The gene of the antimicrobial peptide Oftermicin1 from Coptotermes obesus and its application

Abstract

The invention discloses a targeted silencing black-winged termite antibacterial peptide Oftermicin1 dsRNA of the gene and its application in termite control. Among them, black-winged termite Oftermicin1 The nucleotide sequence of the gene is SEQ ID NO: 1. The present invention is based on antimicrobial peptides Oftermicin1 We designed dsRNA and established a feeding method for the black-winged termite Oftermicin1 RNA interference system, and concluded that feeding had a significant gene silencing effect in black-winged termites. Oftermicin1 RNAi technology application provides technical support. In addition, this patent uses the established black-winged termite Oftermicin1 The RNA interference system Oftermicin1 The combination of dsRNA and biocontrol bacteria can significantly improve the control effect of biocontrol bacteria. The present invention lays a theoretical foundation for the development of immunosuppressants that are safe for humans and animals, and provides a new theory for biological control of pests, ultimately providing new strategies and new ways of pest control for my country's green agricultural production and sustainable development.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an antibacterial peptide of black-winged termites. Oftermicin1 Genes and their applications. Background Art

[0002] Termites are one of the most famous pests in the world. They are social insects with strong reproductive and survival abilities. They mainly harm buildings, agricultural and forestry crops, reservoir dams, cable bridges, transportation facilities, etc. They also often damage non-cellulose materials. Odontotermes formosanus Shiraki is a higher termite, a type of soil termite. It spends most of its time underground, mainly using worker ants to harm the bark and shallow wood layer, as well as the roots, causing large ant trails to form outside the damaged tree trunks, and causing the growth to decline. When invading the wood, the trunks wither; especially for seedlings, it is very easy to cause death. When feeding and damaging, mud blankets and mud lines are formed. In severe cases, the mud blanket surrounds the entire trunk to form a mud sheath, which is very characteristic. Black-winged soil termites are the main pests of reservoirs and river dams, and can often cause dam leakage, landslides and breaches (Li Dong et al., 2001; Cai Banghua et al., 1965; Xu Zhenhai, 2004; Xu Zhide et al., 2007). Because the nests of black-winged soil termites are very concealed, the damage they cause is not easy to be discovered. When they are discovered, the damage is already very huge. In addition, black-winged termites have a diverse diet and a wide range of damage, and can harm more than 100 species of plants including camphor, fir, magnolia, and maple (Huang Qiuying et al.; 2005).

[0003] At present, the control of black-winged termites still mainly relies on traditional chemical pesticides, but problems such as pesticide residues are becoming increasingly serious, posing a potential threat to human and animal health and the ecological environment. Therefore, it is imperative to discover new biological control methods and explore new strategies for the control of black-winged termites. RNA interference (RNAi) refers to the phenomenon in which double-stranded RNA (ds RNA) induces homologous mRNA degradation in eukaryotic organisms, silencing the expression of target genes. In the study of insect gene function, gene interference is generally carried out by introducing exogenous dsRNA or small interfering RNA (si RNA). RNAi can achieve sustainable control of pest populations by selectively interfering with the expression of key insect genes, and is highly anticipated in the field of pest control. Insect antimicrobial peptides (AMPs) are a class of polypeptide substances with broad-spectrum antimicrobial activity that appear in the hemolymph of insects when they are exposed to external stimuli or microbial infections. They are usually composed of 10-50 amino acid residues, often positively charged, amphiphilic, cationic water-soluble polypeptides, linear or with a ring structure, the ring structure is composed of one or more pairs of semi-peptide residues connected. In holometabolous insects, antimicrobial peptides are rapidly synthesized by the fat body and various epithelial cells and secreted into the hemolymph, while in non-holometabolous insects, antimicrobial peptides are first synthesized in healthy insect blood cells and secreted into the hemolymph after stimulation or infection. Silencing this gene can reduce the ability of termites to resist infection by pathogenic microorganisms and eventually lead to their death. Therefore, it is expected that dsRNA can be designed for termite control by targeting antimicrobial peptide genes through RNA interference technology. Summary of the invention

[0004] The object of the present invention is to provide a method for Oftermicin1 The application of dsRNA of genes in termite control. Among them, black-winged termites Oftermicin1 The gene was first discovered by the applicant. Based on the gene, dsRNA is designed and introduced into termites, which can effectively prevent and control black-winged termites.

[0005] Specifically, the present invention proposes a black-winged termite antimicrobial peptide Oftermicin1 Gene, the Oftermicin1 The nucleotide sequence of the gene is shown in SEQ ID NO: 1. The corresponding amino acid sequence is shown in SEQ ID NO: 2.

[0006] The present invention further proposes Oftermicin1 The application of genes in termite control.

[0007] At the same time, the present invention proposes a method for preventing and controlling termites. Oftermicin1The dsRNA is transcribed from the nucleotide sequence shown in SEQ ID NO:1.

[0008] The present invention also provides the encoding right above Oftermicin1 dsRNA DNA.

[0009] Furthermore, the present invention provides a recombinant expression vector comprising the above-mentioned DNA encoding dsRNA.

[0010] The present invention also provides a host bacterium for transforming the recombinant expression vector.

[0011] In another aspect, the present invention provides a method for controlling termites, comprising the following steps:

[0012] Can be used Oftermicin1 The dsRNA and Serratia marcescens SM1 are fed to termites together, wherein the dsRNA is transcribed from the nucleotide sequence shown in SEQ ID NO: 1.

[0013] Beneficial effect: The present invention is based on immune recognition protein Oftermicin1 The dsRNA was designed by gene, and the feeding method was established to kill black-winged termites Oftermicin1 RNA interference system, and concluded that feeding had a significant gene silencing effect in black-winged termites. Oftermicin1 The application of RNAi technology provides a theoretical basis. At the same time, by using the HT115 strain to construct a dsRNA expression system, the interference cost is reduced. The present invention successfully interferes with the immune recognition protein using this system. Oftermicin1 Gene expression and found Oftermicin1 The gene-silenced black-winged termites were significantly more sensitive to the SM1 strain of Serratia marcescens. Oftermicin1 When dsRNA and SM1 were used simultaneously, the mortality rate of termites was significantly increased, indicating that it can improve the control effect of biocontrol bacteria. Oftermicin1 It provides a theoretical basis for the application of dsRNA in termite control. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is the electrophoresis diagram of total RNA of Coptotermes nigropteroides;

[0015] Figure 2 for Oftermicin1 The cloned sequence and deduced amino acid sequence of

[0016] Figure 3 Treating black-winged termites with Serratia marcescens Oftermicin1 Expression level;

[0017] Figure 4 For L4440-ds Oftermicin1 and L4440-ds GFP The electrophoresis results of the recombinant plasmid, where 1 is L4440-ds GFP , 2 is L4440-ds Oftermicin1 ;

[0018] Figure 5 is the result of dsRNA electrophoresis, where 1 is ds GFP , 2 is ds OfOftermicin1 ;

[0019] Figure 6 is the relative expression level of the target gene 6 h after dsRNA feeding, where: Note: Different lowercase letters indicate significant differences among treatments;

[0020] Figure 7 is the survival analysis after 6 h of dsRNA treatment, where ABCDE are 14, 24, 34, 44, and 54 h, respectively; F is the survival analysis graph, and the dotted line is the time of SM1 treatment. DETAILED DESCRIPTION

[0021] The experimental methods used in the following examples are conventional methods unless otherwise specified, and the materials and reagents used are commercially available unless otherwise specified.

[0022] Experimental materials and methods involved in the examples:

[0023] (1) Test insects: Black-winged termites were collected from Jurong City, Jiangsu Province. After the ant nests were collected, they were placed in an insect incubator at 27°C in the dark for breeding.

[0024] (2) Cultivation of Serratia marcescens SM1

[0025] Culture medium: Bacterial basal medium (g / L): peptone 10 g, beef extract 20 g, NaCl 2 g, K2HPO42 g, agar 18 g pH 7.2~7.4.

[0026] Bacterial seed medium (g / L): peptone 10 g, yeast extract 20 g, NaCl 2 g, K2HPO4 2 g.

[0027] Bacterial fermentation medium (g / L): peptone 10 g, soybean oil 30 g, NaCl 2 g, K2HPO4 2 g.

[0028] The isolated Serratia marcescens strain SM1 was transferred to the bacterial basal medium, cultured in the dark at 27°C for 24 hours, and a single colony was obtained after streaking. A single colony was taken out and placed in a sterilized 250mL conical flask containing 50mL seed culture medium, and cultured in a constant temperature shaker at 30°C and 200r / min for 12 hours for seed liquid culture. Then 70ml of the cultured seed liquid was added to 250ml of fermentation medium, and cultured in a shaking incubator at a speed of 200r / min at a temperature of 30°C for 36 hours, and taken out for use after culture.

[0029] (3) Determination of the concentration of Serratia marcescens SM1 fermentation broth

[0030] Within a certain range, as the number of bacteria in the fermentation broth of Serratia marcescens SM1 increased, its OD 600 The value of also increases.

[0031] The present invention is further described in detail below in conjunction with specific embodiments. The embodiments will help to understand the present invention, but the protection scope of the present invention is not limited to the following embodiments.

[0032] Example 1 Oftermicin1 Gene cloning

[0033] (1) Primer design: Based on transcriptome data Oftermicin1 Primers were designed using Primer5 software:

[0034] Oftermicin1 F:ACAATGAGGACTGTCGCTAT;

[0035] Oftermicin1 R: CGTATGGTCATTGGCTTG.

[0036] (2) cDNA amplification and TA cloning:

[0037] The total RNA of termites was extracted by Trizol method.

[0038] The total RNA extraction results of black-winged termites (such as Figure 1 ). The nucleic acid detector detects the OD of RNA 260 / OD 280 The ratio is 1.855, which is between 1.8 and 2.0, indicating that the RNA quality is acceptable and the next step of the experiment can be carried out.

[0039] Total RNA was used as a template and reverse transcription was performed according to the instructions of First Strand cDNA Synthesis Kit of TaKaRa Company to synthesize cDNA. The reverse transcription system is shown in Table 1.

[0040] Table 1

[0041]

[0042] Using cDNA as template and primers Oftermicin1 F. Oftermicin1 R, amplified, and obtained a 235 bp fragment, the sequence of which is shown in SEQ ID NO.1. The full-length sequence contains an open reading frame of 186 bp, encoding a 62 amino acid polypeptide, such as Figure 2 The PCR amplification reaction system is shown in Table 2. The PCR amplification reaction conditions are: 94 ℃ pre-denaturation for 3 min; 94 ℃ denaturation for 30 s, 52 ℃ annealing for 30 s, 72 ℃ extension for 30 s, for a total of 35 cycles; 72 ℃ final extension for 10 min. The PCR amplification products were detected by 1% agarose gel electrophoresis and photographed under the gel imaging system. The correct PCR products were purified and recovered by gel recovery kit. The TA cloning conditions are shown in Table 3. The gel recovery products were connected with pClone007 at room temperature for 1-5 min, and the connection products were transformed into E.coli DH5α competent cells. The transformation of the connection products:

[0043] (1) Take out the E. coli DH5α competent cells from the −80°C refrigerator and dissolve them in ice water;

[0044] (2) Use a pipette to add 10 uL of the ligation product to 100 uL of E. coli DH5α competent cells and place on ice for 30 minutes;

[0045] (3) Heat shock in a 42°C water bath for 45 seconds, then immediately place in ice water for 2 minutes;

[0046] (4) Add SOC or LB liquid culture medium and culture at 37°C and 200 rpm for 1 h;

[0047] (5) Spread 200uL of bacterial solution on LB solid medium containing Amp penicillin (final concentration 50μg / mL) and culture inverted in a 37°C incubator overnight.

[0048] The transformation product was cultured in LB (Amp + ) solid medium for 12-16 h. The positive clones were selected and identified by bacterial liquid PCR. The recombinant plasmid containing the correct insertion fragment was named pClone007- Oftermicin1 , sent to the company for sequencing.

[0049] Table 2

[0050]

[0051] Table 3

[0052]

[0053] Example 2 Effect of Serratia marcescens SM1 on black-winged termites Oftermicin1 Inducible expression of

[0054] Toxic experiment: First, filter paper was placed on the bottom of each 6 cm culture dish and moistened with water. Then, 20 black-winged termite workers with good vitality and mature development were placed in the culture dish. The fermentation medium of Serratia marcescens SM1 was used as the control (ck). Each concentration (2.139×10 11 cells / ml, 2.139×10 10 cells / ml, 2.139×10 9 The bacterial solution of 100 cells / ml was dripped on the black-winged termites with a 0.12μL micropipette, and each group was repeated three times. After dripping, it was placed in a dark environment at 25℃ for observation and sampling. The samples were collected at 3, 6, 12, and 24 hours, and stored at -80℃.

[0055] like Figure 3 As shown in the fluorescence quantitative experiment, it was found that the concentration of 2.139×10 9 After treating black-winged termites with SM1 at a concentration of cells / ml, Oftermicin1 At 3h, 6h, 12h and 24h of treatment, the expression of β-catenin was significantly upregulated. 10 After treating black-winged termites with SM1 at a concentration of cells / ml, Oftermicin1 At 3h, 6h, 12h and 24h of treatment, the expression of 11 After treating black-winged termites with SM1 at a concentration of cells / ml, Oftermicin1 The expression level was up-regulated only at 3h and 6h, and was significantly down-regulated at 24h.

[0056] Example 3 Termites Oftermicin1 Synthesis and induction of gene expression by dsRNA

[0057] (1) Termites Oftermicin1 Primer design for dsRNA of genes.

[0058] Prediction by online software Oftermicin1 There are potential RNAi target sites at 150bp~182bp of Oftermicin1 Primers were designed using Primer5 software:

[0059] ds Oftermicin1 F: ATTTGCGGCCGC AGGACTGTCGCTATCCTG;

[0060] ds Oftermicin1 R: CCC AAGCTTT GCCCCCAGTAACATACA,

[0061] And introduce restriction sites NotⅠ and HindⅢ in the upstream and downstream (bold letters are restriction sites, italic letters are protected bases). GFP The primers are:

[0062] dsGFP F: ATCG GAGCTCAGTTGAACGGATCCATCTTCA;

[0063] dsGFP R: CCC AAGCTTAGAACTTTTCACTGGA,

[0064] And the restriction sites (SacI) and HindⅢ were introduced upstream and downstream. All primers were synthesized by Tianjin Qingke Biotechnology Co., Ltd.

[0065] (2) Termites Oftermicin1 Synthesis of dsRNA of genes.

[0066] Using sequencing to Oftermicin1 Full-length plasmid pClone007- Oftermicin1 As a template, the upstream and downstream primers designed for synthesizing dsRNA were used. Oftermicin1 F and ds Oftermicin1 R was used for PCR amplification; the PCR amplification reaction conditions were: 94 ℃ pre-denaturation for 3 min; 94 ℃ denaturation for 30 s, 49 ℃ annealing for 30 s, 72 ℃ extension for 30 s, for a total of 35 cycles; 72 ℃ final extension for 10 min. The PCR amplification products were detected by 1% agarose gel electrophoresis and photographed under a gel imaging system. The correct PCR products were purified and recovered using a gel recovery kit.

[0067] (3) Construction of dsRNA expression vector.

[0068] Using the GFP protein nucleic acid sequence available in the laboratory as a template, a 500 bp fragment was cloned. The target fragment and the L4440 vector were digested and linked, and L4440-ds was successfully constructed. Oftermicin1 and L4440-ds GFP Recombinant plasmid. L4440-ds Oftermicin1 and L4440-ds GFP The results of recombinant plasmid electrophoresis are as follows Figure 4 shown.

[0069] Specifically, L4440-ds Oftermicin1 As an example, the above PCR product was double-digested with NotⅠ and HindⅢ to recover the target fragment; at the same time, the expression vector L4440 was double-digested with these two enzymes to recover the target vector. The target fragment double-digestion system and the vector double-digestion system are shown in Table 4 and Table 5, respectively. The target fragment and the target vector were connected at 16 ℃ for 16 h under the action of T4 DNA ligase. The ligation product was transformed into E. coli DH5α competent cells and cultured in LB (ampicillin and tetracycline double resistance) solid medium for 12 h. After selecting the positive clones and identifying them by enzyme digestion, the recombinant plasmid containing the correct inserted fragment was named L4440-ds Oftermicin1 , sent to the company for sequencing.

[0070] Table 4

[0071]

[0072] Table 5

[0073]

[0074] (4) Induced expression and extraction of dsRNA.

[0075] Containing L4440-ds Oftermicin1 and L4440-ds GFP HT115 strain dsRNA induced expression of recombinant plasmid ( Figure 5 ), the target bands are 183 bp and 500 bp, which are similar to ds Oftermicin1 With ds GFP The expected sizes were consistent, and the interference vector was successfully constructed. Then, the total RNA after induced expression was digested with DNaseⅠ and RNase A.

[0076] L4440-ds Oftermicin1 For example, the sequenced L4440-ds Oftermicin1 The recombinant plasmid was transformed into HT115 (DE3) competent bacteria and spread on a plate containing ampicillin (50 μg∙mL -1 ) and tetracycline (12.5 μg∙mL -1 ) on LB solid medium with dual antibodies and inverted culture at 37 °C overnight. Pick a single clone and inoculate it in a medium containing ampicillin (50 μg∙mL -1 ) and tetracycline (12.5 μg∙mL -1 ) in LB liquid medium with double antibodies, 37 ℃, 220 r∙min -1 The culture was shaken until the bacterial solution OD 600When the concentration was about 0.5-0.6, IPTG (final concentration 0.8 mM) was added and the mixture was incubated at 37 °C and 220 r∙min. -1 Continue to shake and culture for 3 h, then use TaKaRa RNAiso Plus to extract dsRNA. Use RNAse H and DNAse I to digest dsRNA. Use Eppendorf BioSpectrometer basic for quantification to a final concentration of 1 μg / μL. Store in a -80℃ ultra-low temperature freezer for future use.

[0077] Example 4 After RNAi Oftermicin1 Detection of expression level.

[0078] First, Oftermicin1 The dsRNA was mixed with Nile Blue, and then 400 μl was dripped onto the filter paper at the bottom of a 6 cm culture dish. Oftermicin1 The control group was ds GFP and 20% Nile Blue aqueous solution (ck). 20 termites were added to each culture dish, and each group was repeated 3 times. The samples were placed in a dark environment at 25°C for observation and collection. The samples were collected after 6 hours, and the termites whose intestines turned blue were collected and stored at -80°C.

[0079] A fluorescence quantitative PCR (qRT-PCR) experiment was performed on the gene to examine the changes in gene expression at different times. The fluorescence quantitative primers are as follows (RPS18 and GAPDH are internal reference genes):

[0080] q- Oftermicin1 F:CTAGTCTTCCTGGTAGTGGTTTG

[0081] q- Oftermicin1 R:CAAGTGGGTCCATCACAGAA

[0082] q-RPS18F: ATGGCAAACCCCCGTCAGTA

[0083] q-RPS18R:CATACCACGATGCGCACGAA

[0084] q-GAPDHF:TCGTATTGGCCGTCTTGTGC

[0085] q-GAPDHR:AGCGACCATGGGTGAATCAT;

[0086] The fluorescence quantitative PCR reaction system is as follows:

[0087]

[0088] Reaction procedure:

[0089] 95℃ 30s

[0090] {95℃ 5 s, 60℃ 34 s} 30 cycles

[0091] {95℃ 15 s, 60℃ 1 min, 95℃ 15s}

[0092] The experiment was designed with 3 biological replicates. After obtaining the Ct values ​​of the target gene and the reference gene, 2 -ΔΔt Methods The relative expression of target gene mRNA was calculated and the obtained data were analyzed for significant differences using InStat software.

[0093] To detect Oftermicin1 The expression of the target gene was changed at different sampling intervals after dsRNA feeding. The cDNA samples of the control group and the treatment group were tested by real-time fluorescence quantitative PCR. The results showed that the interference efficiency was 75.18% at 6 h after dsRNA feeding, and the relative expression of the target gene was significantly lower than that of the other two groups ( Figure 6 ).

[0094] Example 5 Changes in the sensitivity of Coptotermes to Serratia marcescens SM1 after RNAi

[0095] First, dsRNA was mixed with Nile Blue, and then 400 μL was dripped onto the filter paper at the bottom of a 6 cm culture dish. Oftermicin1 The control group was ds GFP and 20% Nile Blue aqueous solution. Oftermicin1 The bioassay was started when the expression level was downregulated to the highest level. 20 termites were added to each culture dish, and each group was repeated 3 times. The common fermentation medium treatment (CK), SM1 treatment (CK-SM1), ds GFP Processing (ds GFP )、ds GFP After interference, SM1 was used to treat (ds GFP -SM1)、ds Oftermicin1 Processing (ds Oftermicin1 ) and ds Oftermicin1 After interference, SM1 was used to treat (ds Oftermicin1 -SM1), and conduct biological test. Place in a dark environment at 25℃ for observation and data recording.

[0096] Feeding ds to black-winged termites Oftermicin1After 6 h, we conducted the SM1 infection experiment. We found that the survival rate of black-winged termites after RNAi was significantly lower than that without RNAi. We selected 14, 24, 34, 44, and 54 h for data analysis and found that at 14 h, the survival rate of ds treated with SM1 was significantly lower than that of ds treated with SM1. Oftermicin1 The mortality rate of ds treated with SM1 was the highest, reaching 20%. Oftermicin1 The mortality rate of the ds treated with SM1 was the highest, reaching about 50%. Oftermicin1 The mortality rate of the CK group treated with SM1 and the ds group treated with SM1 was the highest, reaching about 90%. GFP The mortality rate of the group reached 20%, which was higher than that of the control group (CK group and ds GFP group) but lower than that treated with SM1 Oftermicin1 group; at 44 h and 54 h, ds treated with SM1 Oftermicin1 The mortality rate of the group was the highest, reaching 100%. At this time, the mortality rate of the CK group treated with SM1 and the ds GFP The mortality rate of the group was about 50%, which was higher than that of the control group (CK group and ds GFP group) but lower than that treated with SM1 Oftermicin1 Group.

[0097] It can also be clearly seen from the survival curve that the ds Oftermicin1 The survival rate of the group was significantly lower than that of the control group (CK group and GFP group), and the death rate of termites reached about 90% at 34 h ( Figure 7 ).

[0098] In summary, this patent is the first to use the technology of bacterial amplification of dsRNA to synthesize black-winged termites. Oftermicin1 dsRNA, established a feeding method for the black-winged termite Oftermicin1 RNA interference system, and concluded that feeding had a significant gene silencing effect in black-winged termites. Oftermicin1 The application of RNAi technology provides technical support. This system successfully interferes with antimicrobial peptides Oftermicin1 Gene expression and found Oftermicin1 The gene-silenced black-winged termites were significantly more sensitive to the SM1 strain of Serratia marcescens. Oftermicin1 When dsRNA and SM1 were used simultaneously, the mortality rate of termites was significantly increased, indicating that it can improve the control effect of biocontrol bacteria. Oftermicin1The application of dsRNA in termite control provides a theoretical basis. The present invention lays a theoretical foundation for the development of immunosuppressants that are safe for humans and animals, and provides a new theory for biological control of pests, ultimately providing new strategies and new ways of pest control for my country's green agricultural production and sustainable development.

[0099] The present invention provides a method and idea for controlling termites. There are many methods and approaches to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be considered as the scope of protection of the present invention. All components not specified in this embodiment can be implemented by existing technologies. Sequence Listing <110> Nanjing Forestry University <120> The gene of the antimicrobial peptide Oftermicin1 from Coptotermes obesus and its application <160> 14 <170> SIPOSequenceListing 1.0 <210> 1 <211> 189 <212> DNA <213> Oftermicin1 gene nucleotide sequence (Artificial Sequence) <400> 1 atgaggactg tcgctatcct gctagtcttc ctggtagtgg tttgcgtgtt cgtggcacag 60 catccggcat acgcaggatg cgagttccaa acgtgttggg ccacgtgcca ggcacagcac 120 caaatctact tcagaagagc gttctgtgat ggacccactt gcaaatgtgt gtatgttatact 180 gggggctag 189 <210> 2 <211> 62 <212> PRT <213> Oftermicin1 amino acid sequence (Artificial Sequence) <400> 2 Met Arg Thr Val Ala Ile Leu Leu Val Phe Leu Val Val Val Cys Val 1 5 10 15 Phe Val Ala Gln His Pro Ala Tyr Ala Gly Cys Glu Phe Gln Thr Cys 20 25 30 Trp Ala Thr Cys Gln Ala Gln His Gln Ile Tyr Phe Arg Arg Ala Phe 35 40 45 Cys Asp Gly Pro Thr Cys Lys Cys Val Tyr Val Thr Gly Gly 50 55 60 <210> 3 <211> 20 <212> DNA <213> Oftermicin1F(Artificial Sequence) <400> 3 acaatgagga ctgtcgctat 20 <210> 4 <211> 18 <212> DNA <213> Oftermicin1R(Artificial Sequence) <400> 4 cgtatggtca ttggcttg 18 <210> 5 <211> 30 <212> DNA <213> dsOftermicin1F(Artificial Sequence) <400> 5 atttgcggcc gcaggactgt cgctatcctg 30 <210> 6 <211> 27 <212> DNA <213> dsOftermicin1R(Artificial Sequence) <400> 6 cccaagcttt gcccccagta acataca 27 <210> 7 <211> 31 <212> DNA <213> dsGFP F(Artificial Sequence) <400> 7 atcggagctc agttgaacgg atccatcttc a 31 <210> 8 <211> 25 <212> DNA <213> dsGFP R(Artificial Sequence) <400> 8 cccaagctta gaacttttca ctgga 25 <210> 9 <211> 23 <212> DNA <213> q-Oftermicin1 F(Artificial Sequence) <400> 9 ctagtcttcc tggtagtggt ttg 23 <210> 10 <211> 20 <212> DNA <213> q-Oftermicin1 R(Artificial Sequence) <400> 10 caagtgggtc catcacagaa 20 <210> 11 <211> 20 <212> DNA <213> q-RPS18F(Artificial Sequence) <400> 11 atggcaaacc cccgtcagta 20 <210> 12 <211> 20 <212> DNA <213> q-RPS18R(Artificial Sequence) <400> 12 cataccacga tgcgcacgaa 20 <210> 13 <211> 20 <212> DNA <213> q-GAPDHF(Artificial Sequence) <400> 13 tcgtattggc cgtcttgtgc 20 <210> 14 <211> 21 <212> DNA <213> q-GAPDHR(Artificial Sequence) <400> 14 agcgaccatg ggtggaatca t 21

Claims

1. An antimicrobial peptide for controlling black-winged termites Oftermicin1 A dsRNA of a gene, characterized in that Said Oftermicin1 The nucleotide sequence of the gene is shown in SEQ ID NO: 1; the dsRNA is Oftermicin1 The full-length plasmid pClone007- Oftermicin1 As a template, the upstream primer ds Oftermicin1 F and downstream primer ds Oftermicin1 R is amplified by PCR to obtain the target fragment, wherein, Upstream primer ds Oftermicin1 F is: ATTT GCGGCCGC AGGACTGTCGCTATCCTG; Downstream primer ds Oftermicin1 R is: CCC AAGCTTT GCCCCCAGTAACATACA.

2. A recombinant expression vector, characterized in that: It expresses the dsRNA of claim 1.

3. A host bacterium, characterized in that The recombinant expression vector described in claim 2 is transformed therein.

4. A method for preventing and controlling black-winged termites, characterized in that: The dsRNA according to claim 1 and Serratia marcescens SM1 are co-fed with black-winged termites.

Images