Application of GPAAV-CBA-H_TP53(P53)-WPRE plasmid

Abstract

The application of the GPAAV‑CBA‑H_TP53(P53)‑WPRE plasmid of the present invention belongs to the field of genetic engineering technology. The application of the GPAAV‑CBA‑H_TP53(P53)‑WPRE plasmid in the preparation of hypoglycemic drugs. The plasmid has the effect of lowering blood sugar in immunodeficient subjects, but has no effect on non-immunodeficient subjects. The immunodeficiency type is a thymus-deficient type. The present invention has the following advantages: the adeno-associated virus packaged with the GPAAV‑CBA‑H_TP53(P53)‑WPRE plasmid has the effect of lowering blood sugar in immunodeficient subjects, but has no effect on non-immunodeficient subjects, and the hypoglycemic effect of the adeno-associated virus packaged with the plasmid is correlated with the immunodeficiency of the subject.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to the application of GPAAV-CBA-H_TP53 (P53)-WPRE plasmid. Background Art

[0002] The p53 gene is a major member of the tumor suppressor gene family and is the gene with the highest correlation with human tumorigenesis. The wild-type p53 gene plays an important role in maintaining normal cell growth and preventing and inhibiting the occurrence and proliferation of malignant tumor cells. Various factors in the environment, such as ultraviolet rays, radiation, chemicals, and certain metabolites produced by the body itself, can cause cell DNA damage. Under normal physiological conditions, these cell DNA can be repaired or degraded and removed under the action of certain gene products to prevent it from being inherited and maintain the replication of normal DNA, thereby protecting the normal function of the cell. Otherwise, the damaged DNA will continue to replicate and separate with the chromosomes, resulting in a large number of DNA mutations and chromosomal aberrations in the chromosome set. The further accumulation of these mutations will eventually cause normal cells to deteriorate and develop into cancer cells.

[0003] Currently, most of the research on the p53 gene focuses on tumor suppression, and there are few studies on whether the p53 gene has other functions.

[0004] Diabetes is a syndrome of metabolic disorders of sugar, protein, fat, water and electrolytes caused by various pathogenic factors such as genetic factors, immune dysfunction, microbial infection and its toxins, free radical toxins, mental factors, etc., which lead to islet dysfunction and insulin resistance. It is characterized by high blood sugar. Typical cases may show polyuria, polydipsia, polyphagia and weight loss, i.e., "three mores and one less". At present, some studies have clearly shown that the onset of diabetes is indeed related to the presence of susceptible genes or defective genes in the body.

[0005] The blood sugar control drugs currently on the market mainly include the following categories:

[0006] 1. Metformin, which is the first choice drug recommended by the guidelines, can effectively inhibit liver glycogen production and improve muscle fat sensitivity to insulin.

[0007] 2. α-glucosidase inhibitors. Representative drugs include acarbose. It is mainly used to lower blood sugar 2 hours after a meal. Some patients will experience gastrointestinal reactions.

[0008] 3. Sulfonylurea hypoglycemic drugs, such as gliclazide, glimepiride, and gliquidone, mainly promote insulin secretion.

[0009] 4. DPP-4 inhibitors can provide blood sugar-dependent hypoglycemic treatment with good safety and no obvious side effects.

[0010] 5. SGLT-2 inhibitors lower blood sugar by increasing renal sugar excretion and have a protective effect on both the heart and kidneys.

[0011] 6. GLP-1 receptor agonists can control blood sugar by suppressing appetite and delaying gastric emptying, and also have a significant effect on reducing body weight.

[0012] 7. Insulin can simulate insulin secretion in the body and lower blood sugar. It can effectively lower blood sugar for patients with high blood sugar. It can be used for patients with acute complications of diabetes and liver and kidney dysfunction. Summary of the invention

[0013] In order to provide more choices for diabetic patients in terms of therapeutic drugs, the inventors studied whether the p53 gene can control blood sugar based on the p53 gene therapy for cancer, and also studied the construction of the p53 gene and a new vector.

[0014] The purpose of the present invention is to disclose the use of GPAAV-CBA-H_TP53 (P53)-WPRE plasmid in the preparation of hypoglycemic drugs.

[0015] The objective of the present invention is achieved through the following technical solutions:

[0016] Application of GPAAV-CBA-H_TP53(P53)-WPRE plasmid in the preparation of hypoglycemic drugs.

[0017] The application described in the above technical solution, wherein: the GPAAV-CBA-H_TP53(P53)-WPRE plasmid has the effect of lowering blood sugar in immunodeficient subjects, but has no effect of lowering blood sugar in non-immunodeficient subjects.

[0018] The application described in the above technical solution, wherein: the immunodeficiency type is a thymus deficiency type.

[0019] The application described in the above technical solution, wherein: the hypoglycemic drug is an adeno-associated virus packaged with the GPAAV-CBA-H_TP53(P53)-WPRE plasmid.

[0020] The application described in the above technical solution, wherein: the adeno-associated virus after packaging the GPAAV-CBA-H_TP53(P53)-WPRE plasmid has the effect of lowering blood sugar in immunodeficient subjects, but has no effect of lowering blood sugar in non-immunodeficient subjects.

[0021] The application described in the above technical solution, wherein: the immunodeficiency type is a thymus deficiency type.

[0022] The present invention has the following beneficial effects:

[0023] The adeno-associated virus packaged with the GPAAV-CBA-H_TP53(P53)-WPRE plasmid has the effect of lowering blood sugar in immunodeficient subjects, but has no effect on non-immunodeficient subjects; the blood sugar lowering effect of the adeno-associated virus packaged with the GPAAV-CBA-H_TP53(P53)-WPRE plasmid is correlated with the immunodeficiency of the subject. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] 1. Figure 1 This is a map of the expression vector GPAAV-CBA-MCS-WPRE.

[0025] 2. Figure 2 This is the map of GPAAV-CBA-H_TP53(P53)-WPRE plasmid. DETAILED DESCRIPTION

[0026] To facilitate the understanding of the technical solution of the present invention, the present invention is further described below in conjunction with specific embodiments.

[0027] Example 1: Preparation of GpAAV-CBA-H_TP53(P53)-WPRE plasmid:

[0028] 1. Experimental Materials and Methods

[0029] 1. Materials:

[0030] 1. Vector information: The expression vector GPAAV-CBA-MCS-WPRE was purchased from "Jiman Biotechnology (Shanghai) Co., Ltd.". The map is as follows Figure 1 As shown;

[0031] 2. Reagents: The reagents used in this example are shown in Table 1:

[0032] Table 1 Reagents and sources

[0033]

[0034] 3. Instruments: The instruments used in this embodiment are shown in Table 2:

[0035] Table 2 Instruments and sources

[0036]

[0037]

[0038] (II) Methods:

[0039] 1. Double enzyme digestion of vector:

[0040] (1) Cultivate the bacterial solution containing the expression vector GPAAV-CBA-MCS-WPRE plasmid overnight, and extract the plasmid using 3-5 ml of fresh bacterial solution. For specific methods, refer to the QIAGEN plasmid extract instructions.

[0041] (2) Take 1 μg of fresh plasmid and perform double digestion with corresponding restriction endonucleases at 37°C for about 3 h. The enzyme digestion system is shown in Table 3:

[0042] Table 3 Enzyme digestion system

[0043] vector 1 μg green Buffer 3 μL MluI 1.5 μL BamHI 1.5 μL <![CDATA[ddH2O]]> Make up to 30 μL

[0044] (3) Perform agarose gel electrophoresis on the digested product. After the electrophoresis, perform gel recovery as follows: Under ultraviolet light, cut the gel strip containing the target fragment. Use a balance to weigh the total weight and subtract the weight of the empty tube to calculate the weight of the gel. Calculate the volume of the gel according to 100 mg = 100 μL, and add 1 times the volume of the gel to the Binging Solution and place it in a 65°C water bath to completely melt the gel. Shake the EP tube appropriately during this period to accelerate the dissolution of the gel.

[0045] (4) Transfer all the above liquids to the filter column and centrifuge at 13,000 rpm for 30 seconds (can be repeated once). Then discard the liquid in the tube, add 500μL of WASolution to the column, and centrifuge at 13,000 rpm for 30 seconds. Discard the liquid in the tube, add 500μL of Wash Solution to the column, and centrifuge at 13,000 rpm for 30 seconds (can be repeated once). Then leave it empty for 3 minutes. Place the filter column in a new 1.5mL EP tube and dry it at room temperature. Finally, add 35μL of ddH2O to the column, let it stand for 5 minutes, and centrifuge at 13,000 rpm for 1.5 minutes. In order to improve the recovery rate, the dissolved DNA can be added to the column again and centrifuged for one minute. Discard the column to obtain the recovered expression vector fragment, and measure the concentration.

[0046] 2. Preparation of target gene fragments:

[0047] 2.1. Design and synthesize primers:

[0048] (1) Determine that the vector used is the expression vector GPAAV-CBA-MCS-WPRE;

[0049] (2) Design PCR amplification primers based on Gene ID: 7157, and introduce homologous sequences at the ends of the linearized expression vector (the fragment of the expression vector after double enzyme digestion) at the 5' end of the primer, so that the 5' and 3' end sequences of the amplified product are completely consistent with the two end sequences of the linearized expression vector.

[0050] (3) Send the designed primer sequences (as shown in Table 4) to the Bioengineering Institute for synthesis.

[0051] Table 4 Primer sequences

[0052] Primer name Primer sequence 5’ to 3’ Primer-F CCGCAGCCAGCCATGGCCACCATGGAGGAGCCGC Primer-R GTAATCCAGAGGTTGATTTCAGTCTGAGTCAGGCCCTTCTGTCTTG

[0053] 2.2. Preparation of templates required for amplification of target gene fragments:

[0054] The primer sequences used in primer overlap PCR are shown in Table 5:

[0055] Table 5 Primer sequences (5'-3')

[0056] P1 ATGGAGGAGCCGCAGTC P2 CTGAAAATGTTTCCTGACTCAGAGGGGGCTCGACGCTAGGATCTGACTGCGGCTCCTCCA P3 TCTGAGTCAGGAAACATTTTCAGACCTATGGAAACTACTTCCTGAAAACAACGTTCTGTC P4 ACAGCATCAAATCATCCATTGCTTGGGACGGCAAGGGGGACAGAACGTTGTTTTCAGGAA P5 GCAATGGATGATTTGATGCTGTCCCCGGACGATATTGAACAATGGTTCACTGAAGACCCA P6 GGGAGCAGCCTCTGGCATTCTGGGAGCTTCATCTGGACCTGGGTCTTCAGTGAACCATTG P7 GCCAGAGGCTGCTCCCCCCGTGGCCCCTGCACCAGCAGCTCCTACACCGGCGGCCCCTGC P8 TTTTCTGGGAAGGGACAGAAGATGACAGGGGCCAGGAGGGGGCTGGTGCAGGGGCCGCCG P9 CTTCTGTCCCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTTGC P10 GCAGGGGAGTACGTGCAAGTCACAGACTTGGCTGTCCCAGAATGCAAGAAGCCCAGACGG P11 TGCACGTACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTG P12 GACGCGGGTGCCGGGCGGGGGTGTGGAATCAACCCACAGCTGCACAGGGCAGGTCTTGGC P13 CCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTG P14 ATCGCTATCTGAGCAGCGCTCATGGTGGGGGCAGCGCCTCACAACCTCCGTCATGTGCTG P15 CGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAAT P16 GAAAAGTGTTTCTGTCATCCAAATACTCCACACGCAAATTTCCTTCCACTCGGATAAGAT P17 TATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCCTATGAGCCGCCTGAG P18 ACACATGTAGTTGTAGTGGATGGTGGTACAGTCAGAGCCAACCTCAGGCGGCTCATAGGG P19 CCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCA P20 AGTAGATTACCACTGGAGTCTTCCAGTGTGATGATGGTGAGGATGGGCCTCCGGTTCATG P21 GAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTTGAGGTGCGTGTTTGTGCCTGT P22 CTTGCGGAGATTCTCTTCCTCTGTGCGCCGGTCTCTCCCAGGACAGGCACAAACACGCAC P23 GAGGAAGAGAATCTCCGCAAGAAAGGGGAGCCTCACCACGAGCTGCCCCCAGGGAGCACT P24 TTTGGCTGGGGAGAGGAGCTGGTGTTGTTGGGCAGTGCTCGCTTAGTGCTCCCTGGGGGC P25 CTCCTCTCCCCAGCCAAAGAAGAAACCACTGGATGGAGAATATTTCACCCTTCAGATCCG P26 ATTCAGCTCTCGGAACATCTCGAAGCGCTCACGCCCACGGATCTGAAGGGTGAAATATTC P27 GAGATGTTCCGAGAGCTGAATGAGGCCTTGGAACTCAAGGATGCCCAGGCTGGGAAGGAG P28 TTTTGGACTTCAGGTGGCTGGAGTGAGCCCTGCTCCCCCCTGGCTCCTTCCCAGCCTGGG P29 CAGCCACCTGAAGTCCAAAAAGGGTCAGTCTACCTCCCGCCATAAAAAACTCATGTTCAA P30 GTCTGAGTCAGGCCCTTCTGTCTTGAACATGAGTTTTTTATGGCG

[0057] (1) Primer overlapping PCR steps:

[0058] (1.1) Step 1 PCR:

[0059] Primers with complementary ends were used to form overlapping chains in the PCR products, so that template-free amplification was performed by extending the overlapping chains in the subsequent amplification reaction; the reaction system for the PCR reaction corresponding to the preparation of p53-I, p53-II and p53-III is shown in Table 6, and the PCR reaction program for the preparation of p53-I, p53-II and p53-III is shown in Table 7:

[0060] Table 6 PCR reaction system

[0061]

[0062] Table 7 PCR reaction program

[0063]

[0064] (1.2), Step 2 PCR:

[0065] The reaction system was prepared with the products of Step 1 PCR reaction (p53-I, p53-II and p53-III) as the total template, and PCR was performed after sufficient mixing and instant centrifugation to obtain the template (p53) required for amplification of the target gene fragment; the reaction system is shown in Table 8 and the reaction procedure is shown in Table 9:

[0066] Table 8 PCR reaction system

[0067]

[0068] Table 9 PCR reaction program

[0069]

[0070]

[0071] (2) After the primer overlapping PCR machine is off, the synthetic fragment of 1179 bp is obtained, which is the template required for amplification of the target gene fragment.

[0072] 2.3. Amplification of target gene fragments:

[0073] (1) Dilute the primers synthesized in step 2.1 to a stock solution with a final concentration of 10 μmol / L.

[0074] (2) Using the product of the primer overlap PCR in step 2.2 as a template, PCR amplification is performed using the diluted primers and template. The PCR amplification system is shown in Table 10:

[0075] Table 10 PCR amplification system

[0076] Template 1 - 2 μg Primer - F 2 μL Primer - R 2 μL PCR mix 25 μL ddH2O Make up to 50 μL

[0077] Add the above materials into a thin-walled tube, mix well, and place it into a PCR instrument after tapping. Set the denaturation temperature to 95°C, the annealing temperature to 72°C, and the extension temperature to 56°C to start PCR amplification.

[0078] (3) After PCR, perform agarose gel electrophoresis and recover the target gene fragment using the same method as above.

[0079] 3. Connection between expression vector fragment and target gene fragment (seamless cloning):

[0080] (1) Determine the concentration of the recovered expression vector fragment and target gene fragment;

[0081] (2) The optimal amount of cloning vector used in the Hieff CloneTM recombination reaction system is 0.03 pmol; the optimal molar ratio of cloning vector to insert fragment is 1:2, that is, the optimal amount of insert fragment used is 0.06 pmol. The DNA mass corresponding to these molar numbers can be calculated by the following formula:

[0082] Optimal amount of cloning vector used = [0.02 × number of base pairs of cloning vector] ng (0.03 pmol)

[0083] Optimal amount of insert fragment = [0.04 × number of base pairs of insert fragment] ng (0.06 pmol)

[0084] (3) The expression vector fragment (linearized cloning vector) and the target gene fragment (insert fragment amplification product) were connected at 50° C. for 20 min in the connection system shown in Table 11;

[0085] Table 11 Connection system

[0086]

[0087] 4. Conversion:

[0088] (1) Place competent E. coli DH5α or E. coli JM109 cells on ice (4°C) and wait for them to thaw naturally. Then, take 10 μl of the ligation product from step 3 and add it to competent E. coli DH5α or E. coli JM109 cells and place on ice (4°C) for 30 min.

[0089] (2) Heat shock in a 42°C water bath for 90 seconds and then quickly place on ice (4°C) for 2-3 minutes.

[0090] (3) Add 500 μL of SOC culture medium without antibiotics and culture at 37°C with shaking at 225 rpm for 45 min.

[0091] (4) Centrifuge at 3000 rpm for 2 min, discard 900 μL of the supernatant, blow off the bacterial solution at the bottom of the tube, add it to the culture plate containing the corresponding resistance (ampicillin or kanamycin, etc.) on the carrier, spread it evenly with a sterile spreader (the temperature of the spreader should not be too high to avoid scalding the bacteria), and invert it in a 37°C constant temperature incubator for overnight culture.

[0092] 5. Send for testing:

[0093] Two clones were selected from each group and sent to a sequencing company for sequencing identification.

[0094] 2. Experimental results:

[0095] The sequencing result of the constructed GPAAV-CBA-H_TP53(P53)-WPRE plasmid is shown in SEQ ID NO.1, and its map is shown in Figure 2 shown.

[0096] Embodiment 2: AAV-P53 was obtained by production and packaging of adeno-associated virus:

[0097] (I) Extraction of recombinant plasmid GPAAV-CBA-H_TP53(P53)-WPRE:

[0098] The plasmid DNA used for virus packaging needs to be of high quality and purity. The plasmid was extracted from the clone obtained in step 4 of Example 1 using Qiagen's plasmid extraction kit, and the plasmid DNA was finally dissolved in TE buffer at pH 7.5.

[0099] (II) 293T cell culture:

[0100] 1. Recovery of frozen 293T cells:

[0101] (1) Add 10 ml of DMEM growth medium into a 15 ml conical bottom tube;

[0102] (2) Place the cell cryopreservation tube stored at -80℃ in a 37℃ water bath and gently shake for 1-2 minutes to thaw it. Take out the cryopreservation tube from the water bath and disinfect it by wiping the surface of the tube with 75% ethanol (room temperature). Note that only the tube body should be placed in the water bath, and the tube cap should not be immersed together, otherwise the water in the water bath will be sucked into the cryopreservation tube;

[0103] (3) Transfer the thawed cell suspension to the conical tube prepared in the first step;

[0104] (4) Centrifuge at 200g for 3 minutes at room temperature to pellet the cells. Discard the supernatant.

[0105] (5) Add 5 ml of fresh growth medium to the conical tube and gently pipette up and down to suspend the cells. At this time, the cells have just recovered and are relatively fragile, so it is better to suspend the cells when pipetting and avoid excessive pipetting;

[0106] (6) Move 5 ml of cell suspension to 75 cm 2 Place the cells in a 37°C, 5% CO2 incubator.

[0107] (7) Monitor cell density every day. When the cells reach 50% confluence, subculture them. Then subculture 293T cells.

[0108] 2. Passaging of 293T cells:

[0109] (1) Preheat DMEM complete medium and trypsin-EDTA solution in a 37°C water bath;

[0110] (2) Remove the growth medium and wash the cells once with 10 ml of PBS (phosphate-buffered saline);

[0111] (3) Digest the cells with 5 ml of trypsin-EDTA solution for 1-3 minutes; (Note: The digestion time with trypsin-EDTA solution should be the shortest time required to make the adherent cells fall off the culture flask. This process can be observed using an inverted microscope. Over-digestion will damage or kill the cells.)

[0112] (4) Dilute the cells with 5 ml of culture medium to inactivate trypsin, and transfer the cell suspension to a 15 ml conical-bottom tube;

[0113] (5) Centrifuge at 200 g for 3 minutes at room temperature to pellet the cells and discard the supernatant.

[0114] (6) Resuspend the cell pellet in 10 ml of culture medium and transfer 2 ml of the cell suspension to each 75 cm 2 5 cell culture bottles in total. Each bottle contains 28 ml of growth medium. Place the cells in a 37°C, 5% CO2 incubator. Check the cell density every day and keep the cell confluence below 50%.

[0115] (III) Adeno-associated virus production and packaging:

[0116] 1. Preparation of 293T cells:

[0117] Add 10 ml of DMEM growth medium to a 10 cm culture dish and add 3 × 10 6 293T cells, shake well, and culture for 48 hours before transfection. (Note: In order to obtain higher titers, the health of 293T cells and the density of subculture are very important factors. Subculture is required when the cell confluence reaches 50%. And freeze in large quantities when the cells are at a low generation and growing healthily. Avoid cell clumping when subculturing and plating for transfection. Cells may grow to a higher confluence before transfection with plasmids.)

[0118] 2. Transfection of 293T cells:

[0119] (1) Before transfection, check the host cells passaged two days ago. They should reach 70-80% confluence.

[0120] (2) Take out the required plasmids and reagents from the refrigerator and cool them to room temperature;

[0121] (3) Calculate the required transfection system and plasmid dosage according to the number of packaging plates, dilute the plasmid according to the kit requirements, add the transfection reagent, mix gently, and let stand for 20 minutes;

[0122] (4) Aspirate and discard the culture medium of the cells to be transfected, replace it with DMEM containing 5% FBS, add the DNA-transfection reagent mixed solution to the cells, and gently shake the cell culture plate;

[0123] (5) Return the cell culture dish to the 37°C incubator for 12 hours;

[0124] (6) After 12 hours, replace with fresh 5% FBS DMEM and culture for another 60 hours.

[0125] 3. Collection of Adeno-associated Virus:

[0126] The transfected cell supernatant (i.e., virus solution) was collected and centrifuged, and then filtered through a 0.45 μm filter to remove cell debris.

[0127] 4. Purification and packaging of adeno-associated virus:

[0128] (1) The filtered virus solution was precipitated with PEG6000 solution at 4°C for more than 3 h.

[0129] (2) After virus precipitation, centrifuge the virus solution at 4000 rpm, 4°C, for 20 min, and resuspend the precipitate in Opti-MEM.

[0130] (3) Ultracentrifuge the virus resuspension at 27,000 rpm, 4°C, for 90 min.

[0131] (4) After ultracentrifugation, the virus was resuspended and placed in an ultrafiltration tube for ultrafiltration at 4000 rpm, 4°C, for 20 min.

[0132] (5) Sterilize and filter the virus, package it, and store it at -80℃.

[0133] The following specific experimental examples are used to illustrate the beneficial effects of the GPAAV-CBA-H_TP53 (P53)-WPRE plasmid of the present invention in controlling blood sugar:

[0134] The AAV-P53 used in the following experimental examples was prepared in Example 1 and Example 2.

[0135] Experimental Example 1: Sugar control experiment:

[0136] Experiments on the different blood sugar control effects of AAV-P53 in nude mice and GK mice:

[0137] 20 nude mice, with a body weight range of 20-25 g / mouse, were grouped as shown in Table 12:

[0138] Table 12 Grouping of 20 nude mice

[0139] Nu1 group 5 Do nothing Nu2 Group 5 1.0 mL via tail vein Nu3 group 5 0.1 mL was administered into the tail vein Nu4 group 5 0.3 mL was administered into the tail vein

[0140] There were 16 GK rats, with a body weight range of 240-260 g / rat, and the groups were shown in Table 13:

[0141] Table 13 Grouping of 16 GK rats

[0142] GK1 Group 8 Do nothing Gk2 Group 8 4.0 mL was administered into the tail vein Gk3 Group 8 Tail vein rapid-acting insulin injection 30 units / animal

[0143] Blood sugar was recorded before administration, and tail vein blood sugar of the test animals was tested starting from the 7th day after administration. In the Nu2 group, 1.0 mL was administered, and the blood sugar dropped too sharply after 7 days, reaching the limit of mouse hypoglycemia, and the animals withdrew from the experiment.

[0144] The blood glucose records of animals are shown in Table 14 (mean ± standard deviation). Compared with the control group, the blood glucose levels of the 0.1 mL group and the 0.3 mL and 1.0 mL groups decreased significantly, and showed a dose-effect relationship, indicating that AAV-P53 has the effect of lowering blood glucose in nude mice; in GK mice, no difference in blood glucose was observed, suggesting that AAV-P53 has no effect on the blood glucose of GK mice.

[0145] Table 14 Changes in blood glucose in Nu mice and GK mice after AAV-P53 injection

[0146]

[0147] In GK mice, rapid-acting insulin was injected via the tail vein, and the blood sugar changes were shown in Table 15. From the data in Table 10, it can be observed that the blood sugar of GK mice decreased, indicating that the hyperglycemia of GK rats can be controlled by insulin, but is not affected by AAV-P53.

[0148] Table 15 Changes of blood glucose in GK mice injected with insulin via tail vein

[0149]

[0150] Nude mice are thymus-deficient mice, and GK mice are inbred spontaneous diabetes model mice among Wistar rats. It can be seen that the hypoglycemic effect of AAV-P53 is related to the immune deficiency of the target, and its hypoglycemic effect is selective.

[0151] The above description is only a preferred embodiment of the present invention and does not impose any formal or substantial limitation on the present invention. Any technician familiar with the profession can make use of the technical contents disclosed above without departing from the scope of the technical solution of the present invention, and any slight changes, modifications and evolutions made by equivalent changes are all equivalent embodiments of the present invention; at the same time, any changes, modifications and evolutions of any equivalent changes made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. Use of the GPAAV-CBA-H_TP53(P53)-WPRE plasmid in the preparation of a hypoglycemic drug having a blood sugar lowering effect on an immunodeficient subject, wherein the immunodeficiency is a thymus-deficient subject.

2. The use according to claim 1, characterized in that: The hypoglycemic drug is an adeno-associated virus packaged with the GPAAV-CBA-H_TP53 (P53)-WPRE plasmid.

Images