KASP molecular marker related to leaf purple color of brassica rapa and application thereof

By developing SNP molecular markers in common Chinese cabbage and using KASP technology for genotyping, the problem of leaf color identification in common Chinese cabbage was solved, realizing efficient molecular marker-assisted breeding and improving breeding efficiency and accuracy.

CN116004901BActive Publication Date: 2026-04-21ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
Filing Date
2022-12-30
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

In the current technology, there is limited research on anthocyanin regulatory genes in common Chinese cabbage, which makes it difficult to quickly and effectively apply molecular markers to breeding practices and achieve rapid identification and screening of leaf color.

Method used

A SNP molecular marker located at 35,836,974 bases on chromosome 3 of common Chinese cabbage was developed, and genotyping was performed using KASP technology. High-throughput competitive allele-specific PCR was conducted using the IntelliQube platform, and a specific primer set was designed for detection, thus realizing molecular marker-assisted screening for leaf color.

Benefits of technology

Marker-assisted selection significantly improves breeding efficiency, saves breeding costs, and enables rapid and accurate prediction of common cabbage leaf color.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116004901B_ABST
    Figure CN116004901B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of KASP molecular markers related to common pakchoi leaf purple and its application, by QTL-seq technology and genetic map location, the main effect QTL site related to leaf purple located on the 3rd chromosome of common pakchoi is found, and further developed the molecular marker closely linked to site, by the seed or seedling leaf extraction DNA of color unknown common pakchoi material, combined with the KASP primer of the present application carries out KASP molecular marker genotyping test, the color of common pakchoi can be predicted by the genotyping result of marker, without using artificial identification method, can obviously improve breeding efficiency, save breeding cost.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to molecular markers in Chinese cabbage leaves, belonging to the fields of biological detection and breeding. Background Technology

[0002] Non-heading Chinese cabbage (Brassica campestris sp. Chinensis Makino) is a variety of Brassica spp. in the Brassicaceae family. Native to southern my country, it is one of the country's main leafy vegetables. Non-heading Chinese cabbage includes six varieties: common Chinese cabbage (var. communis Tsen et Lee), tatsoi (var. rosularis Tsen et Lee), flowering cabbage (var. tsai-tai Hort), flowering cabbage (var. Tai-tsai Hort), tillering cabbage (var. Muticeps Hort), and rapeseed (var. Utilis Tsen et Lee). Green-stemmed cabbage, also known as common Chinese cabbage, bok choy, small rapeseed, etc., has the widest distribution, especially in the middle and lower reaches of the Yangtze River, accounting for 30% to 40% of the total vegetable multiple cropping area.

[0003] Anthocyanins, as natural pigments, are the coloring substances of purple Brassica oleracea and play an important role in plant growth and human health. Currently, six anthocyanins have been identified in purple Brassica vegetables, including cyanidin, peonyin, delphinidin, malvidin, anthocyanin, and morning gloryin. They help plants attract insects for pollination and seed dispersal, prevent UV radiation damage, and resist pathogen infection; they also have strong antioxidant capabilities, helping the human body to eliminate free radicals and prevent cancer, inflammation, and cardiovascular diseases. Therefore, in-depth research on the genes regulating anthocyanins in purple Brassica oleracea is of great significance for using modern biotechnology to breed anthocyanin-rich Brassica oleracea to meet the growing demand for healthy functional foods.

[0004] Genetic studies have shown that the purple trait in Brassica oleracea crops is a single-gene dominant trait. Different studies have located the purple gene in Brassica oleracea crops on chromosomes A02, A03, A07, and A09. The results indicate that the genes controlling the purple trait in Brassica vegetables are complex, with different genetic mechanisms among varieties, subspecies, and even different materials. The key genes controlling anthocyanin synthesis and regulation are also complex and diverse. Currently, anthocyanin regulatory genes have been located and cloned in Chinese cabbage, purple flowering cabbage, and kale, but research reports on them in common Chinese cabbage are limited, and the developed molecular markers cannot be quickly and effectively applied to breeding practices.

[0005] Currently, anthocyanin regulatory genes have been located and cloned in Chinese cabbage, purple flowering cabbage, and kale, but there are few research reports on them in common Chinese cabbage, and the developed molecular markers cannot be quickly and effectively applied to breeding practices. Summary of the Invention

[0006] The present invention develops a molecular marker closely linked to the trait within the QTL range of common Chinese cabbage leaf color and verifies the reliability of the marker. By detecting the molecular marker, the leaf color of common Chinese cabbage can be predicted, providing a molecular marker-assisted selection technology for the identification and screening of common Chinese cabbage leaf color.

[0007] In a first aspect, this invention provides an SNP molecular marker, wherein the SNP molecular marker site is located at the 35,836,974th base on chromosome 3 of common cabbage, and the SNP marker is a C-to-A transition. The sequence information of the 80 bases upstream and downstream of this marker is extracted.

[0008] The marker CGTCCTTGAGGTTCCCCTACTCGACCTGGAATTCAGAGGCATGAGTCTTCATCACCTCGACGATCTCCCTCTTGCCCTT[C / A]TGTTCCGCCTTGCGGACAGCCCTCGCATGAT CACGAGCAAGTTGCGCAGCTCGCTCCAACATCTCGCCTTGCATGCGAGC (SEQ ID NO: 1) was converted into a KASP marker using primer design software. The polymorphism of the marker was then verified by using the high-throughput IntelliQube genotyping platform based on competitive allele-specific PCR (KSAP technology) for SNP genotyping, thus enabling molecular marker-assisted screening for the color of common Chinese cabbage leaves.

[0009] A second aspect of the present invention provides a specific primer set for detecting SNPs, wherein the primer set is a KASP primer transformed with SNP markers, and the primer sequence is as follows:

[0010] Forward primer 1, F-1: ACGATCTCCCTCTTGCCCTTC (SEQ ID NO:2)

[0011] Forward primer 2, F-2: ACGATCTCCCTCTTGCCCTTA (SEQ ID NO:3)

[0012] Reverse primer, R:TGCTCGGTCAGCGAGCTTCCAC (SEQ ID NO:4).

[0013] The third aspect of this invention is to provide a method for detecting SNPs. The method uses the primers described in the second aspect, with the extracted plant genome as a template, and performs a competitive allele-specific PCR (KASP) reaction using the high-throughput IntelliQube genotyping platform. The KASP reaction system is as follows: the reaction system is prepared according to the IntelliQube platform manual from LGC, specifically including a KASP primer mixture, a KASP master mixture, and a DNA template. The KASP primer mixture contains two allele-specific forward primers and one shared reverse primer; the KASP master mixture contains FAM-labeled oligosequences from the F-1 tail, HEX-labeled oligosequences from the F-2 tail, FAM dye, HEX dye, and a quencher; the DNA template is common Chinese cabbage genomic DNA.

[0014] In one specific embodiment, the KASP test steps can be simplified as follows:

[0015] 1. Aliquot the DNA samples into 96-well PCR plates. Prepare the DNA samples to a uniform and suitable concentration (5-10 ng / μl) and add them to the 96-well PCR plates. Add two negative controls (NTCs) to each PCR plate.

[0016] 2. Prepare the KASP genotyping mixture. Using a 384-well array tape, the mixture should contain: 0.8 μL wet DNA, 0.8 μL 2x KASPMaster mix + Assay, for a total reaction volume of 1.6 μL.

[0017] 3. Add the KASP genotyping mixture to the array tape membrane containing the DNA template. Using the IntelliQube SNP gene detection platform, program the process and sequentially place the 384-well array tape, DNA sample plate, and KASP genotyping mixture into the machine. Operate the machine to automatically dispense the DNA sample diluent and KASP genotyping mixture into the 384-well array tape and seal the membrane.

[0018] 4. Perform PCR cycling. PCR can be performed in the IntelliQube machine in SNP genotyping inline mode (single membrane) or in the Hydrocycler machine in SNP genotyping outline mode (multiple membranes) for water bath PCR. The program settings are as follows: 1. Pre-denaturation: 94℃, 15 min, 1 cycle; 2. Denaturation: 94℃, 20 sec; Annealing / Extension: 61-55℃, 60 sec (-0.6℃ / cycle); Step 2 10

[0019] 26 cycles; 3. Denaturation: 94°C, 20 sec; annealing / extension: 55°C, 60 sec, step 3, 26 cycles.

[0020] 5. Fluorescence data reading and analysis. After the PCR reaction, fluorescence data were read and analyzed using an IntelliQube instrument. Fluorescence excitation FAM: 485 nm, emission: 520 nm; HEX excitation: 535 nm, emission: 556 nm; ROX excitation: 575 nm, emission: 610 nm.

[0021] 6. Add cycles. If the fluorescence signal is low and the clusters are scattered, fluorescence readings can be performed after adding cycles. The conditions for adding cycles are as follows: denaturation: 94℃, 20 sec; annealing / extension: 57℃, 60 sec, 3 cycles.

[0022] KASP typing results:

[0023] First, the primers and methods described above can detect the presence of major QTL sites related to leaf color traits in common Chinese cabbage, and at the same time detect the polymorphism type of the marker. The marker type is consistent with the corresponding plant resistance phenotype, and the leaf color of common Chinese cabbage can be predicted by the marker type.

[0024] The beneficial effects of this invention are as follows: This invention discovers a major QTL locus related to leaf color on chromosome 3 of common Chinese cabbage using QTL-seq technology and genetic mapping. Furthermore, it develops molecular markers closely linked to the locus. By extracting DNA from seeds or seedling leaves of resistant unknown common Chinese cabbage materials, and combining it with the KASP primers of this invention to conduct KASP molecular marker typing experiments, the typing results of the markers can predict the leaf color of common Chinese cabbage without the need for manual identification, which can significantly improve breeding efficiency and save breeding costs. Attached Figure Description

[0025] Figure 1 The QTL-seq mapping of the purple trait in common Chinese cabbage shows a distinct peak region on chromosome 3, and the major QTL locus region (35.7–36.05 Mb) can be delineated with a 99% confidence interval.

[0026] Figure 2 The results of prediction for 60 F2 individual plants were obtained using this molecular marker. Detailed Implementation

[0027] The specific implementation methods and technical solutions of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. It should be noted that those skilled in the art can refer to the content of this document and appropriately improve the process parameters to achieve the desired results. In particular, it should be pointed out that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and those skilled in the art can obviously make modifications or appropriate changes and combinations to the methods and applications described herein without departing from the content, spirit and scope of the present invention to realize and apply the technology of the present invention.

[0028] The present invention will be described through specific embodiments, but the present invention is not limited thereto.

[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; unless otherwise specified, the reagents, biological materials, etc. used in the following examples are commercially available.

[0030] Example 1: Obtaining the Purple Phenotype Sample Library

[0031] 1) The F1 generation was obtained by crossing purple common Chinese cabbage 'B1264' and green common Chinese cabbage '523'. The F1 generation was then self-crossed to obtain a segregating population of 468 F2 plants, which was used as the research object.

[0032] 2) In the F2 generation, traits segregated, with both green and purple plants, and variations in shade of purple. The BQT1 population had 124 green plants and 344 purple plants. A chi-square test showed a 3:1 segregation ratio of purple to green plants in both F2 populations, indicating that the purple trait is a dominant quality trait controlled by a gene. From the F2 generation, 30 dark purple plants were selected and grouped into a purple pool, and 30 green plants were selected and grouped into a green pool. A modified CTAB method was used to extract DNA from these extreme plants and the parents.

[0033] Example 2: SNP Acquisition

[0034] 1) Illumina HiSeq™ PE150 was used to sequence two parents and two pools. The sequencing depth of the parents was 10× and the sequencing depth of the pools was 30×.

[0035] 2) The SNP-index was calculated using the pooled sequencing QTL-seq method for extreme traits. After 1000 permutation tests, a 95% confidence level was selected as the screening threshold. Major QTL loci associated with the purple locus were detected on chromosome 3 of common Chinese cabbage.

[0036] 3) The physical location of this site is in the 35.7-36.05Mb region of chromosome 3. There are 632 identified SNP sites in this region. Thirteen polymorphic SNP sites were selected in this region, and 50bp base sequences were extracted from the upstream and downstream sides of each site. KASP marker primers were designed according to primer design principles.

[0037] The sequence information of the KASP primer developed based on SNP site information at position 35,836,974 on chromosome 3 is as follows:

[0038] Forward primer 1, F-1: ACGATCTCCCTCTTGCCCTTC

[0039] Forward primer 2, F-2: ACGATCTCCCTCTTGCCCTTA

[0040] Reverse primer, R:GCGAGATGTTGGAGCGAGCTGCG

[0041] The SNP genotyping test based on KSAP technology was conducted on the parents and F2 generation single plants with different resistance using the IntelliQube platform of LGC. The specific KASP test procedure was carried out in accordance with the instructions.

[0042] KASP reaction system: The reaction system was developed according to the IntelliQube platform manual from LGC, specifically including:

[0043] KASP primer mixture, KASP master mixture, and DNA template.

[0044] The KASP primer mixture contains two allele-specific forward primers and one shared reverse primer; the KASP master mixture contains FAM-tagged oligosequences of F-1 tail, HEX-tagged oligosequences of F-2 tail, FAM dye, HEX dye, and quencher; the DNA template is common Chinese cabbage genomic DNA.

[0045] KASP test procedure:

[0046] 1. Aliquot the DNA samples into 96-well PCR plates. Prepare the DNA samples to a uniform and suitable concentration (5-10 ng / μl) and add them to the 96-well PCR plates. Add two negative controls (NTCs) to each PCR plate.

[0047] 2. Prepare the KASP genotyping mixture. Using a 384-well array tape, the mixture should contain: 0.8 μL wet DNA, 0.8 μL 2x KASPMaster mix + Assay, for a total reaction volume of 1.6 μL.

[0048] 3. Add the KASP genotyping mixture to the array tape membrane containing the DNA template. Using the IntelliQube SNP gene detection platform, program the process and sequentially place the 384-well array tape, DNA sample plate, and KASP genotyping mixture into the machine. Operate the machine to automatically dispense the DNA sample diluent and KASP genotyping mixture into the 384-well array tape and seal the membrane.

[0049] 4. Perform PCR cycling. PCR can be performed in the IntelliQube machine in SNP genotyping inline mode (single membrane) or in the Hydrocycler machine in SNP genotyping outline mode (multiple membranes) for water bath PCR. The program settings are as follows: 1. Pre-denaturation: 94℃, 15 min, 1 cycle; 2. Denaturation: 94℃, 20 sec; Annealing / Extension: 61-55℃, 60 sec (-0.6℃ / cycle); Step 2: 10 cycles; 3. Denaturation: 94℃, 20 sec; Annealing / Extension: 55℃, 60 sec; Step 3: 26 cycles.

[0050] 5. Fluorescence data reading and analysis. After the PCR reaction, fluorescence data were read and analyzed using an IntelliQube instrument. Fluorescence excitation FAM: 485 nm, emission: 520 nm; HEX excitation: 535 nm, emission: 556 nm; ROX excitation: 575 nm, emission: 610 nm.

[0051] 6. Add cycles. If the fluorescence signal is low and the clusters are scattered, fluorescence readings can be performed after adding cycles. The conditions for adding cycles are as follows: denaturation: 94℃, 20 sec; annealing / extension: 57℃, 60 sec, 3 cycles.

[0052] KASP typing results:

[0053] First, the primers and methods described above can detect the presence of major QTL sites associated with purple leaves in common Chinese cabbage, and simultaneously detect the polymorphism type of the marker. The marker type is consistent with the corresponding plant color phenotype. By predicting the leaf color of common Chinese cabbage through the marker type, molecular marker-assisted selection for the purple leaf trait in common Chinese cabbage can be achieved (see [link to relevant documentation]). Figure 1 ).

[0054] Example 3 Compliance Verification

[0055] Using this molecular marker for prediction, the 60 F2 plants were divided into three genotypes: 17 were CC type, all with purple leaves, and their genotype was identical to the purple-leaved parent "B1204"; 8 were AA type, all with green leaves, and their genotype was identical to the green-leaved parent "524"; and 19 were AC heterozygous, exhibiting purple leaves. Analysis showed that individuals of the CC and TC genotypes were all purple-leaved, while those of the TT genotype were green-leaved.

[0056] Therefore, by comparing the phenotypic results of plant color and the KASP typing test results, it was demonstrated that the SNP marker at nucleotide 35,836,974 on chromosome 3 is closely linked to the purple leaf trait of common Chinese cabbage and can be used to detect differences in leaf color in common Chinese cabbage (see [link]). Figure 2 ).

[0057] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer set for specifically detecting a molecular marker of Brassica campestris L. var. purpurea leaf, characterized in that, The primer set described above is used in the KASP reaction, and the sequence of the primer set is as follows: Forward primer 1, F-1: ACGATCTCCCTCTTGCCCTTC (SEQ ID NO:2); Forward primer 2, F-2: ACGATCTCCCTCTTGCCCTTA (SEQ ID NO:3); Reverse primer, R: GCGAGATGTTGGAGCGAGCTGCG (SEQ ID NO:4); The nucleic acid sequence of the molecular marker is shown in SEQ ID NO:

1.

2. A method for specifically detecting molecular markers in purple leaves of common Chinese cabbage, wherein the method comprises amplifying the genome of common Chinese cabbage using the primer set described in claim 1 and the KASP method.

3. The method of claim 2, wherein, The KASP method specifically involves using the extracted plant genome as a template and performing a KASP-based reaction using the high-throughput IntelliQube genotyping platform. The KASP reaction system comprises a KASP primer mixture, a KASP master mixture, and a DNA template.

4. The method according to claim 3, wherein the KASP primer mixture comprises two allele-specific forward primers and one common reverse primer; the KASP master mixture comprises an oligosequence labeled with FAM at the F-1 tail, an oligosequence labeled with HEX at the F-2 tail, FAM dye, HEX dye, and a quencher; and the DNA template is common Chinese cabbage genomic DNA.

5. The method according to claim 3 or 4, wherein the specific operation of KASP is as follows: 1) Aliquot the DNA samples into 96-well PCR plates. 2) Prepare KASP genotyping mixture 3) Add the KASP genotyping mixture to the array tape membrane containing the DNA template; 4) Perform PCR cycling reaction; 5) Data reading and analysis.

6. The method of claim 5, wherein, If the fluorescence signal of the data is low and the clusters are scattered, repeat the cycle and then read the fluorescence.

7. A method for assisting in the breeding of common Chinese cabbage, wherein the method involves using the primer set described in claim 1 or the method described in any one of claims 2-6 to detect the genotype of common Chinese cabbage, and detecting the molecular marker described in claim 1, wherein when the SNP genotype is CC or AC, it is a purple leaf phenotype, and when it is AA, it is a green leaf phenotype.

8. A method for detecting the color phenotype of common Chinese cabbage leaves, wherein the method comprises detecting the genome of common Chinese cabbage using the primer set described in claim 1 or the method described in any one of claims 2-6, detecting the molecular marker described in claim 1, wherein when the SNP genotype is CC or AC, it is a purple-leaved plant, and when it is AA, it is a green-leaved plant.

Citation Information

Patent Citations

  • SNP molecular marker related to flower color traits of Chinese cabbages as well as detection primer, detection kit and application of SNP molecular marker

    CN112646917A

  • SNP (Single Nucleotide Polymorphism) site related to green-keeping property of Chinese cabbage and application of SNP site

    CN114164294A