhibition rates of 41% and 43%, respectively.

[0134] Figure 4 D represents the results of detecting the cell proliferation ability of hsa_circ_0043438 after overexpression in gastric cancer cell lines BGC-823 and SGC-7901. As shown in the figure, gastric cancer cells were significantly inhibited, with inhibition rates of 51% and 47%, respectively.

[0135] In summary, this invention provides circRNA biomarkers for the diagnosis and treatment of gastric cancer, namely the circular RNA genes hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438. The inventors, using quantitative real-time PCR, found that the expression levels of these circular RNA genes in the serum of gastric cancer patients were significantly lower than those in healthy individuals, indicating that these four circRNA biomarkers can predict the occurrence of gastric cancer and can be used as diagnostic biomarkers for gastric cancer. Furthermore, the effects of hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438 on cell proliferation were studied using a CCK8 assay. The results showed that overexpression of these four biomarkers in gastric cancer cell lines BGC-823 and SGC-7901 significantly inhibited the growth of gastric cancer cells. This demonstrates that the four biomarkers hsa_circ_0002454, hsa_circ_0003441, hsa_circ_0014624, and hsa_circ_0043438 can serve as both diagnostic markers and potential therapeutic targets for gastric cancer. Reagents used to detect these four biomarkers can be incorporated into products for diagnosing or treating cancer, such as microarrays, kits, or nucleic acid membrane strips.

[0136] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. The application of a reagent for detecting gastric cancer circRNA biomarkers in the preparation of a diagnostic kit for gastric cancer, characterized in that, The circRNA marker is hsa_circ_0003441; The nucleotide sequence of hsa_circ_0003441 is shown in SEQ ID No.

2.

2. The application according to claim 1, characterized in that, The reagents include a set of primers specifically for amplifying hsa_circ_0003441.

3. The application according to claim 2, characterized in that, The primer set of hsa_circ_0003441 includes forward primers and reverse primers; The nucleotide sequence of the forward primer is shown in SEQ ID NO.7; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.

8.

4. The application according to claim 2, characterized in that, The reagents also include: reverse transcription PCR reagents and real-time PCR reagents; The reverse transcription PCR reagents include: 2× RT Mix, RT Enzyme Mix, and RNA-free ddH2O; The quantitative PCR reagent includes: 2× PCR Master Mix and RNA-free ddH2O.