Treatment and / or prevention of a disease or syndrome associated with a viral infection

By using α1-antitrypsin (AAT) protein and its variants, isotypes and/or fragments to target individuals with specific biomarker levels, treatment and prevention of coronavirus infection, particularly SARS-CoV-2 infection, has addressed the treatment challenges of asymptomatic or mildly symptomatic patients and reduced the risk of neurological complications.

CN116033917BActive Publication Date: 2026-04-07AGERONIX SA
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-05-03
Publication Date
2026-04-07

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively treat and prevent diseases or syndromes caused by coronavirus infection, particularly COVID-19 caused by SARS-CoV-2 infection, especially in asymptomatic or mildly symptomatic patients, and there is a risk of neurological complications.

Method used

Using α1-antitrypsin (AAT) protein and its variants, isotypes and/or fragments, administered via intravenous injection, intravenous infusion, dosing pump infusion, inhaled nasal spray, eye drops, skin patch, sustained-release formulation, in vitro gene therapy or in vitro cell therapy, for the treatment and prevention of coronavirus infection, particularly SARS-CoV-2 infection, in individuals with low levels of endogenous AAT, and high levels of spike protein initiating protease, ACE2 receptor and IFN-γ.

Benefits of technology

It improves the treatment efficacy for coronavirus infection-related diseases, particularly inflammatory diseases of the nervous system, by regulating endogenous AAT levels, reducing the inflammatory response, and decreasing the risk of neurological complications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

This invention provides compositions and methods for treating and / or preventing diseases or syndromes associated with viral infections. The invention also relates to methods for determining the sensitivity of a subject to such treatment, and methods for determining the amount of composition required for effective treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention provides compositions and methods for treating and / or preventing diseases or syndromes associated with viral infections. The invention also relates to methods for determining a subject's susceptibility to such treatment, and methods for determining the amount of composition required for effective treatment. Background Technology

[0002] Viruses, such as coronaviruses, cause diseases in animals and humans worldwide. Coronaviruses are RNA viruses.

[0003] Human coronaviruses (HCoVs) are known to primarily cause upper and lower respiratory tract infections. Examples of human coronaviruses include: beta coronavirus (named MERS-CoV) which causes Middle East Respiratory Syndrome (MERS-CoV), beta coronavirus (named SARS-CoV or SARS-CoV-1) which causes Severe Acute Respiratory Syndrome (SARS-CoV), novel coronavirus (named SARS-CoV-2) which causes coronavirus disease 2019 or COVID-19, alpha coronavirus 299E, alpha coronavirus NL63, beta coronavirus OC43, and beta coronavirus HKU1.

[0004] The illness or syndrome caused by SARS-CoV-2 infection is also known as COVID-19. SARS-CoV-2 infection can be asymptomatic or cause illness or syndrome with mild or severe symptoms. The most common symptoms of illness or syndrome associated with SARS-CoV-2 (also known as SARS-CoV-19) infection are fever and cough, fatigue, difficulty breathing, chills, joint or muscle pain, expectoration, sputum production, dyspnea, myalgia, joint pain or sore throat, headache, nausea, vomiting, diarrhea, sinus pain, nasal congestion, and decreased or altered sense of smell or taste. Other symptoms include loss of appetite, weight loss, stomach pain, conjunctivitis, rash, lymphoma, apathy, and drowsiness.

[0005] Patients with severe symptoms may develop pneumonia. A significant number of pneumonia patients require passive oxygen therapy. Non-invasive ventilation and high-flux nasal cannula oxygen therapy can be used for mild to moderate non-hypercapnic pneumonia cases. For patients with severe acute respiratory syndrome or acute respiratory distress syndrome (SARS / ARDS) and those on mechanical ventilation, lung-protective ventilation strategies must be implemented.

[0006] Although respiratory failure is the primary complication of coronavirus disease 2019 (COVID-19), a significant number of patients have been reported to have neurological symptoms affecting both the peripheral and central nervous systems (Niazkar, Zibaee et al. 2020 Neurol Sci 41(7): 1667-1671; Nordvig, Fong et al. 2021, Neurol ClinPract 11(2): e135-e146). Hematopoietic pathways, retrograde / anterograde transport along peripheral nerves, and rare direct invasion are considered possible neuropathic mechanisms of attack for neurotropic viruses, including SARS-CoV-2 (Barrantes 2021 Brain Behav Immun Health 14: 100251; Tavcar, Potokar et al. 2021, Front Cell Neurosci 15: 662578). Severe SARS-CoV-2 cases often exhibit disproportionate and aberrant inflammatory responses, including systemic upregulation of cytokines, chemokines, and pro-inflammatory signaling (Najjar, Najjar et al. 2020, JNeuroinflammation 17(1): 231). This excessive systemic inflammation can impair neurovascular endothelial function, disrupt the blood-brain barrier, ultimately activate the CNS immune system, and lead to CNS complications (Amruta, Chastain et al., 2021, Cytokine Growth Factor Rev 58: 1-15). Despite the recent COVID-19 pandemic raising concerns, several other viruses are associated with major brain diseases such as Alzheimer's, Parkinson's, and multiple sclerosis. Diseases or syndromes associated with viral infections also include a variety of conditions such as inflammatory diseases and constitute a significant social burden. Therefore, there is an urgent need to improve the treatment and / or prevention of virus-related diseases or syndromes.

[0007] The aforementioned technical problems are solved by means of the aspects disclosed herein and those defined in the claims. Summary of the Invention

[0008] This invention provides a composition for use in treating and / or preventing diseases or syndromes associated with viral infection in subjects in need, preferably coronavirus infection, more preferably SARS-CoV-2 infection, the composition comprising a therapeutically effective amount of α1-antitrypsin protein, variants, isotypes, and / or fragments thereof. The α1-antitrypsin (AAT) protein, variants, isotypes, and / or fragments thereof may be plasma-derived AAT, variants, isotypes, and / or fragments thereof, particularly human plasma-derived AAT, variants, isotypes, and / or fragments thereof; or recombinant α1-antitrypsin (rhAAT) protein, variants, isotypes, and / or fragments thereof. Preferably, the α1-antitrypsin (AAT) protein, variants, isotypes, and / or fragments thereof is recombinant α1-antitrypsin (rhAAT) protein, variants, isotypes, and / or fragments thereof. The viral infection, such as coronavirus infection, is preferably SARS-CoV-2 infection. Compared to at least one subject who is asymptomatic or has mild symptoms during a viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), a subject requiring treatment and / or prevention of a disease or syndrome associated with a viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) may have at least i) lower levels of endogenous α-antitrypsin (AAT), ii) higher levels of at least one spike protein priming protease, iii) higher levels of angiotensin-converting enzyme 2 (ACE2) receptors, and / or iv) higher levels of interferon-γ (IFN-γ).

[0009] The present invention also relates to a method for determining the susceptibility of a target subject to treatment and / or prevention of a disease or syndrome associated with a viral infection, said treatment and / or prevention using the composition of the present invention, said viral infection preferably being a coronavirus infection, more preferably being a SARS-CoV-2 infection.

[0010] The present invention also provides a method for determining a therapeutically effective amount of α1-antitrypsin (AAT) for the effective treatment and / or prevention of diseases or syndromes associated with viral infection, wherein the treatment and / or prevention uses a composition for the purposes of the present invention, wherein the viral infection is preferably a coronavirus infection, more preferably a SARS-CoV-2 infection.

[0011] A method for treating and / or preventing disease or syndrome associated with a viral infection, preferably a coronavirus infection, more preferably SARS-CoV-2 infection, is also provided in subjects in need. The method comprises administering a therapeutically effective amount of α1-antitrypsin protein, its variants, isotypes, and / or fragments. The α1-antitrypsin (AAT) protein, its variants, isotypes, and / or fragments, may be plasma-derived AAT, its variants, isotypes, and / or fragments, particularly human plasma-derived AAT, its variants, isotypes, and / or fragments; or recombinant α1-antitrypsin (rhAAT) protein, its variants, isotypes, and / or fragments. Preferably, the α1-antitrypsin (AAT) protein, its variants, isotypes, and / or fragments, is recombinant α1-antitrypsin (rhAAT) protein, its variants, isotypes, and / or fragments.

[0012] Therefore, the present invention relates particularly to the following aspects:

[0013] 1. A composition for use in treating and / or preventing a disease or syndrome associated with a viral infection in subjects in need, said composition comprising a therapeutically effective amount of α1-antitrypsin (AAT) protein, variants, isotypes and / or fragments thereof.

[0014] 2. The composition for use according to aspect 1, wherein the desired subject has at least one selected from the group consisting of:

[0015] 1. Lower levels of endogenous alpha-antitrypsin (AAT) before or during viral infection compared to at least one subject who was asymptomatic or had mild symptoms during viral infection.

[0016] 2. Higher levels of at least one spike protein initiating protease before or during viral infection compared to at least one asymptomatic or mildly symptomatic subject during viral infection.

[0017] 3. Angiotensin-converting enzyme 2 (ACE2 receptor) levels were higher in subjects before or during viral infection compared to at least one subject who was asymptomatic or had mild symptoms during viral infection.

[0018] 4. Interferon-γ (IFN-γ) levels in subjects who were previously infected or were infected with the virus, compared to at least one subject who was asymptomatic or had mild symptoms during the viral infection.

[0019] 3. The composition for use according to aspect 2, wherein the lower endogenous AAT level prior to or during viral infection is caused by AAT deficiency.

[0020] 4. The composition for use according to aspect 2 or 3, wherein the spike protein initiating protease is selected from at least one of the following groups: transmembrane protease serine isoform 2 (TMPRSS2), transmembrane protease isoform 6 (TMPRSS6), cathepsin L, cathepsin B, proprotein convertase 1 (PC1), trypsin, elastase, neutrophil elastase, matriptase, and furin, wherein the spike protein initiating protease is preferably cathepsin L and furin.

[0021] 5. The composition for use according to any one of aspects 2 to 4, wherein the higher level of at least one spike protein initiating protease is caused by age and / or genetic predisposition.

[0022] 6. The composition for use according to any one of aspects 2 to 5, wherein the higher ACE2 receptor level is caused by at least one selected from the group consisting of infection, inflammation, age and / or genetic predisposition.

[0023] 7. The composition for use according to any one of aspects 2 to 6, wherein the higher IFN-γ level is caused by at least one selected from the group consisting of infection, inflammation, age, and genetic predisposition.

[0024] 8. The composition for use according to any one of aspects 2 to 7, wherein the subject of need has

[0025] i) Lower levels of endogenous AAT, and

[0026] ii) Higher levels of at least one spike protein initiating protease.

[0027] 9. The composition for use according to any one of aspects 2 to 8, wherein the desired subject has

[0028] i) Lower levels of endogenous AAT, and

[0029] iii) Higher ACE2 receptor levels.

[0030] 10. The composition for use according to any one of aspects 2 to 9, wherein the desired subject has

[0031] i) Lower levels of endogenous AAT, and

[0032] iv) Higher levels of interferon-γ.

[0033] 11. The composition for use according to aspect 10, wherein the higher IFN-γ level is caused by at least one disease or condition selected from the group consisting of: AAT deficiency, liver disease such as non-alcoholic fatty liver disease, diabetes, obesity and / or cardiovascular disease.

[0034] 12. The composition for use according to any one of aspects 2 to 11, wherein the desired subject has

[0035] i) Lower levels of endogenous AAT

[0036] ii) Higher levels of at least one spike protein initiating protease, and

[0037] iii) Higher ACE2 receptor levels and / or iv) Higher IFN-γ levels.

[0038] 13. A composition for use according to any of the foregoing aspects, wherein the α1-antitrypsin (AAT) protein, its variants, isotypes and / or fragments are extracted from human plasma.

[0039] 14. A composition for use according to any one of aspects 1 to 12, wherein the α1-antitrypsin (AAT) protein, its variants, isotypes and / or fragments are recombinant α1-antitrypsin (rhAAT), its variants, isotypes and / or fragments.

[0040] 15. The composition for use according to aspect 14, wherein the α1-antitrypsin protein is as shown in SEQ ID NO:1.

[0041] 16. The composition for use according to aspect 14, wherein the α1-antitrypsin fragment is a C-terminal sequence fragment, or any combination thereof.

[0042] 17. The composition for use according to aspect 14, wherein the α1-antitrypsin variant is selected from the group comprising short cyclic peptides derived from the C-terminal sequence shown in SEQ ID NO:2.

[0043] 18. The composition for use according to aspect 17, wherein the short cyclic peptide derived from the C-terminal sequence of α1-antitrypsin is selected from the group consisting of cyclic-(CPFVFLM)-SH, cyclic-(CPFVFLE)-SH, cyclic-(CPFVFLR)-SH and cyclic-(CPEVFLM)-SH, or any combination thereof.

[0044] 19. A composition for use according to any of the foregoing aspects, wherein the composition further comprises a pharmaceutically acceptable excipient or carrier.

[0045] 20. A composition for use according to any of the foregoing aspects, wherein the composition further comprises a nucleoside analog, a protease inhibitor, an immunosuppressant (e.g., sarilumab or tocilizumab), an antibiotic, an antibody or fragment thereof against the viral structural component (e.g., passive immunotherapy), interferon beta (e.g., interferon beta-1a), and / or a vaccine.

[0046] 21. A composition for use according to any one of the foregoing aspects, wherein the composition is administered by intravenous injection, intravenous infusion, dosator pump infusion, inhaled nasal spray, eye drops, skin patch, sustained-release formulation, in vitro gene therapy or in vitro cell therapy, preferably by intravenous injection.

[0047] 22. A method for determining the susceptibility of a target subject to treatment and / or prevention of a disease or syndrome associated with a viral infection, said treatment and / or prevention using a composition comprising a therapeutically effective amount of α1-antitrypsin (AAT) protein, its variants, isotypes, and / or fragments as defined in any one of aspects 1 to 21, said method comprising the steps of:

[0048] a) Determine the levels of at least one of the following groups in the target subject before or during viral infection: endogenous α1-antitrypsin, at least one spike protein initiating protease, ACE2 receptor, and interferon-γ.

[0049] (b) Determine the level of at least one of the following groups in at least one reference subject during viral infection: endogenous α1-antitrypsin, at least one spike protein initiating protease, ACE2 receptor, and interferon-γ, wherein the reference subject is asymptomatic or has mild symptoms.

[0050] c) Compare the target level determined in step a) with the reference level determined in step b).

[0051] If the target subject has at least one of the following characteristics, then the target subject is more sensitive to treatment and / or prevention of the disease or syndrome associated with viral infection:

[0052] 1. A target level of endogenous α-antitrypsin (AAT) that is lower than the reference level of endogenous AAT.

[0053] 2. A target level of at least one spike protein initiating protease that is higher than a reference level of the at least one spike protein initiating protease.

[0054] 3. A target level of angiotensin-converting enzyme 2 (ACE2 receptor) that is higher than the reference level of the angiotensin-converting enzyme 2 receptor, and

[0055] 4. A target level of interferon-γ (IFN-γ) that is higher than the reference level of interferon-γ.

[0056] 23. A method for determining a therapeutically effective amount of α1-antitrypsin (AAT and / or rhAAT) for the effective treatment and / or prevention of a disease or syndrome associated with a viral infection, said treatment and / or prevention using a composition according to any one of aspects 1 to 21, said method comprising the steps of:

[0057] a) Determine the level of endogenous α1-antitrypsin in target subjects before or during viral infection.

[0058] b) Determine the amount of AAT in the composition, the amount being the amount required to achieve an AAT level of at least 10 μM, preferably at least 20 μM, more preferably at least 50 μM, even more preferably at least 100 μM, and most preferably at least 200 μM in the subject.

[0059] 24. A composition for use according to any one of aspects 1 to 21, or a method according to aspects 22 and 23, wherein the virus is a coronavirus.

[0060] 25. The composition for use according to aspect 24, or the method according to aspect 24, wherein the virus is SARS-CoV-2.

[0061] 26. The composition for use according to any one of aspects 1 to 25, or the method according to aspects 22 to 25, wherein the disease or syndrome is a respiratory syndrome or severe acute respiratory syndrome.

[0062] 27. The composition for use according to any one of aspects 1 to 25, or the method according to aspects 22 to 25, wherein the disease or syndrome is an inflammatory disease of the nervous system or a nervous system syndrome.

[0063] 28. The composition for use according to any one of aspects 1 to 27, or the method according to aspect 27, wherein the inflammatory disease or syndrome of the nervous system is a disease or syndrome selected from the group consisting of multiple sclerosis, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's disease, and Huntington's disease. Detailed Implementation

[0064] Although similar or equivalent methods and materials to those described and used herein may be used in the practice or testing of this invention, suitable methods and materials will be described below. The entire contents of all publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference. Publications and applications discussed herein are provided only because their publication precedes the filing date of this application. Nothing herein should be construed as an admission that the invention is not entitled to precedence over such publications by virtue of a prior invention. Furthermore, materials, methods, and examples are illustrative only and not restrictive.

[0065] In case of conflict, this specification (including definitions) shall prevail. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this subject matter pertains. As used herein, the following definitions are provided to facilitate understanding of the invention.

[0066] The term "comprise / comprising" is usually used in the sense of including, meaning that one or more features or components are allowed to exist.

[0067] As used in the specification and claims, the singular forms “a / an” and “the” include references to the plural, unless the context clearly specifies otherwise.

[0068] As used in this article, "at least one" means "one or more", "two or more", "three or more", etc.

[0069] As used herein, the terms “subject” / “subject in need” or “patient” / “patient in need” are recognized in the art and are used interchangeably herein to refer to mammals, including dogs, cats, rats, mice, monkeys, cattle, horses, goats, sheep, pigs, camels, and most preferably humans. In some cases, the subject is a subject in need of treatment or a subject suffering from a disease or disorder. However, in other respects, the subject may be a healthy subject. The term does not indicate a specific age or sex. Therefore, it is intended to cover adult subjects, pediatric subjects, and neonatal subjects, whether male or female. Preferably, the subject is a human. Most preferably, the subject is a person suffering from a disease or syndrome associated with a viral infection, preferably a coronavirus infection, more preferably SARS-CoV-2 infection.

[0070] As used herein, the terms “peptide,” “protein,” “polypeptide,” “polypeptide,” and “peptide” are used interchangeably to refer to a series of amino acid residues interconnected by peptide bonds between adjacent α-amino and carboxyl groups.

[0071] The terms “nucleic acid,” “polynucleotide,” and “oligonucleotide” are used interchangeably to refer to any kind of polymers of deoxyribonucleotides (e.g., DNA, cDNA…) in linear or cyclic conformations and in single- or double-stranded form, or polymers of ribonucleotides (e.g., RNA, mRNA…) or combinations of polymers of deoxyribonucleotides and ribonucleotides (e.g., DNA / RNA). These terms should not be construed as limiting the length of the polymer and may include known natural nucleotide analogs, as well as nucleotide analogs modified in the base, sugar, and / or phosphate moieties (e.g., phosphate thioester backbone). Typically, analogs of a particular nucleotide have the same base-pairing specificity; that is, an analog of A will pair with a T base.

[0072] As used herein, the term "vector" refers to a viral vector or nucleic acid (DNA or RNA) molecule, such as a plasmid or other vehicle, containing one or more heterologous nucleic acid sequences of the present invention, and preferably designed for transfer between different host cells. The terms "expression vector," "gene delivery vector," and "gene therapy vector" refer to any vector that efficiently incorporates and expresses one or more nucleic acids of the present invention in cells, preferably under the regulation of a promoter. Cloning or expression vectors may contain additional elements, such as regulatory elements and / or post-transcriptional regulatory elements in addition to the promoter.

[0073] The term “about”, in particular, with respect to a given quantity, means a deviation of plus or minus ten percent (10), preferably five percent, even more preferably two percent, and most preferably one percent.

[0074] This invention relates to compositions for use in treating and / or preventing diseases or syndromes associated with any viral infection in subjects in need, the compositions comprising a therapeutically effective amount of α1-antitrypsin protein, its variants, isotypes, and / or fragments.

[0075] The α1-antitrypsin (AAT) protein, its variants, isotypes, and / or fragments may be plasma-derived AAT, its variants, isotypes, and / or fragments, particularly human plasma-derived AAT, its variants, isotypes, and / or fragments; or recombinant α1-antitrypsin (rhAAT) protein, its variants, isotypes, and / or fragments. Preferably, the α1-antitrypsin (AAT) protein, its variants, isotypes, and / or fragments, is recombinant α1-antitrypsin (rhAAT) protein, its variants, isotypes, and / or fragments. The viral infection may be caused by enveloped or non-enveloped DNA viruses (double-stranded or single-stranded), RNA viruses (single-stranded or double-stranded, positive or negative), retroviruses, or any emerging viruses.

[0076] In some aspects of the invention, the composition is used to treat and / or prevent diseases or syndromes associated with respiratory viral infection in subjects in need. In some aspects, the respiratory viruses described herein are viruses selected from the group consisting of rhinovirus, RSV, parainfluenza virus, metapneumovirus, coronavirus, enterovirus, adenovirus, bocavirus, polyomavirus, herpes simplex virus, and cytomegalovirus.

[0077] In some aspects of the invention, the composition is used to treat and / or prevent diseases or syndromes associated with DNA virus infection in subjects in need.

[0078] In some respects, the DNA viruses described herein are selected from the group consisting of: adenovirus, rhinovirus, RSV, influenza virus, parainfluenza virus, metapneumovirus, coronavirus, enterovirus, adenovirus, bocavirus, polyomavirus, herpes simplex virus, cytomegalovirus, bocavirus, polyomavirus, and cytomegalovirus.

[0079] In some aspects of the invention, the composition is used to treat and / or prevent diseases or syndromes associated with RNA virus infection in subjects of need. The RNA virus may be an enveloped RNA virus or a coated RNA virus, or a non-enveloped RNA virus or a naked RNA virus. The RNA virus may be a single-stranded RNA (ssRNA) virus or a double-stranded RNA (dsRNA) virus. The single-stranded RNA virus may be a positive-sense ssRNA virus or a negative-sense ssRNA virus.

[0080] In some aspects, the RNA viruses described herein are selected from the group consisting of: rhinovirus, RSV, influenza virus, parainfluenza virus, metapneumovirus, coronavirus, enterovirus, adenovirus, bocavirus, polyomavirus, herpes simplex virus, and cytomegalovirus. In some aspects of the invention, the compositions are used to treat and / or prevent diseases or syndromes associated with coronavirus infection in subjects in need. In some aspects, the coronaviruses described herein are selected from the group consisting of: α-CoV, β-CoV, γ-CoV, or δ-CoV. In another specific aspect, the coronaviruses described herein belong to the genus α-CoV or β-CoV. In some respects, the coronaviruses described herein are selected from the group consisting of: human coronavirus OC43 (HCoV-OC43), human coronavirus HKU1 (HCoV-HKU1), human coronavirus 229E (HCoV-229E), human coronavirus NL63 (HCoV-NL63, New Haven coronavirus), Middle East respiratory syndrome-related coronavirus (MERS-CoV or "novel coronavirus 2012"), severe acute respiratory syndrome coronavirus (SARS-CoV or "SARS-typical"), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2 or "novel coronavirus 2019"). Preferably, the viral infection is an RNA virus infection, and most preferably, the coronavirus infection is caused by a coronavirus selected from the non-restrictive group including MERS-CoV, SARS-CoV, and SARS-CoV-2. Most preferably, the viral infection is SARS-CoV-2 infection.

[0081] It should be understood that this invention includes all diseases or syndromes associated with viral infection, preferably coronavirus infection, more preferably SARS-CoV-2 infection. Diseases or syndromes associated with SARS-CoV-2 infection are also referred to as COVID-19. In one aspect, diseases or syndromes associated with viral infection are inflammations such as systemic vascular inflammation (e.g., Kawasaki disease), immune disorders (e.g., Graves' disease), and / or respiratory syndromes, particularly severe acute respiratory syndrome. These diseases or syndromes may be associated with viral infection because the viral infection is related to, precedes, contributes to, and / or causes the disease or syndrome. For example, viral infection can trigger inflammation that directly or indirectly causes the disease or syndrome. Inflammation associated with viral infection can be acute or chronic. Inflammation associated with viral infection can then persist throughout the body and / or in specific organs (e.g., the brain) and / or cause persistent damage. In some aspects of this invention, the composition is used to treat and / or prevent neurological inflammatory diseases or neurological syndromes associated with viral infection in subjects of need.

[0082] As used herein, the term "inflammatory disease or syndrome of the nervous system" refers to a disease, syndrome, and / or condition characterized by increased inflammation of the nervous system compared to healthy reference subjects. Diseases or syndromes described herein include those of the nervous system related to viruses. Inflammation is characterized by dysregulation of inflammatory markers in the blood and / or brain and / or increased infiltration, activation, proliferation, and / or differentiation of immune cells. Inflammatory markers are markers that indicate inflammation in subjects. In some respects, inflammatory markers described herein are markers selected from the group consisting of: CRP, erythrocyte sedimentation rate (ESR), procalcitonin (PCT), interleukins (e.g., IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, I... Inflammatory markers can be regulated by various cytokines, including IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-33, IL-32, IL-35, or IL-36, tumor necrosis factors (such as TNFα, TNFβ), interferons (such as interferon-γ), MIP-I, MCP-I, RANTES, other chemokines, and / or other cytokines. Inflammatory markers can also be detected indirectly, for example, by detecting inhibitors of inflammatory markers (e.g., binding factors and / or antagonists). In some respects, inflammatory markers are measured in cells involved in inflammation, cells affected by cells involved in inflammation, cerebrospinal fluid, and / or blood. In some respects, inflammatory markers indicate the infiltration, activation, proliferation, and / or differentiation of immune cells. The detection of inflammatory markers or the ratio of two or more inflammatory markers is found to be outside the normal range. Normal ranges for inflammatory markers and whether a marker (ratio) must be below or above a threshold indicating inflammation are known to those skilled in the art. In some aspects, gene expression levels, RNA transcription levels, protein expression levels, protein activity levels, and / or enzyme activity levels of at least one inflammatory marker are detected. In some aspects, at least one inflammatory marker is quantitatively and / or qualitatively detected to identify inflammatory diseases or neurological syndromes in subjects requiring treatment and / or prevention.

[0083] In some respects, the inflammatory diseases or syndromes of the nervous system described herein are characterized by acute inflammation, meaning that the duration of inflammatory symptoms typically ranges from about a few minutes (e.g., 2, 5, 10, 15, 30, 45 minutes) to several days (e.g., 2, 3, 5, 7, 10, or 14 days). Acute inflammation usually occurs as a direct result of an irritant, such as a viral infection. In some respects, the inflammatory diseases or syndromes of the nervous system are characterized by chronic inflammation, meaning that the duration of inflammatory symptoms typically ranges from about a few days (e.g., 2, 3, 5, 7, 10, or 14 days), or that inflammatory symptoms recur at least once (e.g., once or more, twice or more, or three or more times). In some respects, the inflammatory diseases or syndromes of the nervous system are characterized by chronic low-grade inflammation. Chronic low-grade inflammation can occur without clinical symptoms.

[0084] In some respects, the subject requiring treatment and / or prevention has a history of viral infection. Therefore, the subject requiring treatment and / or prevention has been infected with a virus at least once. In some respects, the subject requiring treatment and / or prevention has been infected with a virus at least once. In some respects, the subject requiring treatment and / or prevention was infected with a virus at least once during childhood. In some respects, the subject requiring treatment and / or prevention has been infected with a virus at least once. In some respects, the subject requiring treatment and / or prevention has been infected with a virus at least once in the past 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0.5 years. In some respects, the viral infection was active (e.g., detectable) at the time point at which the subject requiring treatment and / or prevention was diagnosed with a neuroinflammatory disease or neurological syndrome.

[0085] Methods for detecting viral infections are known to those skilled in the art. In some aspects, the present invention relates to methods for detecting viruses, said methods being selected from the group consisting of: virus isolation methods, nucleic acid-based methods, microscopy-based methods, host antibody detection, electron microscopy, and host cell phenotype.

[0086] In some respects, the viral infection described herein is detected in samples, for example, in samples selected from the group consisting of: nasopharyngeal swabs, blood, tissue (e.g., skin), sputum, mouthwash, bronchoalveolar lavage fluid, urine, semen, feces, cerebrospinal fluid, dried blood spots, and nasal mucus.

[0087] In some respects, the viral infection described in this article was obtained as information retrieved from the patient's medical history.

[0088] Examples of detecting (previous) SARS-CoV-2 infection include human IFN-γ SARS-CoV-2 ELISApot. PLUS The kit (ALP), test strip (Mabtech, 3420-4AST-P1-1), or T-cell response assay (Zuo, J., Dowell, AC, Pearce, H. et al., 2021, Nat Immunol).

[0089] In some respects, the inflammatory diseases or syndromes of the nervous system described herein are sympathetic nervous system inflammatory diseases or sympathetic nervous system syndromes. In some respects, the inflammatory diseases or syndromes of the nervous system described herein are parasympathetic nervous system inflammatory diseases or parasympathetic nervous system syndromes. In some respects, the inflammatory diseases or syndromes of the nervous system described herein are central nervous system inflammatory diseases or central nervous system syndromes. In some respects, the inflammatory diseases or syndromes of the nervous system described herein are peripheral nervous system inflammatory diseases or peripheral nervous system syndromes.

[0090] In some respects, virus-related inflammatory diseases or neurological syndromes are selected from the following groups: multiple sclerosis, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's disease, and Huntington's disease.

[0091] As used herein, the term “multiple sclerosis” refers to a disease or disorder characterized by inflammation, demyelination, oligodendrocyte death, membrane damage, and axonal death. In some respects, multiple sclerosis as used herein refers to relapsing / remitting multiple sclerosis or progressive multiple sclerosis. In other respects, multiple sclerosis is at least one of the four major types of multiple sclerosis defined in an international survey of neurologists (Lublin and Reingold, 1996, Neurology 46(4):907-11), namely relapsing / remitting multiple sclerosis, secondary progressive multiple sclerosis, progressive / relapsing multiple sclerosis, or primary progressive multiple sclerosis (PPMS).

[0092] In some respects, the multiple sclerosis referred to in this article refers to the symptoms of multiple sclerosis, including vision problems, dizziness, vertigo, sensory dysfunction, weakness, coordination problems, balance loss, fatigue, pain, neurocognitive deficits, mental health deficits, bladder dysfunction, bowel dysfunction, sexual dysfunction, and heat sensitivity.

[0093] As used herein, the term "huntington disease" refers to a neurodegenerative disorder caused by the production of a pathogenic mutant huntingtin protein (HTT or mHTT) resulting from a trinucleotide repeat amplification in the HTT gene (e.g., CAG, which is translated into the polyglutamine or PolyQ region). In some respects, the mutant huntingtin protein accelerates the rate of neuronal cell death in certain areas of the brain. In other respects, the term "huntington disease" as used herein refers to the symptoms of huntingtin disease, including impaired motor function, cognitive impairment, depression, anxiety, movement disorders, chorea, rigidity, muscle contractures (dystonia), bradykinesia or dystonia, impaired gait, postural changes, impaired balance, unexpected weight loss, sleep rhythm disturbances, circadian rhythm disturbances, and autonomic nervous system dysfunction.

[0094] As used herein, the term "amyotrophic lateral sclerosis" refers to a progressive neurodegenerative disease that affects upper motor neurons (motor neurons in the brain) and / or lower motor neurons (motor neurons in the spinal cord) and leads to motor neuron death. In some aspects, amyotrophic lateral sclerosis includes all classifications of amyotrophic lateral sclerosis known in the art, including but not limited to classic amyotrophic lateral sclerosis (typically affecting both lower and upper motor neurons), primary lateral sclerosis (PLS, typically affecting only upper motor neurons), progressive bulbar palsy (PBP or medullary onset, a form of amyotrophic lateral sclerosis that typically begins with difficulty swallowing, chewing, and speaking), progressive muscular atrophy (PMA, typically affecting only lower motor neurons), and familial amyotrophic lateral sclerosis (the inherited form of amyotrophic lateral sclerosis).

[0095] In some respects, the term "amyotrophic lateral sclerosis" refers to the symptoms of amyotrophic lateral sclerosis, including but not limited to progressive weakness, atrophy, fasciculations, hyperreflexia, dysarthria, dysphagia, and / or respiratory paralysis.

[0096] As used in this article, the term "Alzheimer's disease" (AD) refers to a mental degeneration associated with a specific degenerative brain disease characterized by senile plaques, neurofibrillary tangles, and progressive neuronal loss, clinically manifested as progressive memory deficits, confusion, behavioral problems, inability to care for oneself, and / or progressive physical degeneration.

[0097] In some respects, the NINCDS-ADRDA (National Institute for Neurological and Communication Disorders and the Alzheimer's Disease and Related Disorders Association) criteria were used to identify subjects with Alzheimer's disease:

[0098] 1) Clinical Dementia Grade (CDR) = 1; Mini-Mental State Examination (MMSE) score of 16 to 24; medial temporal lobe atrophy (determined by magnetic resonance imaging (MRI)) score > 3 on the Scheltens scale. In some respects, the term "Alzheimer's disease" includes all stages of the disease, including the stages defined by the NINCDS-ADRDA diagnostic criteria for Alzheimer's disease in 1984.

[0099] 2) Definitive Alzheimer’s disease: The patient meets the criteria for possible Alzheimer’s disease and has histopathological evidence of AD through autopsy or biopsy.

[0100] Possible diagnosis of or prodromal Alzheimer's disease: Dementia has been confirmed through clinical and neuropsychological examinations. Cognitive impairment must also be progressive and present in two or more cognitive domains. These deficits must have an age of onset between 40 and 90 years of age, and finally, there must be no other diseases that could lead to dementia syndrome.

[0101] 3) Possibly having or not having prodromal Alzheimer's disease: A dementia syndrome with atypical onset and presentation exists; and there is no known cause; however, there are no comorbidities that are considered the origin of dementia. In some respects, the term Alzheimer's disease refers to one stage of Alzheimer's disease. In some respects, the term Alzheimer's disease refers to two stages of Alzheimer's disease. In some respects, the term "Alzheimer's disease" refers to the symptoms of Alzheimer's disease, including but not limited to memory loss, confusion, difficulty thinking, language changes, behavioral changes, and / or personality changes.

[0102] As used herein, the term "Parkinson's disease" refers to a neurological syndrome characterized by dopamine deficiency, caused by degenerative, vascular, or inflammatory changes in the substantia nigra-basal ganglia. Symptoms of Parkinson's disease include, but are not limited to, the following: resting tremor, cogwheel rigidity, bradykinesia, postural reflex disturbances, good response to 1-DOPA treatment, absence of obvious oculomotor nerve palsy, cerebellar or pyramidal signs, muscle atrophy, motor dysfunction, and / or speech impairment. In one particular aspect, the invention is for the treatment of dopaminergic dysfunction-related syndromes. In some aspects, Parkinson's disease includes any stage of Parkinson's disease. In some aspects, the term Parkinson's disease includes the early stages of Parkinson's disease, and broadly refers to stage one of Parkinson's disease, in which the person with the disease exhibits non-disabling, mild symptoms, such as paroxysmal tremor of a single limb (e.g., the hand), and it affects only one side of the body.

[0103] In some respects, the term Parkinson's disease includes late-stage Parkinson's disease, which refers to a more severe, progressive phase of the disease in which individuals exhibit typical, severe symptoms that can lead to several disabilities, including tremors on both sides of the body, balance problems, etc. Symptoms associated with late-stage Parkinson's disease can vary significantly from individual to individual and may not appear until years after the initial onset of the disease.

[0104] In some respects, the term “Parkinson’s disease” refers to the symptoms of Parkinson’s disease, including but not limited to tremor (e.g., tremor most noticeable at rest), shaking (e.g., shaking of the hands, arms, legs, jaw and face), muscle rigidity, lack of postural reflexes, slowing of voluntary movement, backward leaning, mask-like facial expression, kyphosis, poor balance, poor coordination, bradykinesia, postural instability and / or gait abnormalities.

[0105] Examples of established links between inflammatory diseases or syndromes of the nervous system and viral infections:

[0106]

[0107] The disease or syndrome is preferably associated with coronavirus infection, more preferably with SARS-CoV-2 infection. The disease or syndrome associated with SARS-CoV-2 is preferably selected from at least one of the following: fever, cough, fatigue, dyspnea, chills, joint or muscle pain, expectoration, sputum production, wheezing, myalgia, arthralgia or sore throat, headache, nausea, vomiting, diarrhea, sinus pain, nasal congestion, decreased or altered sense of smell or taste, loss of appetite, weight loss, stomach pain, conjunctivitis, rash, lymphoma, apathy, and somnolence, preferably fever, cough, fatigue, dyspnea, chills, joint or muscle pain, expectoration, sputum production, wheezing, myalgia, arthralgia or sore throat, headache, nausea, vomiting, diarrhea, sinus pain, nasal congestion, decreased or altered sense of smell or taste.

[0108] This invention relates to compositions for treating and / or preventing diseases or syndromes associated with viral infections, preferably coronavirus infections, in subjects in need, wherein the compositions comprise a therapeutically effective amount of α1-antitrypsin (AAT) protein, variants, isotypes, and / or fragments thereof. The coronavirus is preferably SARS-CoV-2.

[0109] The inventors discovered that AAT and rhAAT inhibited viral entry of several viruses (see Figures 11, 21, and 22) and reduced inflammation, particularly in microglia of the nervous system (Figures 19 and 20). Furthermore, neuronal-derived SH-SY5Y cells (frequently used in research on neurodegenerative diseases including Parkinson's disease (Xicoy, H., Wieringa, B. & Martens, GJ The SH-SY5Y cell line in Parkinson's disease research: a systematic review. Mol Neurodegeneration 12, 10, 2017)) exhibited relatively high copy numbers of spike protein-initiating protease mRNAs, namely trypsin and cathepsin B. Figure 15e Combined with the relatively high ACE2 expression levels in SH-SY5Y ( Figure 3a These neural tissues (Bielarz V, Willemart K, Avalosse N, et al. Susceptibility of neuroblastoma and glioblastoma cell lines to SARS-CoV-2 infection. Brain Res. 2021 May 1) and cells of similar origin become susceptible to SARS-CoV-2 infection.

[0110] Various strategies can be used to deliver the compositions used for the purposes of this invention to the nervous system, including the brain, and across the blood-brain barrier (Salameh, TS, & Banks, WA, 2014, Advances in pharmacology, 71, 277-299; Tashima, T., 2020, Receptor-Mediated Transcytosis. Chemical and Pharmaceutical Bulletin, 68(4), 316-32; Pardridge, WM, 2020, Frontiers inaging neuroscience, 11, 373; Upadhyay, RK, 2014, BioMed researchinternational).

[0111] In some aspects, the composition used for purposes of the present invention is fused with a blood-brain barrier enhancing protein. In some aspects, the blood-brain barrier enhancing protein described herein is at least one whole protein selected from the group consisting of transferrin, insulin, insulin-like growth factor, and low-density lipoprotein, as well as variants, isotypes, and / or fragments of said protein.

[0112] Trojan horse strategies may also be used (see, for example, Pardridge, WM., 2017, BioDrugs 31, 503–519). In some aspects, compositions used for purposes of the present invention are linked to antibodies or fragments thereof that bind to endogenous BBB receptor transporters, such as insulin receptors or transferrin receptors.

[0113] The compositions used in this invention can also be modified to increase lipophilicity and subsequently improve BBB-crossing properties (see, for example, Upadhyay, RK, 2014, BioMed research international, Article ID869269, 37 pages). In some aspects, the compositions used in this invention comprise modifications that increase lipophilicity. In some aspects, modifications that increase the lipophilicity described herein include adding at least one hydrophilic peptide, replacing a sequence portion with at least one hydrophilic peptide, adding a lipid portion, and / or replacing a non-lipid portion with a lipid portion.

[0114] Therefore, the present invention is based, at least in part, on the broad effects of AAT on diseases or syndromes associated with viral infections.

[0115] Treatment and / or prevention with AAT and / or rhAAT proteins may be particularly suitable for specific subjects.

[0116] Therefore, the present invention also relates to a composition for use in treating and / or preventing diseases or syndromes associated with viral infection in subjects in need, the viral infection preferably being a coronavirus infection, more preferably SARS-CoV-2 infection, the composition comprising a therapeutically effective amount of α1-antitrypsin (AAT) protein, variants, isotypes and / or fragments thereof, wherein the subject in need has a level of at least one altered level selected from at least one reference subject compared to: i) endogenous α-antitrypsin (AAT), at least one spike protein initiating protease, angiotensin-converting enzyme 2 (ACE2 receptor) and interferon-γ (IFN-γ). The α1-antitrypsin (AAT) protein, its variants, isotypes and / or fragments may be plasma-derived AAT, its variants, isotypes and / or fragments, particularly human plasma-derived AAT, its variants, isotypes and / or fragments; or recombinant α1-antitrypsin (rhAAT) protein, its variants, isotypes and / or fragments. Preferably, the α1-antitrypsin (AAT) protein, its variants, isotypes and / or fragments are recombinant α1-antitrypsin (rhAAT) protein, its variants, isotypes and / or fragments.

[0117] The term "subject in need" is also referred to as the target subject. The subject in need may be a subject who is currently experiencing or suffering from a viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) and has a disease or syndrome associated with a viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection). The infected subject may require treatment and / or prevention of a disease or syndrome associated with the viral infection, preferably coronavirus infection, more preferably SARS-CoV-2 infection. Treatment with AAT and / or rhAAT can inhibit or reduce the entry of the viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 virus) into cells, reduce the spread of the viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 virus) in the body, and / or reduce inflammation as a response to the viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) by inhibiting the spike protein initiating protease. Subjects requiring treatment and / or prevention may suffer from respiratory syndromes, more preferably acute respiratory syndromes, and even more preferably severe acute respiratory syndromes. Subjects requiring treatment and / or prevention may have at least one symptom selected from the following groups: fever, cough, fatigue, dyspnea, chills, joint or muscle pain, expectoration, sputum production, wheezing, myalgia, arthralgia or sore throat, headache, nausea, vomiting, diarrhea, sinus pain, nasal congestion, decreased or altered sense of smell or taste, loss of appetite, weight loss, stomach pain, conjunctivitis, rash, lymphoma, apathy, and somnolence, preferably selected from the following groups: fever, cough, fatigue, dyspnea, chills, joint or muscle pain, expectoration, sputum production, wheezing, myalgia, arthralgia or sore throat, headache, nausea, vomiting, diarrhea, sinus pain, nasal congestion, decreased or altered sense of smell or taste. Subjects requiring treatment and / or prevention may require intensive care and / or mechanical ventilation. Subjects requiring treatment and / or prevention may be defined by one or any combination of the above definitions.

[0118] Subjects who require this information may also be those who were previously infected with a virus (preferably coronavirus infection, more preferably SARS-CoV-2 infection) and are particularly susceptible to developing illness or syndrome after infection. Such subjects may require preventative measures against illness or syndrome associated with the viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) prior to infection.

[0119] At least one reference subject may be a group of reference subjects. Preferably, one or more reference subjects are asymptomatic or mildly symptomatic subjects who have a viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) or are in the course of a viral infection (i.e., infected subjects). More preferably, the subjects are asymptomatic subjects who have a viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) or are in the course of a viral infection.

[0120] According to the present invention, asymptomatic means that the subject (reference) has no symptoms, preferably no symptoms selected from the group consisting of: no fever, cough, fatigue, dyspnea, chills, joint or muscle pain, expectoration, sputum production, wheezing, myalgia, arthralgia or sore throat, headache, nausea, vomiting, diarrhea, sinus pain, nasal congestion, decreased or altered sense of smell or taste, loss of appetite, weight loss, stomach pain, conjunctivitis, rash, lymphoma, apathy, and somnolence; more preferably, no fever, cough, fatigue, dyspnea, chills, joint or muscle pain, expectoration, sputum production, wheezing, myalgia, arthralgia or sore throat, headache, nausea, vomiting, diarrhea, sinus pain, nasal congestion, decreased or altered sense of smell or taste. Asymptomatic (reference) subjects are preferably free from respiratory syndrome, more preferably free from acute respiratory syndrome, and even more preferably free from severe acute respiratory syndrome. Asymptomatic (reference) subjects do not require intensive care and / or mechanical ventilation. Asymptomatic (reference) subjects may be defined by one or any combination of the above definitions.

[0121] According to the present invention, the (reference) subjects with mild symptoms are preferably not suffering from respiratory syndrome, more preferably not suffering from acute respiratory syndrome, and even more preferably not suffering from severe acute respiratory syndrome. Preferably, the (reference) subjects with mild symptoms do not require intensive care and / or mechanical ventilation. Subjects with mild symptoms (reference) may have at least one symptom selected from the group consisting of: fever, cough, fatigue, dyspnea, chills, joint or muscle pain, expectoration, sputum production, wheezing, myalgia, arthralgia or sore throat, headache, nausea, vomiting, diarrhea, sinus pain, nasal congestion, decreased or altered sense of smell or taste, loss of appetite, weight loss, stomach pain, conjunctivitis, rash, lymphoma, apathy, and somnolence; more preferably, they may not have fever, cough, fatigue, dyspnea, chills, joint or muscle pain, expectoration, sputum production, wheezing, myalgia, arthralgia or sore throat, headache, nausea, vomiting, diarrhea, sinus pain, nasal congestion, decreased or altered sense of smell or taste. Subjects with mild symptoms (reference) do not require intensive care and / or mechanical ventilation. Subjects with mild symptoms (reference) may be defined by one or any combination of the above definitions.

[0122] The reference subjects can be children, especially children under 10 years of age, preferably under 5 years of age. The age of the reference subjects can be from 1 to 10 years of age, preferably from 2 to 5 years of age.

[0123] A subject is a (reference) subject who is in the course of a viral infection or has a viral infection (especially coronavirus infection, more particularly SARS-CoV-2 infection), preferably a (reference) subject who is infected with a virus (especially coronavirus, more particularly SARS-CoV-2). An infected (reference) subject is defined as one in whom the virus (especially coronavirus, more particularly SARS-CoV-2 virus) has entered the cells of the (reference) subject's body, preferably, the virus has already multiplied in the cells of the (reference) subject's body.

[0124] Following infection with a virus (particularly coronaviruses, and more particularly SARS-CoV-2), infected subjects exhibit elevated interferon-γ (AAT) levels. This elevated AAT, in turn, leads to increased levels of angiotensin-converting enzyme 2 (ACE2 receptor). Elevated ACE2 levels stimulate increased activity and initiation of the protease on the spike protein. The endogenous levels of AAT then decrease in response to the increased activity of at least one spike protein initiating protease. Subsequently, the endogenous levels of AAT are further depleted as AAT binds to (and inhibits) the active spike protein initiating protease. Subjects with at least one of the following groups are particularly susceptible to developing a disease or syndrome in response to a virus (particularly coronaviruses, and more particularly SARS-CoV-2 infection) compared to at least one reference subject: i) lower endogenous α-antitrypsin (AAT) levels, ii) higher levels of at least one spike protein initiating protease, iii) higher levels of angiotensin-converting enzyme 2 (ACE2 receptor) and iv) higher levels of interferon-γ (IFN-γ). Therefore, these target subjects are particularly relevant and suited to receive treatment and / or prophylaxis using a composition containing a therapeutically effective amount of α1-antitrypsin (AAT) protein, its variants, isotypes, and / or fragments. The α1-antitrypsin (AAT) protein, its variants, isotypes, and / or fragments, may be plasma-derived AAT, its variants, isotypes, and / or fragments, particularly human plasma-derived AAT, its variants, isotypes, and / or fragments; or recombinant α1-antitrypsin (rhAAT) protein, its variants, isotypes, and / or fragments. Preferably, the α1-antitrypsin (AAT) protein, its variants, isotypes, and / or fragments, is recombinant α1-antitrypsin (rhAAT) protein, its variants, isotypes, and / or fragments. Most preferably, the AAT protein is recombinant α1-antitrypsin (rhAAT) protein produced in Chinese hamster ovary (CHO) cells and / or human embryonic kidney (HEK) cells.

[0125] The present invention also relates to a composition for treating and / or preventing diseases or syndromes associated with viral infection in subjects in need, wherein the viral infection is preferably a coronavirus infection, more preferably a SARS-CoV-2 infection, the composition comprising a therapeutically effective amount of α1-antitrypsin (AAT) protein and / or recombinant α1-antitrypsin (rhAAT) protein, variants, isotypes and / or fragments thereof, wherein the subject in need has at least one selected from the group consisting of:

[0126] 1. Lower levels of endogenous α-antitrypsin (AAT) before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0127] 2. A higher level of at least one spike protein initiating protease before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0128] 3. Angiotensin-converting enzyme 2 (ACE2 receptor) levels in subjects who were asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), and

[0129] 4. Interferon-γ (IFN-γ) levels in subjects who were asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0130] The at least one asymptomatic or mildly symptomatic subject is also referred to as at least one reference subject. Reference subjects are defined as described herein.

[0131] "Subjects in need" are also referred to as target subjects. The need for treatment and / or prevention of disease syndromes associated with viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) is defined as described herein.

[0132] The levels defined in i) through iv) can be protein levels and / or mRNA levels, preferably protein or mRNA levels. Protein levels are measured using antibody-based assays such as enzyme-linked immunosorbent assay (ELISA) and / or biolayer interferometry (BLI) based on fiber optic biosensors (ForteBio Octet).

[0133] The level of spike protein initiating protease can be determined by measuring the activity of the spike protein protease using a fluorescent peptide derived from the SARS-CoV-2 spike protein. Jaimes et al. described this method (Javier A. Jaimes, Jean K. Millet, Gary R. Whittaker Proteolytic Cleavage of the SARS-CoV-2 SpikeProtein and the Role of the Novel S1 / S2 Site, CELL, iScience 23, 101212, June 26, 2020). The disclosed method peptide: a fluorescent peptide derived from the SARS-CoV-2 spike S1 / S2 site consisting of the sequences HTVSLLRSTSQ (SEQ ID NO: 11) and TNSPRRARSVA (SEQ ID NO: 12), respectively, and containing the (7-methoxycoumarin-4-yl)acetyl / 2,4-dinitrophenyl (MCA / DNP)FRET pair, synthesized by Biomatik (Wilmington, DE, USA). Recombinant furin protease was available from New England Biolabs (Ipswich, MA, USA). Recombinant L-1-toluenesulfonyl-2-phenylethylchloromethyl ketone (TPCK) treated trypsin was available from Sigma-Aldrich (St. Louis, MO, USA). Recombinant PC1, proteolytic enzyme, cathepsin B, and cathepsin L were available from R&D Systems (Minneapolis, MN, USA). Fluorescent peptide analysis:For each fluorescent peptide, the following buffers and peptides diluted to 50 μM were used in a 100 μL volume for reaction: For furin protease (diluted to 10 U / mL), the buffer contained 100 mM MES, 0.5% Triton X-100, 1 mM CaCl2, and 1 mM 2-mercaptoethanol, pH 7.5; for PC1 (diluted to 2.2 ng / μL), the buffer contained 25 mM MES, 5 mM CaCl2, and 1% (w / v) Brij-35, pH 6.0; for trypsin (diluted to 8 nM), the buffer was PBS; for proteolytic enzyme (diluted to 2.2 ng / μL), the buffer contained 50 mM Tris, 50 mM NaCl, and 0.01% (v / v) Tween® 20, pH 9.0; and for cathepsin B (diluted to 2.2 ng / μL), the buffer was 25 mM MES, pH 9.0. 5.0; The buffer for cathepsin L (diluted to 2.2 ng / μL) contained 50 mM MES, 5 mM DTT, 1 mM EDTA, 0.005% (w / v) Brij-35, pH 6.0. Reactions were performed at 30°C in triplicate using a SpectraMax fluorometer (Molecular Devices, Sunnyvale, CA, USA) at wavelengths of λex 330 nm and λem 390 nm, measuring fluorescence emission every minute for 45 minutes. Fluorescence intensity was tracked over time, and the Vmax of the reaction was calculated. Analysis should be performed in triplicate, and the results represent the average Vmax of three independent experiments.

[0134] IFN-γ protein levels can be measured using flow cytometry and particle-based immunoassays. This method is similar to that of Huang et al. (Huang KJ, Su IJ, Theron M, et al. An interferon-gamma-related cytokine storm in SARS patients. J Med Virol. 2005;75(2):185-194.doi:10.1002 / jmv.20255). The BD Human Th1 / Th2 Cytokine or Chemokine Bead Array (CBA) Kit was also used. The BD Human Th1 / Th2 Cytokine CBA Kit (BD PharMingen, San Diego, CA) measures IFN-γ levels by flow cytometry in a particle-based immunoassay. This kit allows for the simultaneous measurement of six cytokines from a 50 mL patient serum sample. For IFN-γ, the detection limit for these immunoassays is 7.1 pg / mL.

[0135] Preferably, the endogenous level of AAT described herein is a protein level. The level of at least one spike protein protease described herein is preferably an mRNA level. The level of the ACE2 receptor described herein is preferably an mRNA level. The level of IFN-γ described herein is preferably a protein level. Protein and / or mRNA levels can be measured in blood, urine, or saliva, preferably in blood, more preferably in plasma, and most preferably in human plasma.

[0136] Several factors have been understood regarding the entry and replication of viruses (particularly coronaviruses, and more specifically SARS-CoV-2), while others remain the subject of research. SARS-CoV-2 entry is mediated by the spike protein, the spike protein initiating protease, and the ACE2 receptor. The SARS-CoV-2 spike protein is also known as spike protein S. The spike protein initiating protease cleaves the SARS-CoV-2 spike protein, thereby initiating SARS-CoV-2 entry into the cell. SARS-CoV-2 enters the cell through the interaction of the initiating spike protein with the ACE receptor. Therefore, the more readily and rapidly SARS-CoV-2 enters the cell if at least one or more initiating proteases are present in the target subject. Furthermore, the more ACE2 receptors present, the easier and faster SARS-CoV-2 enters the cell. SARS-CoV-2 infection leads to inflammation, thereby increasing IFN-γ expression. IFN-γ expression in response to SARS-CoV-2 infection can, in turn, lead to increased ACE2 receptor expression. During SARS-CoV-2 replication, IFN-γ levels further increase, stimulating increased ACE2-spike protein interaction and subsequent spike protein initiation. AAT levels decrease, and increased inflammation upon viral entry into cells leads to even higher levels of IFN-γ. Following SARS-CoV-2 infection, IFN-γ levels initially increase, followed by decreased AAT levels, and then increased cathepsin L levels and / or other spike protein initiation (S-initiation) proteases. See also Figure 1 .

[0137] Therefore, this invention is based at least in part on the finding that AAT and rhAAT simultaneously reduce viral entry (see, for example, Figure 6). Figure 7 , Figure 8 (Figures 11, 12, 21, and 22) and virus-associated inflammation (see, for example, Figures 19 and 20), particularly virus-associated inflammation due to high IFN-γ levels. This combined effect is particularly useful in the patient population described in this article.

[0138] In some aspects, the present invention relates to compositions for use according to the invention, wherein the spike protein initiating protease is at least one selected from the group consisting of: transmembrane protease serine isoform 2 (TMPRSS2), transmembrane protease isoform 6 (TMPRSS6), cathepsin L, cathepsin B, proprotein convertase 1 (PC1), trypsin, elastase, neutrophil elastase, proteolytic enzyme, and furin protease.

[0139] In some respects, the present invention relates to compositions for use according to the invention, wherein the spike protein initiating protease is cathepsin L and / or furin protease.

[0140] AAT is endogenously expressed in humans. AAT is also known as an α-1-protease inhibitor. AAT inhibits proteases, specifically spike protein proteases such as transmembrane protease serine isoform 2 (TMPRSS2), transmembrane protease isoform 6 (TMPRSS6 / protein lyase-2), cathepsin L, cathepsin B, proprotein convertase 1 (PC1), trypsin, elastase, neutrophil elastase, protein lyase, and furin. If the levels of the four participants of this invention (AAT, spike protein initiating protease, ACE2 receptor, and IFN-γ) are altered in target subjects compared to reference subjects, the target subjects may particularly benefit from the treatment and / or prevention of SARS-CoV-2-related diseases or syndromes. Low endogenous AAT levels may make target subjects more susceptible to SARS-CoV-2-related diseases or syndromes, particularly COVID-19.

[0141] In some respects, the present invention relates to compositions for use according to the invention, wherein lower levels of endogenous AAT prior to or during viral infection are caused by AAT deficiency.

[0142] α1-Anttrypsin (hereinafter referred to as "AAT") is a naturally occurring protein in the human body, produced in the liver, preferably in hepatocytes. According to Janciauskiene et al. (Janciauskiene SM, Bals R, Koczulla R, Vogelmeier C, Köhnlein T, Welte T. The discovery of α1-antitrypsin and its role in health and disease. Respir Med. 2011;105(8):1129-1139. doi:10.1016 / j.rmed.2011.02.002), the normal plasma concentration of AAT is 0.9 g / L to 1.75 g / L. Given a MW of 52,000 (Brantly M, Nukiwa T, Crystal RG. Molecular basis of alpha-1-antitrypsin deficiency. Am J Med. 1988;84(6A):13-31. doi:10.1016 / 0002-9343(88)90154-4), this corresponds to normal plasma concentrations of 16 μM to 32 μM. Crystal 1990 (Crystal RG. Alpha 1-antitrypsin deficiency, emphysema, and liver disease. Genetic basis and strategies for therapy. J Clin Invest. 1990 May;85(5):1343-52. doi:10.1172 / JCI114578. PMID: 2185272; PMCID: PMC296579) describes 11 μM as a threshold level for the clinical manifestations of AAT deficiency. For most healthy individuals, daily AAT expression of 2 g in the liver is sufficient to reach a critical serum level of 11 μM, after which endogenous AAT levels are sufficient to protect the lower respiratory tract from neutrophil elastase (NE) damage and inhibit the progressive alveolar destruction that ultimately leads to emphysema. Crystal 1990 further noted that normal endogenous AAT levels in healthy individuals vary from 20 μM to 53 μM. Prior to viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), the endogenous AAT protein level in the plasma of healthy human subjects was 5 μM to 60 μM, preferably 10 μM to 40 μM, more preferably 25 μM to 30 μM, and even more preferably 16 μM to 32 μM.Alternatively, prior to viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), the endogenous level of AAT protein in the plasma of healthy human subjects is preferably higher than 30 μM, more preferably higher than 40 μM, and most preferably higher than 50 μM. The AAT protein can be plasma AAT protein or recombinant AAT (rhAAT) protein. In some aspects, the plasma AAT protein is derived from blood plasma. In some aspects, the recombinant AAT protein is recombinantly produced, for example, in HEK cells, CHO cells, or E. coli cells. Pharmaceutical companies worldwide extract AAT protein from human plasma for the treatment of AAT deficiency (a genetic disorder). Plasma-derived AAT has been approved by the Food and Drug Administration (FDA) in the United States and the European Medicines Agency (EMA) in the European Union. Preferably, the AAT protein of the present invention has a human amino acid sequence; most preferably, the AAT protein of the present invention is as shown in SEQ ID NO: 1 (see Table 1).

[0143] As in the present invention Figure 6a and Figure 6c As shown, 10 μM AAT reduced pseudovirus entry into A549 cells overexpressing the ACE2 receptor by 20% to 30%.

[0144] According to Azouz et al. (Nurit P. Azouz, Andrea M. Klingler and Marc E. Rothenberg, Alpha1-Antitrypsin (AAT) is an inhibitor of the SARS-CoV-2–Priming Protease TMPRSS2, (bioRxiv preprint online, https: / / doi.org / 10.1101 / 2020.05.04.077826, posted on May 5, 2020), AAT at concentrations of 1–100 μM achieved dose-dependent inhibition of the proteolytic activity of TMPRSS2.

[0145] As in the present invention Figure 7 As shown, 100 μM AAT reduced pseudovirus entry into A549 cells that only overexpressed the ACE2 receptor by 50% to 75%.

[0146] As in the present invention Figure 8 As shown, 100 μM AAT reduced pseudovirus entry into A549 cells that overexpressed only the ACE2 receptor and spike protein initiator protease TMPRSS2 by up to 45%.

[0147] It is worth noting that in Figure 6 and of the present invention Figure 7Viral entry was observed to be independent of TMPRSS2. Initiating proteases such as furin and / or cathepsin L (and possibly others) were demonstrated to be able to substitute for TMPRSS2. In this regard, AAT and rhAAT reduced the activity of the proteases cathepsin B, cathepsin L, trypsin, furin, PC1, proteolytic enzymes, elastase, and neutrophil elastase (Figure 16).

[0148] Therefore, AAT and rhAAT have a greater inhibitory effect on viral entry than other TMPRSS2 inhibitors. Figure 7 , Figure 8 (Figures 11, 12, 21, and 22) because AAT and rhAAT effectively inhibit several initiation proteases (Figure 16) (e.g., proteases that can replace the function of TMPRSS2) and subsequent ACE2-mediated viral entry ( Figure 7 , Figure 8 Figures 11, 12, 21, and 22.

[0149] Therefore, AAT and rhAAT reduce viral entry by decreasing initiator protease activity, particularly by broadly and effectively reducing initiator protease activity.

[0150] Therefore, the present invention is based at least in part on the surprising finding that compositions containing AAT and / or rhAAT, variants, isotypes and / or fragments thereof are particularly effective in the treatment and / or prevention of diseases or syndromes associated with viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), especially in subjects having one or more of the prerequisites described herein.

[0151] In this invention, the lower level of endogenous AAT according to i) is preferably the protein level in human plasma. The level of endogenous AAT protein in human plasma according to i) is preferably less than 200 μM, more preferably less than 150 μM, 100 μM, less than 90 μM, less than 80 μM, less than 70 μM, less than 60 μM, less than 50 μM, less than 40 μM, less than 30 μM, less than 25 μM, less than 20 μM, less than 15 μM, less than 11 μM, or less than 10 μM. More preferably, less than 200 μM, less than 100 μM, less than 25 μM, less than 15 μM, or less than 11 μM. Low levels of AAT are insufficient to successfully inhibit the spike protein initiating protease. Therefore, low levels of endogenous AAT can promote viral replication (especially coronavirus replication, more particularly SARS-CoV-2 replication) and / or the development of syndromes associated with viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection). Lower endogenous AAT levels prior to or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) can be caused by AAT deficiency. Preferably, lower endogenous AAT levels prior to viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) are caused by AAT deficiency. AAT deficiency is an autosomal codominant genetic disorder. Codominance means that two different versions of the gene may be active (expressed), and both versions contribute to the heritable trait. SERPINA1 The most common version of the gene (allele) is called M, which produces normal levels of α-1 antitrypsin. Most people in the general population have two copies of the M allele (MM) in each cell. SERPINA1 Other versions of the gene result in reduced levels of α-1 antitrypsin. For example, the S allele produces moderately low levels of this protein, while the Z allele produces very little α-1 antitrypsin. Individuals with two copies of the Z allele (ZZ) in each cell may have α-1 antitrypsin deficiency. Those with the SZ combination have an increased risk of lung diseases such as emphysema, especially if they smoke. It is estimated that 161 million people worldwide have one copy of the S or Z allele and one copy of the M allele (MS or MZ) in each cell. Individuals with the MS (or SS) combination typically produce enough α-1 antitrypsin to protect their lungs. However, those with the MZ allele have a slightly increased risk of impaired lung or liver function. Subjects with AAT deficiency in this invention preferably have SERPINA1 The gene may have ZZ, SZ, MS, MZ, or SS mutations, with ZZ mutations being preferred. SERPINA1In the ZZ mutation of the gene, low levels of AAT secretion are due to the misfolding of AAT and its subsequent accumulation in the endoplasmic reticulum (ER) of hepatocytes (Crystal 1990), leading to progressive liver disease, as the accumulation of misfolded AAT negatively impacts the health of hepatocytes, eventually causing their death.

[0152] During viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), lower endogenous AAT levels can also be caused by viral infection, coronavirus infection, or SARS-CoV-2 infection, respectively. That is, during viral infection, the endogenous AAT level in the reference subject may be temporarily elevated as healthy hepatocytes attempt to overcompensate for the decrease in endogenous AAT levels, while the endogenous AAT level in subjects with hereditary AAT deficiency is lower due to the absence or incompleteness of viral infection (lack of healthy hepatocytes).

[0153] Lower endogenous AAT levels can also be caused by liver diseases such as nonalcoholic fatty liver disease, type 1 or type 2 diabetes (preferably type 1), obesity, and cardiovascular disease. Accumulation of fatty acids in the liver leads to increased stress (increased IFN-γ), tissue inflammation, and subsequent damage to hepatocytes, resulting in decreased healthy AAT secretion levels. As with other types of liver disease, it is noteworthy that AAT deficiency can lead to liver disease over time, as the accumulation of misfolded AAT in the ER of hepatocytes eventually leads to liver failure.

[0154] In this invention, the spike protein initiating protease can be any protease capable of initiating the spike protein of a virus (preferably a coronavirus, more preferably SARS-CoV-2). Preferably, the spike protein initiating protease is at least one selected from the group consisting of: transmembrane protease serine isoform 2 (TMPRSS2), transmembrane protease isoform 6 (TMPRSS6), cathepsin L, cathepsin B, proprotein convertase 1 (PC1), trypsin, elastase, neutrophil elastase, proteolytic enzyme, and furin protease, more preferably TMPRSS2, cathepsin L, and furin protease, and even more preferably cathepsin L or furin protease. The spike protein initiating protease is furin protease, also known as a pairing basic amino acid cleaving (PACE) enzyme.

[0155] The higher levels of at least one spike protein initiating protease (preferably cathepsin L) described herein are preferably mRNA levels or protein levels in human plasma. The plasma concentration of cathepsin L in healthy subjects was 0.2 ng / mL to 1 ng / mL (i.e., 10 pM to 50 pM when the molecular weight is about 23 kDa to 24 kDa; (Kirschke 1977 https: / / febs.onlinelibrary.wiley.com / doi / 10.1111 / j.1432-1033.1977.tb11393.x). Furthermore, immune cells are known to be the primary source of extracellular cysteine ​​cathepsins in inflammation, including in the brain (Hayashi et al., 2013, von Bernhardi et al., 2015, Wendt et al., 2008, Wendt et al., 2007). In human plasma, the level of at least one spike protein initiating protease described herein is preferably higher than 0.2, 0.5, or 1 ng / mL. The level of at least one spike protein initiating protease described herein is preferably higher than 10 pM, 20 pM, or 30 pM. pM, 40 pM, 50 pM, 75 pM, or 100 pM, preferably higher than 10 pM or 50 pM, and even more preferably higher than 50 pM. In this regard, the at least one spike protein initiating protease is preferably cathepsin L. In some aspects, the at least one spike protein initiating protease described herein is at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, or at least nine spike protein initiating proteases. In some aspects, the at least one spike protein initiating protease described herein is at least one protease selected from the group consisting of: TMPRSS2, cathepsin B, cathepsin L, trypsin, furin, PC1, proteolytic enzymes, elastase, and neutrophil elastase. In some aspects, the at least one spike protein initiating protease described herein is at least one protease selected from the group consisting of: TMPRSS2, cathepsin B, cathepsin L, trypsin, furin, PC1, and proteolytic enzymes.

[0156] In some respects, the present invention relates to compositions for use according to the invention, wherein higher levels of at least one spike protein initiating protease are caused by age and / or genetic predisposition.

[0157] Higher levels of at least one spike protein initiating protease can be caused by age and / or genetic predisposition. In particular, higher levels of cathepsin B and cathepsin L, preferably cathepsin B, are age-related. Higher spike protein levels, especially cathepsin B and cathepsin L, more preferably cathepsin B, can accumulate in lysosomes. In target subjects aged 50 years or older, preferably 60 years or older, more preferably 70 years or older, even more preferably 80 years or older, and most preferably 90 years or older, spike protein initiating protease levels are higher. African American subjects may have a genetic predisposition to higher levels of spike protein initiating proteases (especially furin). As shown in Figure 2(a), HeLa cells differ from A549 cells in the relative mRNA rates of furin and cathepsin L. HeLa cells are derived from African Americans. A549 cells are derived from Caucasian airway epithelial cells. As shown in Figure 2(b), HeLa cells are more susceptible to SARS-CoV-2 entry than A549 cells (Figure 6) and have a lower response to AAT treatment. Genetic predisposition can be determined by analyzing the genetic profiles of individual subjects.

[0158] In some respects, the present invention relates to compositions for use according to the invention, wherein higher ACE2 receptor levels are caused by at least one selected from the group consisting of infection, inflammation, age, and genetic predisposition.

[0159] The elevated ACE2 receptor levels described herein are preferably mRNA levels in human plasma. Elevated ACE2 receptor levels can be caused by at least one of the following groups: infection, inflammation (e.g., IFN-γ), age, and genetic predisposition. Infection can be viral and / or bacterial, preferably viral, more preferably coronavirus, and even more preferably SARS or SARS-CoV-2. Another example of infection is leishmaniasis. (See Figure 4 and...) Figure 5As shown, ACE2 receptor expression is upregulated in response to higher IFN-γ levels, which in turn increase with an immune response to inflammation. Inflammation can be caused by, for example, bacterial and / or viral infections, cancer, delayed-type hypersensitivity reactions; autoimmune diseases (such as autoimmune encephalomyelitis, rheumatoid arthritis, autoimmune insulinitis (also known as type 1 diabetes), allogeneic transplant rejection and graft-versus-host disease, nonspecific inflammation, and cytokine release. Age is preferably greater than 50 years, more preferably greater than 60 years, more preferably greater than 70 years, even more preferably greater than 80 years, and most preferably greater than 90 years. An example of a genetic predisposition to high IFN-γ levels is familial Mediterranean fever. Genetic predisposition can be determined by the genomic mapping of the target individual subject. The higher ACE2 receptor levels described herein can also be found in tissues selected from the group consisting of: lung (Calu3), colon (CaCo2), liver (HEPG2), kidney (HEK-293T), and brain (SH-SY5Y), as confirmed by qPCR and the present invention. Figure 3a As shown.

[0160] In some respects, the present invention relates to compositions for use according to the invention, wherein higher IFN-γ levels are caused by at least one selected from the group consisting of infection, inflammation, age, and genetic predisposition.

[0161] According to iv), higher levels of interferon-γ (IFN-γ) are preferably protein or mRNA levels in human plasma, more preferably protein levels in human plasma. In healthy individuals, IFN-γ levels are below or close to the detection limit of the assay, for example, below 30 pg / mL to 50 pg / mL (Billau 1996; Kimura 2001). IFN-γ is produced almost entirely by natural killer (NK) cells, CD4+ lymphocytes, and some CD8+ lymphocytes. The production of IFN-γ by NK cells or T cells requires the cooperation of helper cells, primarily mononuclear phagocytes, which also need to be in some activated state (Billiau A. Interferon-gamma: biology and role in pathogenesis. Adv Immunol. 1996;62:61-130. doi:10.1016 / s0065-2776(08)60428-9). Therefore, inflammatory conditions that lead to NK cell and T cell activation result in elevated IFN-γ levels. Inflammatory conditions involving circulating NK cells or T cells (infection, cancer) are expected to result in higher plasma levels.

[0162] The table below provides plasma IFN-γ levels for several conditions.

[0163]

[0164] According to (iv), the IFN-γ protein level in human plasma is preferably higher than 1 pg / ml, 5 pg / ml, 10 pg / ml, 15 pg / ml, 20 pg / ml, 25 pg / ml, 30 pg / ml, 40 pg / ml, 50 pg / ml, 75 pg / ml, 100 pg / ml, 125 pg / ml, 150 pg / ml, 200 pg / ml, 300 pg / ml, 400 pg / ml, or 500 pg / ml. Higher IFN-γ levels are preferably caused by at least one of the groups selected from infection, inflammation, age, and genetic predisposition, more preferably by inflammation. Infection can be viral and / or bacterial, preferably viral, more preferably coronavirus, and even more preferably SARS or SARS-CoV-2 infection. Another example of infection is leishmaniasis. Inflammation can be caused by, for example, bacterial and / or viral infections, cancer, delayed-type hypersensitivity reactions; autoimmune diseases (such as autoimmune encephalomyelitis, rheumatoid arthritis, autoimmune insulinitis (also known as type 1 diabetes), allogeneic transplant rejection and graft-versus-host disease, nonspecific inflammation, and cytokine release). The age is preferably greater than 50 years, more preferably greater than 60 years, more preferably greater than 70 years, even more preferably greater than 80 years, and most preferably greater than 90 years. An example of a genetic predisposition to high IFN-γ levels is familial Mediterranean fever. Genetic predisposition can be determined through the genetic mapping of the target individual subject.

[0165] Therefore, the present invention is based at least in part on the surprising finding that compositions containing AAT and rhAAT, and their variants, isotypes and / or fragments, reduce viral proliferation and inflammation, particularly IFN-γ-related inflammation.

[0166] In one aspect, "subjects in need," that is, target subjects, have two groups selected from the following:

[0167] 1. Lower levels of endogenous α-antitrypsin (AAT) before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0168] 2. A higher level of at least one spike protein initiating protease before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0169] 3. Angiotensin-converting enzyme 2 (ACE2 receptor) levels in subjects who were asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), and

[0170] 4. Interferon-γ (IFN-γ) levels in subjects who were asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0171] Therefore, the "subjects in need" may have

[0172] 1. Lower levels of endogenous α-antitrypsin (AAT) before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one asymptomatic or mildly symptomatic subject during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), and

[0173] 2. A higher level of at least one spike protein initiating protease before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one asymptomatic or mildly symptomatic subject during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0174] Preferably, in this respect, the level of AAT protein in human plasma described herein is less than 52 μM, and the level of cathepsin L protein in human plasma is greater than 10 pM.

[0175] On the other hand, the "subjects in need" may have

[0176] 1. Lower levels of endogenous α-antitrypsin (AAT) before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), and

[0177] 2. Angiotensin-converting enzyme 2 (ACE2 receptor) levels in subjects who were asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0178] On another front, the "subjects in need" may have

[0179] 1. Lower levels of endogenous α-antitrypsin (AAT) before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one asymptomatic or mildly symptomatic subject during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), and

[0180] 2. Interferon-γ (IFN-γ) levels in subjects who were asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0181] In these aspects, 1. and 4. can be at least one disease or condition selected from the group consisting of: AAT deficiency, liver diseases such as non-alcoholic fatty liver disease, diabetes, obesity, and cardiovascular disease. In some aspects, the invention relates to compositions according to the invention, wherein higher IFN-γ levels are caused by at least one disease or condition selected from the group consisting of: AAT deficiency, liver diseases such as non-alcoholic fatty liver disease, diabetes, obesity, and cardiovascular disease. In some aspects, the invention relates to compositions according to the invention, wherein lower AAT levels are caused by at least one disease or condition selected from the group consisting of: AAT deficiency, liver diseases such as non-alcoholic fatty liver disease, diabetes, obesity, and cardiovascular disease. Diabetes can be type 1 or type 2 diabetes. Liver disease can be acetaminophen-induced liver injury, severe chronic hepatitis, alcoholic liver disease (ALD), encompassing various phenotypes including simple steatosis, steatohepatitis, liver fibrosis and cirrhosis, and even HCC (hepatocellular carcinoma). Cardiovascular conditions can be any condition caused by a sudden reduction or blockage of blood flow to the heart, myocardial infarction, acute coronary syndrome (ACS), or any condition in patients with acute myocardial infarction, where left ventricular ejection fraction is negatively correlated with serum AAT concentration, indicating that systolic dysfunction is related to the inflammatory response.

[0182] Preferably, in this respect, the level of AAT protein in human plasma described herein is less than 52 μM, and the level of IFN-γ protein in human plasma described herein is greater than 0.19 pM.

[0183] On the other hand, "subjects in need," that is, target subjects, have two groups selected from the following:

[0184] 1. A higher level of at least one spike protein initiating protease before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one asymptomatic or mildly symptomatic subject during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0185] 2. Compared with at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), subjects with higher levels of angiotensin-converting enzyme 2 (ACE2 receptor) before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), and

[0186] 3. Interferon-γ (IFN-γ) levels in subjects who were asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0187] On another front, "required subjects" may possess...

[0188] 1. A higher level of at least one spike protein initiating protease before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one asymptomatic or mildly symptomatic subject during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0189] 2. Angiotensin-converting enzyme 2 (ACE2 receptor) levels in subjects who were asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0190] On the other hand, the "subjects in need" may have

[0191] 1. A higher level of at least one spike protein initiating protease before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one asymptomatic or mildly symptomatic subject during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), and

[0192] 2. Interferon-γ (IFN-γ) levels in subjects who were asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0193] On the other hand, the "subjects in need" may have

[0194] 1. Compared with at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), the level of angiotensin-converting enzyme 2 (ACE2 receptor) was higher in subjects before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), and

[0195] 2. Interferon-γ (IFN-γ) levels in subjects who were asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0196] On the other hand, the “subjects in need,” i.e., the target subjects, have three groups selected from the following:

[0197] 1. Lower levels of endogenous α-antitrypsin (AAT) before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0198] 2. A higher level of at least one spike protein initiating protease before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0199] 3. Compared with at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), subjects with higher levels of angiotensin-converting enzyme 2 (ACE2 receptor) before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), and

[0200] 4. Interferon-γ (IFN-γ) levels in subjects who were asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0201] Therefore, the "subjects in need" may have

[0202] 1. Lower levels of endogenous α-antitrypsin (AAT) before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0203] 2. A higher level of at least one spike protein initiating protease before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0204] 3. Angiotensin-converting enzyme 2 (ACE2 receptor) levels in subjects who were asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0205] On the other hand, the "subjects in need" may have

[0206] 1. Lower levels of endogenous α-antitrypsin (AAT) before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0207] 2. Higher levels of at least one spike protein initiating protease before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one asymptomatic or mildly symptomatic subject during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), and

[0208] 3. Interferon-γ (IFN-γ) levels in subjects who were asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0209] Preferably, in this respect, the level of AAT protein in human plasma described herein is less than 36 μM, the level of cathepsin L protein in human plasma described herein is greater than 10 pM, and the level of IFN-γ protein in human plasma described herein is greater than 0.19 mM.

[0210] More preferably, in this respect, the level of AAT protein in human plasma described herein is less than 52 μM, the level of cathepsin L protein in human plasma described herein is greater than 10 pM, and the level of IFN-γ protein in human plasma described herein is greater than 0.19 mM.

[0211] On the other hand, the "subjects in need" may have

[0212] 1. A higher level of at least one spike protein initiating protease before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one asymptomatic or mildly symptomatic subject during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0213] 2. Compared with at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), subjects with higher levels of angiotensin-converting enzyme 2 (ACE2 receptor) before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), and

[0214] 3. Interferon-γ (IFN-γ) levels in subjects who were asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0215] On the other hand, the "subjects in need," i.e., the target subjects, have

[0216] 1. Lower levels of endogenous α-antitrypsin (AAT) before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0217] 2. A higher level of at least one spike protein initiating protease before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0218] 3. Compared with at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), subjects with higher levels of angiotensin-converting enzyme 2 (ACE2 receptor) before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), and

[0219] 4. Interferon-γ (IFN-γ) levels in subjects who were asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection) compared to at least one subject who was asymptomatic or had mild symptoms during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection).

[0220] The AAT protein in the composition used in this invention may be a plasma AAT protein, its variants, isotypes, and / or fragments; or a recombinant AAT protein, its variants, isotypes, and / or fragments. Preferably, the AAT protein, its variants, isotypes, and / or fragments, is a recombinant AAT protein, its variants, isotypes, and / or fragments. The plasma AAT protein is preferably derived from plasma AAT protein, more preferably from human plasma (also referred to as AAT extracted from human plasma). In some aspects, this invention relates to compositions according to the invention, wherein the α1-antitrypsin (AAT) protein, its variants, isotypes, and / or fragments, is a recombinant α1-antitrypsin (also referred to as rhAAT), its variants, isotypes, and / or fragments.

[0221] Recombinant AAT protein is produced by recombination in, for example, CHO cells, HEK cells (HEK293 and / or HEK293T), or E. coli cells. Pharmaceutical companies worldwide extract AAT protein from human plasma for the treatment of AAT deficiency (a genetic disorder). The FDA and EMA have approved plasma-derived AAT. Preferably, the AAT protein of the present invention has a human amino acid sequence; most preferably, the AAT protein of the present invention is as shown in SEQ ID NO: 1 (see Table 1). Recombinant AAT proteins, variants, isotypes, and / or fragments thereof preferably do not contain an Fc domain and / or a histidine tag (His tag).

[0222] The inventors discovered that recombinant AAT (rhAAT produced in CHO) binds to AAT antibodies with different affinities (Figure 17) and exhibits more significant biological effects than plasma-derived AAT. Specifically, recombinant AAT (rhAAT) inhibits ACE2 / spike protein-mediated cell fusion more effectively than plasma-derived AAT. Figure 14 ), and have different enzyme inhibition properties (Figure 16).

[0223] Therefore, the present invention is based at least in part on the surprising discovery that recombinant AAT (rhAAT) produced in CHO cells is particularly effective in the treatment and / or prevention of diseases or syndromes associated with viral infections, preferably coronavirus infections, more preferably SARS-CoV-2 infections.

[0224] In some respects, the present invention relates to compositions for use according to the invention, wherein the α1-antitrypsin (AAT) protein, variants, isotypes and / or fragments thereof, is a recombinant α1-antitrypsin produced in human cells (e.g., HEK293 or HEK293T cells, see Example 23).

[0225] The inventors discovered that, compared with recombinant AAT (rhAAT) produced in CHO cells and plasma-derived AAT, recombinant AAT (rhAAT without the His tag) produced in human cells, particularly HEK293, reduced cathepsin L (… Figure 16b ), trypsin ( Figure 16c ), furin protease ( Figure 16d ) and neutrophil elastase ( Figure 16i It is particularly effective in terms of enzyme activity.

[0226] Therefore, the present invention is based at least in part on the surprising discovery that recombinant AAT produced in human cells, particularly HEK293, is particularly effective in the treatment and / or prevention of diseases or syndromes associated with viral infections, preferably coronavirus infections, more preferably SARS-CoV-2 infections.

[0227] In some aspects, the present invention relates to compositions according to the use of the invention, wherein the α1-antitrypsin (AAT) protein, variants, isotypes, and / or fragments thereof, is a recombinant α1-antitrypsin (rhAAT produced in CHO) having a more extensive non-human glycan profile. In some aspects, the non-human glycan profile described herein is a glycan profile derived from mammalian cells and / or a glycoengineered glycan profile. Glycan engineering strategies, such as those for reducing fucosylation of glycoproteins and / or enhancing sialylation of glycoproteins, are known to those skilled in the art. In some aspects, the non-human glycan profile described herein is a glycan profile derived from CHO cells. The glycosylation mechanism expressed in CHO cells differs from that in human cells, resulting in a different composition of the surface glycans of the recombinant protein ( Figure 24 ) (Lalonde, ME, & Durocher, Y., 2017, Journal of biotechnology, 251, 128-140).

[0228] In some aspects, the present invention relates to compositions for use according to the invention, wherein the AAT protein, variants, isotypes and / or fragments thereof are recombinant AAT, variants, isotypes and / or fragments thereof produced by pXC-17.4 (GS System, Lonza).

[0229] The inventors discovered that, compared with plasma-derived α1-protease inhibitors (plasma-derived AAT) and recombinant AAT produced in CHO via PL136 / PL137 (pCGS3, Merck) (recombinant AAT 2), recombinant AAT produced in CHO via pXC-17.4 (GS System, Lonza) induced inhibition of elastase (…). Figure 16h) and neutrophil elastase ( Figure 16i The activity of ) has a more obvious inhibitory effect.

[0230] Therefore, the present invention is based at least in part on the surprising discovery that certain forms of recombinant AAT (rhAAT) are particularly effective in the treatment and / or prevention of diseases or syndromes associated with viral infections, preferably coronavirus infections, more preferably SARS-CoV-2 infections.

[0231] As used herein, a “fragment” of the AAT protein, peptide, or polypeptide of the present invention refers to a sequence containing fewer amino acids in length than the AAT protein, peptide, or polypeptide of the present invention, particularly a sequence containing fewer amino acids than the AAT sequence shown in SEQ ID NO:1. The fragment is preferably a functional fragment, for example, a fragment having the same biological activity as the AAT protein shown in SEQ ID NO:1. The functional fragment is preferably derived from the AAT protein shown in SEQ ID NO:1. Any AAT fragment can be used, provided it exhibits the same properties (i.e., has biological activity) as its source, the native AAT sequence.

[0232] Preferably, the (functional) fragment shares about 5 consecutive amino acids, at least about 7 consecutive amino acids, at least about 15 consecutive amino acids, at least about 20 consecutive amino acids, at least about 25 consecutive amino acids, at least about 20 consecutive amino acids, at least about 30 consecutive amino acids, at least about 35 consecutive amino acids, at least about 40 consecutive amino acids, at least about 45 consecutive amino acids, at least about 50 consecutive amino acids, at least about 55 consecutive amino acids, at least about 60 consecutive amino acids, at least about 100 consecutive amino acids, at least about 150 consecutive amino acids, at least about 200 consecutive amino acids, at least about 300 consecutive amino acids, etc., and more than the natural human AAT amino acid sequence shown in SEQ ID NO:1. In some aspects, the (functional) fragment described herein contains an expression-optimized signaling protein (e.g., Example 24).

[0233] The functional AAT fragment may comprise or consist of the C-terminal fragment of AAT as shown in SEQ ID NO:2. The C-terminal fragment of SEQ ID NO:2 consists of amino acids 374 to 418 of SEQ ID NO:1.

[0234] More preferably, the AAT fragment is a fragment containing fewer amino acids in length than the C-terminal AAT sequence 374 to 418 (SEQ ID NO:2). Alternatively, the AAT fragment consists essentially of SEQ ID NO: 2.

[0235]

[0236] The term "variant" refers to a protein, peptide, or polypeptide having an amino acid sequence that differs to some extent from the native AAT sequence peptide, i.e., an amino acid sequence that differs from the native AAT sequence through amino acid substitution, wherein one or more amino acids are replaced by another amino acid having the same characteristics and conformational function. Preferably, the variants of the present invention are at least 99%, 98%, 97%, 96%, 95%, 90%, or 85% homologous to the amino acids of SEQ ID NO: 1 or SEQ ID NO: 2. The variants may also have at least 99%, 98%, 97%, 96%, 95%, 90%, or 85% sequence identity to the amino acids of SEQ ID NO: 1 or SEQ ID NO: 2. Amino acid sequence variants may have substitutions, deletions, and / or insertions at certain positions within the amino acid sequence of the native amino acid sequence (e.g., at the N- or C-terminal sequence or within the amino acid sequence). Substitutions may also be conservative, in which case conservative amino acid substitutions are defined herein as exchanges within one of the following five groups:

[0237] I. Small aliphatic nonpolar or weakly polar residues: Ala, Ser, Thr, Pro, Gly

[0238] II. Polar, positively charged residues: His, Arg, Lys

[0239] III. Polar, negatively charged residues: and their amides: Asp, Asn, Glu, Gln

[0240] IV. Large aromatic residues: Phe, Tyr, Trp

[0241] V. Large aliphatic nonpolar residues: Met, Leu, Ile, Val, Cys.

[0242] "Homology" refers to the percentage of similarity between two polynucleotide or polypeptide sequences. Two nucleic acid sequences or two polypeptide sequences are considered "substantially homologous" to each other when they exhibit at least about 50% sequence similarity over a defined molecular length, preferably at least about 75%, more preferably at least about 80% or at least about 85%, more preferably at least about 90%, and most preferably at least about 95% to 98%. As used herein, substantially homologous also means a sequence that shows complete similarity to the specified sequence.

[0243] Typically, "identity" refers to the exact correspondence between nucleotides or amino acids of two polynucleotide or polypeptide sequences. The percentage of identity can be determined by directly comparing the sequence information between two molecules. Through sequence alignment, the exact number of matches between the two aligned sequences is calculated, divided by the length of the shorter sequence, and the result is multiplied by 100.

[0244] Alternatively, homology can be determined by readily available computer programs or by hybridization of polynucleotides under conditions that allow for the formation of stable double strands between homologous regions, followed by digestion with a single-strand-specific nuclease and determination of the size of the digested fragments. Fundamentally homologous DNA sequences can be identified in Southern hybridization experiments under, for example, stringent conditions defined for that specific system. Determining suitable hybridization conditions is within the scope of the art.

[0245] In some aspects, the present invention relates to compositions for use according to the invention, wherein the α1-antitrypsin fragment is a C-terminal sequence fragment, or any combination thereof.

[0246] The peptide variant can be a linear peptide or a cyclic peptide, and can be selected from the group comprising short cyclic peptides derived from the C-terminal sequence shown in SEQ ID No. 2. Preferably, the short cyclic peptide derived from the C-terminal sequence of α1-antitrypsin will be selected from the non-limiting group comprising cyclic-(CPFVFLM)-SH, cyclic-(CPFVFLE)-SH, cyclic-(CPFVFLR)-SH and cyclic-(CPEVFLM)-SH or any combination thereof.

[0247] As used herein, the “isotype” of the AAT protein, peptide, or polypeptide of the present invention refers to a splice variant produced by alternative splicing of AAT mRNA.

[0248] In some respects, the amino acid sequences of the AAT, its variants, isotypes, or fragments described herein are at least 80% identical to the corresponding amino acid sequences in SEQ ID NO:1. In some respects, the amino acid sequences of the AAT, its variants, isotypes, or fragments are 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the corresponding amino acid sequences in SEQ ID NO:1.

[0249] The peptides of the present invention, their isotypes, fragments or variants, may preferably be conjugated with agents that increase the accumulation of the peptides, their isotypes, fragments or variants in target cells (preferably respiratory cells). Such agents can be compounds that induce receptor-mediated endocytosis, such as endocytosis of transferrin conjugated with therapeutic drugs mediated by membrane transferrin receptors (Qian ZM et al., “Targeted drug delivery via the transferrin receptor-mediated endocytosis pathway” Pharmacological Reviews, 54, 561, 2002), or such agents can be cell membrane-permeable carriers selected from, for example, fatty acids such as decanoic acid, myristic acid, and stearic acid, which have been used for intracellular delivery of peptide inhibitors of protein kinase C (Ioannides CG et al., “Inhibition of IL-2 receptor induction and IL-2 production in the human leukemic cell line Jurkat by a novel peptide inhibitor of protein kinase C” Cell Immunol., 131, 242, 1990) and protein tyrosine phosphatase (Kole HK et al., “Apeptide-based protein-tyrosine phosphatase”). (The inhibitor specifically enhances insulin receptor function in intact cells (J. Biol. Chem. 271, 14302, 1996) or the carrier may be selected from peptides. Preferably, a cell membrane-permeable carrier is used. More preferably, a cell membrane-permeable carrier peptide is used.

[0250] When the cell membrane permeable carrier is a peptide, it is preferably a peptide rich in positively charged amino acids.

[0251] Preferably, this peptide rich in positively charged amino acids is an arginine-rich peptide. Futaki et al. (Futaki S. et al., “Arginine-rich peptides. An abundant source of membrane-permeable peptides having potential as carriers for intracellular protein delivery” J. Biol. Chem., 276, 5836, 2001) have demonstrated that the number of arginine residues in membrane-permeable carrier peptides has a significant impact on the internalization method, and there appears to be an optimal number of arginine residues for internalization; preferably, they contain more than 6 arginine residues, more preferably, they contain 9 arginine residues. Arginine-rich peptides preferably contain at least 6 arginine residues, more preferably at least 9 arginine residues.

[0252] The peptide, its isotype, fragment, or variant, can be conjugated to a cell membrane-permeable carrier via a spacer group (e.g., two glycine residues). In this case, the cell membrane-permeable carrier is preferably a peptide.

[0253] Typically, arginine-rich peptides are selected from the non-restricted group including: HIV-TAT 48-57 peptide (GRKKRRQRRR; SEQ ID NO. 7), FHV shell 35-49 peptide (RRRRNRTRRNRRRVR; SEQ ID NO. 8), HTLV-II Rex 4-16 peptide (TRRQRTRRARRNR; SEQ ID NO. 9), and BMV gag 7-25 peptide (SEQ ID NO. 10).

[0254] Any cell membrane permeable carrier can be used, depending on the technician's decision.

[0255] Because of the inherent problem that natural peptides (L-type) are susceptible to degradation by natural proteases, the peptides of the present invention, their isotypes, fragments, or variants, as well as cell membrane-permeable peptides, can be prepared as D-type and / or "retro-inverso isomers" comprising the peptide. In this case, fragments and variants of the peptides of the present invention, as well as retro-inverso isomers of cell membrane-permeable peptides, were prepared.

[0256] The peptides of the present invention, their isotypes, fragments, or variants, can be prepared by a variety of methods and techniques known in the art, such as chemical synthesis or recombination techniques, as described in Maniatiset al. 1982, Molecular Cloning, A laboratory Manual, Cold Spring Harbor Laboratory, wherein the peptides, their isotypes, fragments, or variants are optionally conjugated with an agent that increases the accumulation of the peptide in cells.

[0257] Preferably, the peptides of the present invention are recombined in a cell expression system, including isotypes, fragments, or variants thereof, which are optionally conjugated with an agent that increases the accumulation of said peptide in cells. A variety of single-cell host cells can be used to express the DNA sequences of the present invention. These hosts may include well-known eukaryotic and prokaryotic hosts, such as *Escherichia coli* (E. coli). E. coli ), Pseudomonas ( Pseudomonas ), Bacillus ( Bacillus Streptomyces ( Streptomyces Fungal strains such as yeast, as well as animal cells such as CHO, YB / 20, NSO, SP2 / 0, Rl.1, BW and LM cells, African green monkey kidney cells (e.g. COS 1, COS 7, BSC1, BSC40 and BMT10), insect cells (e.g. Sf9), and human and plant cells in tissue culture.

[0258] The "therapeutic effective dose or therapeutic effective amount" of the α1-antitrypsin protein of the present invention, its variants, isotypes and / or fragments, refers to the amount that, when administered, produces a positive therapeutic or preventive response in a subject to treatment of a disease or syndrome associated with coronavirus infection.

[0259] The term "coronavirus infection" can refer to an infection caused by a coronavirus selected from the group comprising MERS-CoV, SARS-CoV, and SARS-CoV-2 and any variants thereof. In some respects, the SARS-CoV-2 variants referred to herein are SARS-CoV-2 variants selected from the group consisting of: lineage B.1.1.207, lineage B.1.1.7, cluster 5, 501.V2 variant, lineage P.1, lineage B.1.429 / CAL.20C, lineage B.1.427, lineage B.1.526, lineage B.1.525, lineage B.1.1.317, lineage B.1.1.318, lineage B.1.351, lineage B.1.617, and lineage P.3. In some respects, the SARS-CoV-2 variants described herein are SARS-CoV-2 variants selected from the Nextstrain clade of the following groups: 19A, 20A, 20C, 20G, 20H, 20B, 20D, 20F, 20I, and 20E. In some respects, the SARS-CoV-2 virus described herein is a SARS-CoV-2 variant containing at least one mutation selected from the following groups: D614G, E484K, N501Y, S477G / N, P681H, E484Q, L452R, and P614R. In some respects, the SARS-CoV-2 variants described herein are SARS-CoV-2 variants derived from the variants described herein. In some respects, the SARS-CoV-2 virus described herein is a SARS-CoV-2 variant that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity with the viral genome sequence of at least one SARS-CoV-2 variant described herein.

[0260] Coronavirus infection can cause respiratory tract infection, leading to a disease or syndrome as a respiratory syndrome. The respiratory syndrome can be severe acute respiratory syndrome (SARS). In some respects, SARS-CoV-2 infection is at least one of three distinguishable clinical courses of infection: (1) a mild illness with upper respiratory tract manifestations, (2) non-life-threatening pneumonia, and (3) a severe illness with pneumonia, acute respiratory distress syndrome (ARDS), severe systemic inflammation, organ failure, or cardiovascular complications.

[0261] The compositions used for purposes of this invention may also contain one or more pharmaceutically acceptable diluents or carriers.

[0262] "Pharmaceutically acceptable diluents or carriers" refers to carriers or diluents used in the preparation of pharmaceutical compositions that are generally safe, non-toxic, and desirable, and include carriers or diluents acceptable for human pharmaceutical use.

[0263] Pharmaceutically acceptable carriers of this type can be sterile liquids, such as water and oils, including those of petroleum, animal, plant, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc. Water is the preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions, as well as aqueous glucose solutions and glycerol solutions, can also be used as liquid carriers, especially for injectable solutions.

[0264] Pharmaceutically acceptable diluents or carriers include starch, glucose, lactose, sucrose, sodium stearate, glyceryl monostearate, talc, sodium chloride, skim milk powder, glycerin, propylene glycol, water, ethanol, etc.

[0265] The pharmaceutical composition may also contain one or more pharmaceutically acceptable salts, such as inorganic acid salts like hydrochloride, hydrobromide, phosphate, sulfate, etc.; and organic acid salts like acetate, propionate, malonate, benzoate, etc. Furthermore, excipients such as wetting agents or emulsifiers, pH buffers, gelling or gelling materials, flavoring agents, coloring agents, microspheres, polymers, suspending agents, etc., may also be present herein. In addition, one or more other conventional pharmaceutical ingredients may be present, such as preservatives, humectants, suspending agents, surfactants, antioxidants, anti-caking agents, fillers, chelating agents, coating agents, chemical stabilizers, etc., especially if the dosage form is reconfigurable. Suitable exemplary ingredients include microcrystalline cellulose, sodium carboxymethyl cellulose, polysorbate 80, phenethyl alcohol, chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, p-hydroxybenzoate, ethyl vanillin, glycerin, phenol, p-chlorophenol, gelatin, albumin, and combinations thereof. Pharmaceutically acceptable excipients are discussed in detail in Remington's Pharmaceutical Sciences (Mack Pub. Co., NJ 1991), which is incorporated herein by reference.

[0266] Alternatively, the pharmaceutical compositions of the present invention may further comprise one or more additional therapeutic agents. Preferably, the one or more therapeutic agents comprise therapeutically effective amounts of one or more nucleoside analogs, protease inhibitors, immunosuppressants (e.g., thalidomide or tocilizumab), chloroquine, hydroxychloroquine antibiotics, antibodies or fragments thereof targeting viral structural components (e.g., passive immunotherapy), interferon beta (e.g., interferon beta-1a), and / or vaccines.

[0267] In some other aspects, the pharmaceutical compositions of the present invention and one or more additional therapeutic agents are administered substantially simultaneously or concurrently. For example, a subject may be given the pharmaceutical composition for use with the present invention while simultaneously receiving treatment with one or more additional therapeutic agents. Furthermore, it is anticipated that the subject has already received or may receive other forms of antiviral therapy concurrently.

[0268] In some respects, the additional therapeutic agent can be used to reduce potential side effects associated with the administration of the antibody or its antigen-binding fragment of the present invention.

[0269] In some respects, the additional therapeutic agent may be used to support the effects associated with the administration of the antibody or its antigen-binding fragment of the present invention.

[0270] In some respects, the administration of additional therapeutic agents and the antibodies or antigen-binding fragments of the present invention can lead to synergistic effects in terms of desired efficacy and / or side effects.

[0271] In some respects, the additional therapeutic agents described herein are at least one agent selected from the group consisting of nucleoside analogs, protease inhibitors, and immunomodulators such as immunosuppressants.

[0272] In some respects, the additional therapeutic agents described herein are at least one agent selected from the group consisting of: nucleoside analogs, protease inhibitors, immunosuppressants (e.g., thalidomide or tocilizumab), chloroquine, hydroxychloroquine antibiotics, antibodies or fragments thereof targeting viral structural components (e.g., passive immunotherapy), interferon beta (e.g., interferon beta-1a), and / or vaccines.

[0273] Non-limiting examples of nucleoside analogues include ribavirin, remdesivir, β-d-N4-hydroxycytidine, BCX4430, gemcitabine hydrochloride, 6-azauridine, mizoribine, acyclovir fleximer, and one or more combinations thereof.

[0274] Non-limiting examples of protease inhibitors include HIV protease inhibitors and / or HCV protease inhibitors.

[0275] In some respects, the immunomodulators described herein are interferon beta. In other respects, the immunomodulators described herein are interferon beta-1a. Non-limiting examples of immunosuppressants include interleukin inhibitors, such as inhibitors of IL-6 (e.g., thalidomide or tocilizumab), IL-1, IL-12, IL-18, and TNF-α.

[0276] The additional therapeutic agent may improve or complement the therapeutic effects of the compositions and methods described herein (see, for example, Figure 20). Figure 11d ).

[0277] Therefore, the present invention is based at least in part on the finding that certain combinations (such as IFN-β-1a and AAT) improve the effect of AAT on viral entry and inflammation.

[0278] The present invention also contemplates gene delivery vectors and pharmaceutical compositions containing such vectors. Preferably, the gene delivery vector is in the form of a plasmid or vector containing one or more nucleic acids encoding one or more variants, isotypes, and / or fragments of the AAT protein of the present invention. Examples of such gene delivery vectors include, for example, viral vectors, non-viral vectors, particulate carriers, and liposomes. The gene delivery is preferably performed in vitro (…). in vitro ) or in vitro ( ex vivo )conduct.

[0279] Therefore, this invention is based at least in part on the finding that AAT gene delivery (gene therapy) reduces inflammatory effects (see, for example...). Figure 19b ).

[0280] In one aspect, the viral vector is suitable for both in vitro and in vivo gene delivery, preferably suitable for in vitro gene delivery. More preferably, the viral vector is selected from the group consisting of adeno-associated viruses (AAVs) and lentiviruses such as first-, second-, and third-generation lentiviruses, without excluding other viral vectors such as adenovirus vectors, herpesvirus vectors, etc. Other delivery methods or media are known (e.g., yeast systems, microvesicles, gene guns / methods of attaching vectors to gold nanoparticles) and have been provided. In some aspects, one or more viral vectors or plasmid vectors can be delivered by liposomes, nanoparticles, exosomes, microvesicles, or gene guns.

[0281] In other aspects of the invention, the pharmaceutical compositions of the invention are sustained-release formulations, or formulations administered using a sustained-release device. Such devices are well known in the art and include, for example, transdermal patches and micro-implantable pumps, which can deliver drugs in multiple doses over time in a continuous, steady-state manner to achieve the sustained-release effect of non-sustained-release pharmaceutical compositions.

[0282] The pharmaceutical compositions of the present invention can be administered to subjects via various routes, including oral, parenteral, sublingual, transdermal, transrectal, transmucosal, topical, inhalation, buccal administration, intrapleural, intravenous, intraarterial, intraperitoneal, subcutaneous, intramuscular, intranasal, intrathecal, and intra-articular administration, or combinations thereof. For human use, the compositions can be administered as suitable and acceptable formulations according to normal human practice. Skilled personnel will readily determine the dosing regimen and route of administration most suitable for a particular patient. The compositions of the present invention can be administered via conventional syringes, needle-free injection devices, microparticle bombardment guns, or other physical methods such as electroporation (“EP”), hydrodynamic methods, or ultrasound. The compositions can also be administered via intravenous injection, intravenous infusion, dosing pump infusion, inhaled nasal spray, eye drops, skin patches, sustained-release formulations, in vitro gene therapy, or in vitro cell therapy, preferably via intravenous injection.

[0283] The pharmaceutical compositions of the present invention can also be delivered to patients via a variety of technologies, including DNA injection (also known as DNA vaccination) of nucleic acids encoding the AAT protein of the present invention, variants, isotypes and / or fragments thereof, using or without in vivo electroporation; liposome-mediated, nanoparticle-assisted recombinant vectors, such as recombinant lentiviruses described herein.

[0284] The composition can be injected intravenously or locally into the lungs or respiratory tract, or injected into the target tissue via electroporation.

[0285] The present invention also provides a method for treating and / or preventing disease or syndrome associated with coronavirus infection in subjects in need, the method comprising administering a therapeutically effective amount of i) the α1-antitrypsin protein described herein, its variants, isotypes and / or fragments, or ii) a pharmaceutical composition described herein for use in the present invention.

[0286] Also provided is a method for modulating the onset of coronavirus infection in subjects exposed to or suspected of being exposed to coronavirus, the method comprising administering to a subject requiring such treatment a therapeutically effective amount of i) α1-antitrypsin protein, variants, isotypes and / or fragments thereof as described herein, or ii) a pharmaceutical composition as described herein for use in the present invention.

[0287] The present invention also relates to determining the susceptibility of target subjects to treatment and / or prevention of a disease or syndrome associated with a viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), said treatment and / or prevention using a composition comprising a therapeutically effective amount of α1-antitrypsin (AAT) protein, its variants, isotypes, and / or fragments as defined herein, comprising the following steps:

[0288] a) Determine the level of at least one of the following in the target subject prior to or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), consisting of endogenous α1-antitrypsin, at least one spike protein initiating protease, ACE2 receptor, and interferon-γ.

[0289] (b) Determine the level of at least one of the following groups in at least one reference subject during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection): endogenous α1-antitrypsin, at least one spike protein initiating protease, ACE2 receptor, and interferon-γ, wherein the reference subject is asymptomatic or has mild symptoms.

[0290] c) Compare the target level determined in step a) with the reference level determined in step b).

[0291] If the target subject has at least one of the following characteristics, the target subject is more sensitive to treatment and / or prevention of diseases or syndromes associated with viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection):

[0292] 1. A target level of endogenous α-antitrypsin (AAT) that is lower than the reference level of endogenous AAT.

[0293] 2. A target level of at least one spike protein initiating protease that is higher than a reference level of the at least one spike protein initiating protease.

[0294] 3. A target level of angiotensin-converting enzyme 2 (ACE2 receptor) that is higher than the reference level of the angiotensin-converting enzyme 2 receptor, and

[0295] 4. A target level of interferon-γ (IFN-γ) that is higher than the reference level of interferon-γ.

[0296] All definitions and combinations provided herein, if applicable and unless otherwise stated, apply to this respect.

[0297] The present invention also relates to a method for determining a therapeutically effective amount of α1-antitrypsin (AAT) for the effective treatment and / or prevention of diseases or syndromes associated with viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection), said treatment and / or prevention using a composition for the purposes of the present invention, said method comprising the following steps:

[0298] a) Determine the level of endogenous α1-antitrypsin in target subjects before or during viral infection (preferably coronavirus infection, more preferably SARS-CoV-2 infection),

[0299] b) Determine the amount of AAT in the composition that is required to achieve an AAT level of at least 10 μM, preferably at least 20 μM, more preferably at least 50 μM, even more preferably at least 100 μM, and most preferably at least 200 μM in the subject.

[0300] All definitions and combinations provided herein, if applicable and unless otherwise stated, apply to this respect.

[0301] In some aspects, the present invention relates to a method according to the invention, wherein the virus is a coronavirus. In some aspects, the present invention relates to a method according to the invention, wherein the virus is SARS-CoV-2. In some aspects, the present invention relates to a method according to the invention, wherein the disease or syndrome is a respiratory syndrome or severe acute respiratory syndrome. In some aspects, the present invention relates to a method according to the invention, wherein the disease or syndrome is an inflammatory disease of the nervous system or a nervous system syndrome. In some aspects, the present invention relates to a method according to the invention, wherein the inflammatory disease of the nervous system or a nervous system syndrome is a disease or syndrome selected from the group consisting of multiple sclerosis, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's disease, and Huntington's disease.

[0302] All definitions and combinations provided herein, if applicable and unless otherwise stated, apply to these aspects.

[0303] Those skilled in the art will understand that, apart from those specifically described herein, the invention described herein is susceptible to variations and modifications. It should be understood that the invention includes all such variations and modifications without departing from its spirit or essential characteristics. The invention also includes all steps, features, compositions, and compounds individually or collectively mentioned or pointed out in this specification, as well as any combination and all combinations or any two or more of said steps or features. Therefore, this disclosure is to be considered illustrative in all respects and not restrictive, the appended claims indicate the scope of the invention, and all variations in the meaning and scope of equivalents are intended to be included within the scope of the invention. Several references are cited in this specification, each of which is incorporated herein by reference in its entirety. The foregoing description will be more fully understood with reference to the following examples. Attached Figure Description

[0304] Figure 1Schematic diagram of the SARS-CoV-2 infection cycle and the role of AAT in preventing the virus from entering host cells.

[0305] Figure 2(a): Endogenous mRNA levels of cathepsin L, furin, ACE2, and TMPRSS2 in A549 and HeLa cells. The results show that neither HeLa nor A549 cells express the corresponding amounts of ACE2 mRNA and TMPRSS2. Both cell lines express furin and cathepsin L (initiating proteases from the spike proteins of SARS-CoV-1 and SARS-CoV-2).

[0306] Figure 2(b): The SARS-CoV-2 spike D614G pseudoviral variant showed increased infectivity. HeLa cells overexpressing ACE2 and / or TMPRSS2, or those not expressing ACE2 and / or TMPRSS2, were transduced with lentiviruses expressing luciferase and pseudotyped with either the SARS-CoV-2 spike wild-type (D614) or the D614G mutant (G614). Results showed that 10 μM plasma-derived AAT had no inhibitory effect on SARS-CoV-2 pseudoviral cell entry into HeLa cells overexpressing TMPRSS2, but exhibited up to 25% inhibition in HeLa cells expressing only ACE2.

[0307] Figure 3: a) Expression of the ACE2 gene in different cell lines. b) Expression of the TMPRSS2 gene in different cell lines (tissues).

[0308] Figure 4: ACE2 expression in A549 cells in response to IFN-γ treatment.

[0309] Figure 5 : Expression of ACE2 in HeLa in response to IFN-γ treatment.

[0310] Figure 6: SARS-CoV-2 pseudovirus entry experiment. a) to b) A549 cells - WT pseudovirus. a) A549-ACE2 cells with WT D614 pseudovirus. b) A549-ACE2-TMPRSS2 cells with WT D614 pseudovirus. c to d) A549 cells - spike G416 mutant pseudovirus. c) A549 ACE2 cells with mutant G416 pseudovirus. d) A549-ACE2-TMPRSS2 cells with mutant G614 pseudovirus.

[0311] Respikam = Glassia, FDA-approved plasma-derived AAT (clinical grade).

[0312] Sigma = AAT (non-GMP grade) derived from plasma purchased from Sigma.

[0313] Figure 7 At concentrations of 100 μmol and 200 μmol of AAT, 50% to 75% of SARS-CoV-2 pseudovirus entry in ACE2-enhanced A549 cells was blocked. (Respikam 100 μM in PBS 5x; Sigma 100 μM in PBS 5x; Sigma 200 μM in PBS 2.5x; Portland 100 μM in PBS 5x; Genfaxon in PBS 5x; 10 μM and 100 μM of carmostatin in 0.2% DMSO; 10 μM and 100 μM of bromhexine in 0.2% DMSO; 10 μM and 100 μM of benzenesulfonyl in 0.2% DMSO).

[0314] Figure 8 At concentrations of 100 μmol and 200 μmol of AAT, up to 45% of SARS-CoV-2 pseudovirus entry in ACE2+TMPRSS2-enhanced A549 cells was blocked. (Respikam 100 μM in PBS 5x; Sigma 100 μM in PBS 5x; Sigma 200 μM in PBS 2.5x; Portland 100 μM in PBS 5x; Genfaxon in PBS 5x; 10 μM and 100 μM of carmostatin in 0.2% DMSO; 10 μM and 100 μM of bromhexine in 0.2% DMSO; 10 μM and 100 μM of benzenesulfonyl in 0.2% DMSO).

[0315] Figure 9 ACE-2 is the host cell receptor responsible for mediating SARS-CoV-2 infection, the novel coronavirus that causes coronavirus disease 2019 (COVID-19). Treatment with a drug compound (AAT) disrupts the interaction between the virus and the receptor. (Adapted from https: / / www.rndsystems.com / resources / articles / ace-2-sars-receptor-identified).

[0316] Figure 10 SARS-CoV-2 pseudovirus entry test protocol.

[0317] Figure 11 a) b) Effects of plasma-derived AAT and recombinant AAT on the entry of SARS-CoV-2 pseudovirus into A549 human alveolar basal epithelial cells overexpressing ACE2. The most significant inhibitory effect (93.4%) was observed at 200 uM of recombinant AAT 1, which was produced in CHO cells using the vector pXC17.4 (Lonza Biologics Plc). c) Effects of other serine protease inhibitors on the entry of SARS-CoV-2 pseudovirus into A549 human alveolar basal epithelial cells overexpressing ACE2. d) The combination of 10 ng / mL IFN-β-1a with 25 uM plasma-derived AAT and recombinant AAT (recombinant AAT 1, recombinant AAT 2) produced in CHO cells showed additive inhibitory effects in the SARS-CoV-2 pseudovirus entry assay.

[0318] Figure 12 a) b) Effects of plasma-derived AAT and recombinant AAT on the entry of SARS-CoV-2 pseudovirus into HeLa human cervical cancer cells overexpressing ACE2. c) Effects of other serine protease inhibitors on the entry of SARS-CoV-2 pseudovirus into HeLa human cervical cancer cells overexpressing ACE2.

[0319] Figure 13 A schematic diagram of the SARS-CoV-2 spike fusion assay.

[0320] Figure 14 SARS-CoV-2 spike fusion assay in HeLa human cervical cancer cells overexpressing ACE2 and small fragment luciferase or SARS-CoV-2 spike and large fragment luciferase. Recombinant AAT (rhAAT) (recombinant AAT 1 and recombinant AAT 2) generated in CHO cells showed better inhibition of SARS-CoV-2 spike-mediated cell fusion than plasma-derived AAT.

[0321] Figure 15 a) qPCR analysis of spike protein initiating protease gene expression in human lung cell lines b) qPCR analysis of ACE2 gene expression in human lung cell lines (Calu 3 and A549) showed no endogenous expression of ACE2 in the A549 cell line c) qPCR analysis of TMPRSS2 gene expression in human lung cell line (A549) and colon cell line (Caco 2) showed no endogenous expression of TMPRSS2 in the A549 cell line d) e) Relative quantitative qPCR analysis of spike protein initiating protease gene expression in various human cell lines (tissues). Clearly, lung-derived cells showed the highest copy numbers of trypsin and cathepsin B (in Calu 3 and A549 cells, respectively). Notably, cells derived from neural tissue (SH-SY5Y) also showed relatively high copy numbers of trypsin and cathepsin B.

[0322] Figure 16 a) AAT and rhAAT inhibit cathepsin B protease activity; b) AAT and rhAAT inhibit cathepsin L protease activity, with the most significant inhibition observed in recombinant AAT (recombinant AAT 4) produced in HEK293 cells using pcDNA3.1(+) vector; c) AAT and rhAAT inhibit trypsin protease activity, with the most significant inhibition observed in recombinant AAT (recombinant AAT 4) produced in HEK293 cells using pcDNA3.1(+) vector; d) AAT and rhAAT inhibit furin protease activity, with the most significant inhibition observed in recombinant AAT (recombinant AAT 4) produced in HEK293 cells using pcDNA3.1(+) vector. 4) The following were observed: e) AAT and rhAAT inhibit PC1 protease activity; f) AAT and rhAAT inhibit protease activity; g) AAT and rhAAT inhibit TMPRSS2 protease activity; h) AAT and rhAAT inhibit elastase activity. The most significant inhibitory effect was observed in recombinant AAT (recombinant AAT 1) produced in CHO cells using vector pXC17.4. i) AAT and rhAAT inhibit neutrophil elastase activity. The most significant inhibitory effect was observed in recombinant AAT (recombinant AAT 4) produced in HEK293 cells using vector pcDNA3.1(+).

[0323] Figure 17. Standard curves for binding of a) plasma-derived AAT and b) recombinant AAT measured using the Octet method. Different binding affinities were observed between plasma-derived AAT and recombinant AAT generated in CHO cells using vectors PL136 and 137.

[0324] Figure 18 a) Schematic diagram of experimental timeline b) IFNγ-mediated microglia activation (inflammation).

[0325] Figure 19 a) Schematic diagram of experimental timeline b) AAT reduces IFNγ-mediated microglial activation (inflammation). The effects of plasma-derived AAT, recombinant AAT (rhAA), and cells transduced with genes expressing AAT (gene therapy) were observed.

[0326] Figure 20 a) Schematic diagram of experimental timeline b) IFNβ enhances the anti-inflammatory effect of AAT.

[0327] Figure 21 a) b) Effects of plasma-derived AAT and recombinant AAT on the entry of MERS-CoV pseudovirus into Caco2 human colorectal adenocarcinoma cells c) Effects of other serine protease inhibitors on the entry of MERS-CoV pseudovirus into Caco3 human colorectal adenocarcinoma cells.

[0328] Figure 22 a) b) Effects of plasma-derived AAT and recombinant AAT on the entry of SARS-CoV pseudovirus into A549 human alveolar basal epithelial cells overexpressing ACE2 c) Effects of other protease inhibitors on the entry of SARS-CoV pseudovirus into A549 human alveolar basal epithelial cells overexpressing ACE2.

[0329] Figure 23a a) Effects of AAT on ADAM17 activation and protein shedding b) Effects of AAT on monocyte / macrophage activation via spike protein / IgG immune complexes.

[0330] Figure 24 The molecular weight difference of AAT from different sources.

[0331] Figure 25 a) Vector map of pXC-17.4 (Lonza Biologics) b) Vector map of pJ201_AAT_native_SP (Merck) c) Vector map of pJ201_AAT_SP5 (Merck) d) Vector map of PL136 (Merck) e) Vector map of PL137 (Merck) f) Vector map of empty pCGS3 g) Vector map of pcDNA3.1(+) (GenScript)

[0332] Figure 26 The Octet method was developed for detecting AAT affinity.

[0333] All attached images: "Respikam" refers to plasma-derived AAT (clinical grade); "Sigma" refers to plasma-derived AAT; "Recombinant AAT 1" refers to AAT produced in CHO via pXC-17.4 (GS System, Lonza); "Recombinant AAT 2" refers to AAT produced in CHO via PL136 / PL137 (Merck); "Recombinant AAT 3" refers to AAT produced in HEK293T; "Recombinant AAT 4" refers to AAT produced in HEK293 via pcDNA3.1(+) (GenScript).

[0334] Example

[0335] Materials and methods

[0336] Treatment of SARS-CoV-2 infection with α1-antitrypsin (AAT)

[0337] The impact of AAT on SARS-CoV-2 infection manifests on two levels:

[0338] First, SARS-CoV-2 relies on proteases to enter cells.

[0339] Second, excessive inflammation in severe SARS-CoV-2 disease.

[0340] Importantly, this represents the three stages of COVID-19 (the disease caused by SARS-CoV-2):

[0341] Phase 1 COVID-19 (the disease caused by SARS-CoV-2, with flu-like symptoms that usually disappear within a week) does not require treatment.

[0342] The second stage of the disease is characterized by viral pneumonia, requiring hospitalization and antiviral treatment (i.e., inhibiting SARS-CoV-2 from entering cells) is the main objective of this stage to prevent further progression.

[0343] The third stage of COVID disease is characterized by acute respiratory distress syndrome (ARDS) and severe systemic inflammation; this stage requires anti-inflammatory and antiviral treatment.

[0344] According to our analysis, AAT can be used to treat stage II and III COVID-19, while prophylactic administration of AAT is to prevent stage I from progressing to stage II and III.

[0345] Example 1 - SARS-CoV-2 enters cells

[0346] SARS-CoV-2 entry is mediated by the binding of the viral spike protein to the host cell's angiotensin-converting enzyme 2 (ACE2) receptor. To recreate this biological event in vitro, lentiviral vectors encoding a reporter gene (GFP or luciferase) and expressing the spike protein on their surface were generated. Lentiviral vector entry into cells is mediated by the SARS-CoV-2 mechanism, and its efficiency was determined by the expression of the reporter gene (GFP or luciferase) in target cells (Ou, X., Liu, Y., Lei, X. et al. Characterization of spike glycoprotein of SARS-CoV-2 on virusentry and its immune cross-reactivity with SARS-CoV. Nat Commun 11, 1620, 2020). AAT was added, and the inhibition of viral entry was quantified by reading GFP and / or luciferase signals.

[0347] The transmembrane serine protease TMPRSS2 is crucial for SARS-CoV-2 infection (Toshio Hirano, MasaakiMurakami COVID-19: A New Virus, but a Familiar Receptor and Cytokine ReleaseSyndrome Immunity, 22 April 2020) and hepatitis C infection (Esumi M, Ishibashi M, Yamaguchi H, Nakajima S, Tai Y, Kikuta S, Sugitani M, Takayama T, Tahara M, Takeda M, Wakita T - Trans-membrane serine protease TMPRSS2 activates hepatitis C virus infection. Hepatology. 2015 Feb; 61(2):437-46). Hepatitis C infection can be blocked by AAT (possibly through TMPRSS2 inhibition - Esumi et al., 2020), and SARS-CoV-2 (as well as some highly pathogenic forms of influenza virus) has sequences that allow cleavage by the protease furin. This cleavage site is absent in SARS and MERS coronaviruses, indicating its crucial importance for the pathogenicity of SARS-CoV-2 (B. Coutard, C. Valle, X. de Lamballerie, B. Canard, NG Seidah, E. Decroly, Thespike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade, Antiviral Research, Volume 176, 2020). α1-Antitrypsin Portland exhibits strong and selective activity against furin (Jean F, Stella K, Thomas L, et al. alpha1-Antitrypsin Portland, a bioengineered serpin highly selective for furin: application as an antipathogenic agent). Proc Natl Acad Sci USA. 1998;95(13):7293–7298. doi:10.1073 / pnas.95.13.7293). Therefore, it is hypothesized that wild-type AAT (plasma-derived) and recombinant AAT (produced in mammalian cells, such as CHO and / or HEK cells) will exhibit furin protease activity.

[0348] experiment

[0349] Effects of AAT on the cleavage of recombinant spike protein in cells

[0350] The recombinant spike protein was added to relevant cell types (any cells expressing ACE2 and cells known in the art), and proteolytic cleavage was assessed by Western blotting. Any cell line expressing ACE2 can be used. Various target cell lines express different amounts of the ACE2 receptor, including but not limited to: Calu-3, SH-SY5Y, HEK, HT1080, A549, MRC5, Huh7, Vero81, VeroE6, HeLa, RS, and LLCMK2.

[0351] The impact of AAT on the entry of fake viruses

[0352] The pseudovirus (i.e., pseudotyped viral vector) using the SARS-CoV-2 spike protein as the viral attachment / fusion protein accurately describes the mechanism of SARS-CoV-2 entry into cells. This entry depends on two proteolytic steps inhibited by the protease inhibitor AAT. Therefore, the entry of the pseudovirus into a variety of different cell lines (preferably cell lines expressing ACE2) was investigated.

[0353] 1.3. Effect of AAT on infection of viable SARS-CoV-2 cells (live virus assay):

[0354] Following OFSP recommendations, live SARS-CoV-2 virus was tested for AAT at biosafety level 3. The virus was inoculated in vitro into cells treated with AAT or any fragment, variant, or isotype thereof, and multiple parameters, including reduced cytotoxicity and viral titer, were measured to assess efficiency. More specifically, SARS-CoV-2 cellular infection was assessed by immunofluorescence of viral proteins and quantification of cell death. This is because SARS-CoV-2 infects neural tissue (Helms J, Kremer S, Merdji H, et al. Neurologic Features in Severe SARS-CoV-2 Infection [Published online, 2020 Apr 15]. N Engl J Med. 2020; Pleasure SJ, Green AJ,Josephson SA. The Spectrum of Neurologic Disease in the Severe AcuteRespiratory Syndrome Coronavirus 2 Pandemic Infection: Neurologists Move to the Frontlines. JAMA Neurol. Published online April 10, 2020), infection of neural tissues (such as Minibran™) and neuroblastoma cells (SH-SY5Y) will be treated in combination with AAT, and is expected to alter the cytotoxicity or viral tropism of the virus.

[0355] Example 2 - Excessive inflammation in severe SARS-CoV-2 disease, also known as a “cytokine storm,” Fu Y, Cheng Y, Wu Y. Understanding SARS-CoV-2-Mediated Inflammatory Responses: From Mechanisms to Potential Therapeutic Tools [Published online, 2020 Mar 3]. VirolSin. 2020;1–6. doi:10.1007 / s12250-020-00207-4):

[0356]

[0357] experiment

[0358] 2.1. ADAM17(TACE) of SARS-CoV-2 vaccine:SARS-CoV-2 vaccine vaccine of ADAM17 vaccine(s),Vanesa Palau, Marta Riera, Maria Jose Soler, ADAM17 inhibition mayexert a Protective Effect on COVID-19, Nephrology Dialysis Transplantation, gfaa093; https: / / clinicalaffairs.umn.edu / umn-research / regulation-of-sars-cov-2-receptor-ace2-adam17; Haga S, Yamamoto N, Nakai-Murakami C, et al. Modulation of TNF-alpha-converting enzyme by the spike protein of SARS-CoV and ACE2 induces TNF-alpha production and facilitates viral entry. Proc Natl Acad Sci US A. 2008;105(22):7809–7814. doi:10.1073 / pnas.0711241105).AAT inhibits ADAM17 (see, e.g., BerginDA, Reeves EP, Meleady P, et al. α-1 Antitrypsin regulates human neutrophilchemotaxis induced by soluble immune complexes and IL-8. J Clin Invest. 2010;120(12):4236–4250. doi:10.1172 / JCI41196; Serban KA, Petrusca DN, Mikosz A, etal. Alpha-1 antitrypsin supplementation improves alveolar macrophagesefferocytosis and phagocytosis following cigarette smoke exposure. PLoS One. 2017;12(4):e0176073. Published 2017 Apr 27. doi:10.1371 / journal.pone.0176073).

[0359] The effects of AAT on ADAM17 activation and protein shedding (especially ACE2) were investigated after cells were exposed to the following substances. Figure 23a ):

[0360] i) Spike protein

[0361] ii) Fake virus

[0362] iii) SARS-CoV-2 (live virus).

[0363] The most relevant cells to use are any cells that express ACE2 (as listed above).

[0364] 2.2. Activation of Fc receptors via SARS-CoV-2 / IgG immune complexes (antibody-dependent enhancement, see, for example, F. Negro, Swiss Med Wkly. 2020;150:w20249 “Is antibody-dependent enhancement playing a role in COVID-19 pathogenesis?”). Enhancement of monocyte FcyRJI-mediated function via trypsin-like protease proteolysis, such as inducing TNF release (JM Debets, JG Van de Winkel, J LCeuppens, IE Dieteren, WA Buurman in The Journal of Immunology February 15,1990, 144 (4) 1304-1310).

[0365] The effects of AAT on the activation of monocytes / macrophages via spike protein / IgG immune complexes were investigated. Figure 23b ).

[0366] Example 3 - Additional Experiments Supporting the Efficacy of AAT in Reducing Viral Proliferation

[0367] 3. Viral polymerase test

[0368] SARS-CoV-2 viral polymerase is a key element in viral genetic material replication. Transfecting cell lines expressing multi-subunit viral polymerase (containing at least three core subunits NSP7, NSP8, and NSP12) with overexpressing a luciferase reporter gene that can only be activated by viral polymerase activity can also help.

[0369] The luciferase reporter signal is directly proportional to viral polymerase activity. AAT was tested to assess viral polymerase inhibitory activity.

[0370] Once inside a host cell, SARS-CoV-2 utilizes host cell mechanisms to enhance its replication. This induces a toxic response within the host cell, primarily mediated by the NSP1 viral protein.

[0371] To simulate this biological event, a cell line expressing the viral NSP1 protein controlled by a tetracycline-inducible promoter was generated. After treatment with tetracycline, the toxic NSP1 protein was expressed. It is hypothesized that the addition of AAT could inhibit this viral protein-mediated toxicity.

[0372] Experiment 4

[0373] Overview

[0374] SARS-CoV-2 is an RNA virus, but coronaviruses differ from other RNA viruses in several ways. They have large genomes and complex life cycles, yet little is still known about them. Furthermore, compared to other types of RNA viruses, coronaviruses possess proofreading mechanisms, which provide a relatively stable genome. In fact, given the scale of the pandemic, relatively few mutations leading to amino acid changes have been reported to date.

[0375] The coronavirus S protein, also known as the spike protein, is the main protein of the viral envelope. It mediates the attachment of the virus to receptors on the surface of the host cell and the subsequent fusion between the virus and the host cell membrane to facilitate viral entry into the host cell. It is a trimeric class I fusion protein that exists in a metastable pre-fusion conformation, which is divided into two main subunits, S1 and S2. In order to attach to the receptors on the surface of the host cell, the receptor-binding domain (RBD) contained in the S1 domain undergoes a hinge-like conformational change, defining two distinct states [1]. This conformational change is necessary for proteolytic processing and / or fusion of the S2 domain with the host cell membrane. It is now believed that a variety of proteases, including the PC family of proteases, trypsin-like proteases, and cathepsins, can cleave the spike protein [2].

[0376] The spike protein D614G mutation has attracted attention because it may alter viral attachment, fusion, and / or immunogenicity. The D614G mutation is thought to increase infectivity (ref), transmissibility[3], and / or mortality[4]. Recent studies have directly demonstrated that the G614 variant does indeed enhance viral entry into cells[5, 6].

[0377] SARS-CoV-2 employs a multi-subunit replication / transcription mechanism [7]. A group of non-structural proteins (nsp) produced as cleavage products of the ORF1a and ORF1b viral polyproteins assemble to facilitate viral replication and transcription, making this mechanism a potential target for therapeutic interventions against COVID-19 viral infection [8]. RNA-dependent RNA polymerase (RdRp, also known as nsp12) is a key player in viral RNA synthesis. Recently resolved crystal structures of SARS-CoV-2 nsp12 and its nsp7 and nsp8 cofactor complexes highlight the central role of these non-structural proteins in the COVID-19 viral replication and transcription cycle [8, 9]. The P314L mutation of RdRp has received less attention, but it has been suggested that this mutation may alter viral proofreading, leading to an increased downstream mutation rate

[10] .

[0378] In this study, we investigated the emergence of SARS-CoV-2 variants with mutations in both the S protein and RdR polymerase. Both mutations are located at strategically relevant sites on their respective proteins, making them candidate sites for altering viral biology. The G624 / L323 variant, rather than either the G624 or L323 mutant alone, has been very successful epidemiologically and has recently replaced the original D624 / P323 variant.

[0379] method:

[0380] Cell lines and cultures

[0381] The human cell lines used in this study were HEK 293T / 17 (human kidney, ATC C#CRL-11268), A549, HeLa, and HMC3-MHCII. Luc Cells. HMC3-MHCII, encoding a luciferase reporter gene under the major histocompatibility complex II promoter (MHCII). Luc The cell line has been described as a valuable tool for studying human microglia activation; this cell line was obtained from Professor Karl-Heinz Krause of the University of Geneva. HMC3-MHCII was transduced using a lentiviral vector. Luc Cells to obtain HMC3-MHCII for AAT production Luc Ubi AAT Cell lines (see Generation of Lentivirals). Cells were maintained in Dulbecco modified Eagle medium (DMEM) supplemented with 10% (v / v) fetal bovine serum (FBS), 100 μg / ml penicillin and streptomycin, 2 mM L-glutamine, 1 mM sodium pyruvate, and 1% non-essential amino acids. No non-essential amino acids were added to the HMC3 cell line. Cultures were maintained at 37°C and 5% CO2.

[0382] Spike fusion test.

[0383] Pre-diluted to an appropriate treatment concentration in the culture medium. Add, on top of the mixture, a HeLa cell line stably overexpressing the human ACE2 receptor and a small fragment of split-luciferase, and a HeLa cell line stably overexpressing the SARS-CoV-2 spike protein and a large fragment of split-luciferase, and incubate at 27°C for 24 hours. The interaction between ACE2 and the SARS-CoV-2 spike mediates the fusion of the two cell lines, thus the interaction between the large and small fragments of split-luciferase produces a functional luciferase. Light emission was measured using the Nanoglo kit (Promega) according to the manufacturer's instructions.

[0384] Generation of cell lines expressing ACE2 and TMPRSS2.

[0385] HeLa cells and A549 cells were seeded in 12-well plates at a density of 2E05 cells per well. The next day, cells were co-transduced with ACE2 / puromycin lentivirus and / or TMPRSS2 / blastcin lentivirus. Four days post-transduction, cells were selected with 5 μg / ml blastcin and puromycin. The cells were maintained in a polyclonal population.

[0386] plasmid

[0387] The cDNA ORFs for ACE2 and TMPRSS2 were purchased from GenSript and cloned into the lentiviral vectors pCDH-CMV-MCS-EF1α-Puro (SEQ ID NO:13) and pCDH-CMV-MCS-EF1α-Blast (SEQ ID NO:14), respectively, using standard cloning methods. The pCG1_SCoV2-S plasmid (SEQ ID NO:15) encoding the SARS-CoV-2 spike protein was provided by Professor Stefan Pöhlmann (University of Göttingen, Göttingen, Germany). The G614 spike protein was cloned using site-directed mutagenesis using the following primers: 5'-GCGTGAACTGTACCGAAGTG-3' (SEQ ID NO:16) and 5'-CCTGGTACAGCACTGCC-3' (SEQ ID NO:17). The SARS-CoV-2 spike protein, a truncated form of 19 amino acids at the C-terminus, was generated by PCR amplification using primers 5'-AGCGAATTCGGATCCGCC-3' (SEQ ID NO:18) and 5'-ACAGTCGACTCTAGATTAGCAGCAGCTGCCACAG-3' (SEQ ID NO:19), and then cloned into the pCG1 plasmid.

[0388] Purification of AAT produced in HEK293T cells

[0389] Supernatant from HEK293T cells overexpressing the human AAT-His tag was sampled and incubated overnight at 4°C with shaking on NiSepharose excel histidine-tagged protein purification resin (Cytiva). The supernatant-to-resin volume ratio was 200:1. The supernatant was then discarded, and the beads were washed once with phosphate-buffered saline (PBS). The beads were then washed once with PBS supplemented with 10% (v / v) elution buffer (PBS supplemented with 500 mM imidazole, pH 7.5), and once with PBS supplemented with 20% elution buffer. The finally purified AAT-His tag was eluted in 100% elution buffer. Imidazole was removed by dialysis to obtain AAT-His in PBS buffer.

[0390] The emergence of lentiviruses

[0391] For the generation of recombinant lentivirus, the plasmid was transfected into HEK293T cells using the calcium phosphate method. In short, 4.5 × 10⁻⁶ plasmids were transfected into HEK293T cells. 6 Cells were seeded in 10 cm culture dishes and transfected after 16 hours with 15 μg of any one of the following lentiviral vectors: ACE2, TMPRSS2, AAT, or empty expression; 10 μg of packaging plasmid (psPAX2, provided by Didier Trono [Addgene plasmid 12260]); and 5 μg of envelope plasmid (pMD2G, provided by Didier Trono [Addgene plasmid 12259]). The culture medium was changed 8 hours after transfection. After 48 hours, the viral supernatant was collected, filtered through a 45 μm PVDF filter, and stored at -80°C.

[0392] The emergence of coronavirus spike pseudotype lentiviruses

[0393] Using the calcium phosphate method described above, spike pseudoviruses were generated by co-transfecting 293T cells with psPAX2, pCDH-CMV-Gluc-EF1α-GFP, and a plasmid encoding any of the following: full-length SARS-CoV-2 spike D614 (FL) (SEQ ID NO: 15), full-length spike G614 (FL) (SEQ ID NO: 20), spike D614 DeltaCter (SEQ ID NO: 21), spike G614 DeltaCter (SEQ ID NO: 22), SARS-CoV spike (Sino Biological Europe GmbH, catalog number: VG40150-GN), MERS-CoV spike (Sino Biological Europe GmbH, catalog number: VG40069-GN), or an empty vector (SEQ ID NO: 23).

[0394] Coronavirus spike pseudotype lentivirus infectivity test

[0395] HeLa cells, A549 cells, or Caco2 cells stably overexpressing the human ACE2 receptor were seeded into 96-well plates. After 3 hours of seeding, the cells were treated with compounds or left untreated, depending on the experimental setup. After 24 hours, the cells were transduced with a coronavirus pseudovirus for 6 hours. The culture medium was then changed, and the cells were maintained at 37°C. After three days of incubation, luminescence was measured immediately using a spectrophotometer (Glomax, Promega) by adding 10 μL of cell supernatant to 50 μL of phosphate-buffered saline (PBS) supplemented with 4 μM coelenterate. Simultaneously, the cells were digested with trypsin and resuspended in PBS supplemented with 10% FBS, and analyzed by flow cytometry using an Attune NxT flow cytometer (thermofisher Scientific). Data were analyzed using a FlowJo 11 (FlowJo, LLC, Ashland, OR).

[0396] Cell-free assay (spike protein initiation protease inhibition)

[0397] The reaction was carried out in 100 μL of trypsin (Sigma-Aldrich), 75 μL of cathepsin B (R&D Systems), and 50 μL of PC1 (R&D Systems), proteolytic enzyme (R&D Systems), furin (NEB), cathepsin L (R&D Systems), and TMPRSS2 (creative biomart). The buffers consist of the following: PBS, pH 7.4, for trypsin (diluted to 6.4 nM); 25 mM MES, pH 5, for cathepsin B (diluted to 1.76 ng / ul); 25 mM MES, 5 mM CaCl2, 1% Brij-35, pH 6, for PC1 (diluted to 1.76 ng / ul); 50 mM Tris, 50 mM NaCl, 0.01% Tween 20, pH 9, for proteolytic enzymes (diluted to 1.76 ng / ul); 100 mM HEPES, 1 mM CaCl2, 0.5% Triton X100, 1 mM 2-mercaptoethanol, pH 7.5, for furin (diluted to 10 U / ml); 0.005% Brij-35, 1 mM EDTA, 5 mM DTT, 50 mM MES, pH 6, for cathepsin L (diluted to 1.76 ng / ul); 50 mM TrisHCl, 150 mM NaCl, 0.01% Tween 20, pH 8, were used for TMPRSS2 (diluted to 0.5 μM). Unless otherwise specified, all reagents were supplied by Sigma-Aldrich. For trypsin, cathepsin B, PC1, proteolytic enzyme, furin, and cathepsin L assays, a SARS-CoV-2 peptide containing the sequence TNSPRRARSVA with a modified MCA / Lys(DNP)FRET pair (Biomatik) was used. For the TMPRSS2 assay, a peptide containing the sequence Boc-QAR-AMC (R&D Systems) was used. For porcine pancreatic elastase ELA1, the assay kit (E-12056) was purchased from molecularprobes (Sigma-Aldrich), and for neutrophil elastase ELA2, the assay kit (BML-AK497) was purchased from Enzo; tests were performed according to the manufacturer's instructions. Fluorescence or absorbance was measured at 45 minutes per minute using a microplate reader. For each condition, Vmax was determined in fluorescence units per minute, and enzyme activity was expressed as a percentage of untreated conditions.

[0398] Gene expression analysis

[0399] Total RNA was isolated using the RNeasy Micro Kit (Qiagen) according to the manufacturer's instructions. Using the Primescript Kit from Takara, 500 ng of total RNA from each sample was reverse transcribed at 37°C for 15 minutes in a total volume of 10 μl. Relative mRNA levels were assessed by quantitative RT-qPCR using the SYBR Green PCR Kit (Applied Biosystems) via the 2δCt method. GAPDH was used as an internal control.

[0400] Gene copy number estimation

[0401] For copy number determination, each specific plasmid was linearized using restriction enzyme digestion. The digestion products were washed using a PCR clean-up kit (GeneJET) according to the manufacturer's instructions. Optical density was then measured to determine the copy number. Serial dilutions of the digested plasmids were used for qPCR.

[0402] Plasmids for furin, cathepsin L, stl4, trypsin (PRSS1), and PC1 (PCSK1) were provided by GenScript, and plasmids for cathepsin B were provided by Sino Biological.

[0403] Primers

[0404]

[0405] Results: Effect of S protein D614G mutation on cell transduction using pseudotyped lentiviral vector

[0406] Our goal is to establish a cell line that continuously expresses the viral receptor ACE2, as well as related proteases capable of cleaving the spike protein. For example... Figure 3a and Figure 3b As shown, neither HeLa cells nor A549 cells expressed the corresponding amount of ACE2 mRNA. Similarly, TMPRSS2 mRNA levels were almost undetectable. Both cell types showed low to moderate furin gene expression, but relatively high cathepsin L (a protease capable of cleaving the spike proteins from SARS-CoV-1 and SARS-CoV-2) gene expression levels. To establish cell lines that allow for spike protein pseudotyped lentiviral vectors, we transduced HeLa cells and A549 cells with ACE2 (SEQ ID NO: 24) and TMPRSS2 (SEQ ID NO: 25), or with a combination of ACE2 (SEQ ID NO: 24) and TMPRSS2 (SEQ ID NO: 25).

[0407] As expected, exposing wild-type (transduced) HeLa cells or A549 cells to the aforementioned lentiviral vectors did not result in GFP or luciferase expression. Similarly, overexpression of TMRPSS2 itself did not lead to a significant transduction rate. Using the D614 pseudotyped lentiviral vector, HeLa cells expressing ACE2 and ACE2 / TMRPSS2 showed a small but clearly detectable amount of transduction, while A549 cells showed only very little transduction. This changed significantly when using the G614 pseudotyped vector. Both ACE2-expressing cell lines showed stronger transduction. However, it should be noted that transduction in HeLa cells expressing ACE2 was much stronger than that in A549 cells expressing ACE2. Conversely, overexpression of TMRPSS2, in addition to ACE2, resulted in a strong additional enhancement of transduction, which was not the case in HeLa cells. Therefore, it is most likely that HeLa cells already strongly express a spike-cleaving protease, and that overexpression of TMRPSS2 is not necessary for effective transduction. Conversely, in A549 cells, proteolytic cleavage appears to be a rate-limiting step, thus overexpression of TMRPSS2 enhances transduction.

[0408] Discussion (Susceptibility of HeLa and A549 cell lines to viral infection)

[0409] The increased susceptibility to SARS-CoV-2 pseudovirus infection in one cell line (HeLa, cervical, female, African American) compared to another cell line (A549, lung, male, Caucasian origin) is a particularly interesting observation because it underscores the concept that the characteristics of a patient population are key to determining treatment strategies designed to maximize impact on patients diagnosed with COVID-19 or for preventative purposes. While race itself may be a secondary factor to consider, a genetic predisposition, such as low endogenous AAT or higher levels of chronic inflammation (higher IFN-γ and / or cathepsin L), necessitates higher doses and / or more regular administration of active therapeutic substances (AATs).

[0410] Experiment 4

[0411] The aim was to detect the endogenous levels of ACE2 and TMPRSS2 gene expression in different cell lines.

[0412] Methods: Total RNA was extracted from Calu3, CaCo2, VeroE6, HepG2, A549, SH-SY5Y, HEK293-117T, and HeLa cell lines using the RNeasy Micro Kit (Qiagen). Complementary DNA was synthesized from the total RNA using the PrimeScript™ RT Reagent Kit (Takara). Real-time PCR measurements of cDNA were performed using PowerUp SYBR™ Green Master Mix (Applied Biosystems), and the expression was normalized relative to GAPDH (as a control housekeeping gene). Primers are listed below:

[0413] ACE2 positive: cattggagcaagtgttggatctt (SEQ ID NO: 26)

[0414] ACE2 reverse: gagctaatgcatgccattctca (SEQ ID NO: 27)

[0415] TMPRSS2 positive: cacggactggatttatcgacaa (SEQ ID NO: 28)

[0416] TMPRSS2 reverse: cgtcaaggacgaagaccatgt (SEQ ID NO: 29)

[0417] Forward GAPDH: gcacaagaggaagagagagacc (SEQ ID NO: 30)

[0418] GAPDH reverse: aggggagattcagtgtggtg (SEQ ID NO: 31)

[0419] The results are shown in Figure 3.

[0420] Experiment 5

[0421] The aim was to determine whether interferon-γ treatment induced ACE2 expression in the A549 cell line.

[0422] Protocol: A549 cells were seeded in 12-well plates, and interferon-γ was added 24 hours after cell division. The treatment lasted for 48 hours, and RNA extraction, reverse transcriptase reaction, and qPCR were performed as described previously (see the Methods section of Experiment 4).

[0423] The results are shown in Figure 4.

[0424] Experiment 6

[0425] The aim was to determine whether interferon-γ treatment induced ACE2 expression in HeLa cells expressing the SARS-CoV-2 fusion protein.

[0426] Protocol: HeLa spike cells were seeded in 12-well plates, and interferon-γ was added 24 hours after cell division. Treatment lasted for 48 hours, and RNA extraction, reverse transcriptase reaction, and qPCR were performed as described previously (see Methods section of Experiment 4).

[0427] The results are as follows Figure 5 As shown.

[0428] Experiment 7: SARS-CoV-2 virus entry experiment

[0429] The results are as follows Figure 7 and Figure 8 As shown. The assay was performed using a pseudolentiviral vector expressing the SARS-CoV-2 spike protein with the D614G mutation and encoding a luciferase reporter gene. Figure 7 and Figure 8 ).

[0430] Add pseudolentiviral vectors to constitutively overexpressing ACE2 receptors ( Figure 7 ) or both ACE2 and TMPRSS2 ( Figure 8 On A549 cells. Compound treatment was performed 24 hours (subplots A & B) or 1 hour (subplots C & D) before the addition of the pseudolentiviral vector. Figure 9 and 10 Additional illustrative information regarding fake virus detection protocols is provided.

[0431] Example 4

[0432] AAT from multiple sources ( Figure 11a , Figure 11b , Figure 21a , Figure 21b , Figure 22a , Figure 22b ) or inhibitory compounds ( Figure 11c , Figure 21c , Figure 22cHuman alveolar basal epithelial cells (Fig. 11 and 22) overexpressing ACE2 or human colorectal adenocarcinoma cells (Fig. 21) were treated for 24 hours for a viral entry inhibition assay. Lentiviral vectors encoding a luciferase reporter gene and expressing the SARS-CoV-2 spike protein (Fig. 11), SARS-CoV spike protein (Fig. 22), or MERS-CoV spike protein (Fig. 21) with the D614G mutation were then added for 6 hours. Finally, the culture medium was changed, and the cells were cultured for another 3 days before measurement. Viral entry was measured by lentivirus-mediated luciferase signal (dark gray in Fig. 11, 21, and 22) and normalized using WST8-cell viability (shown in light gray). For all conditions, the concentrations of DMSO / PBS were normalized (buffered) for all conditions. All conditions were repeated three times; error bars represent standard deviation. Technical information can be found in the Materials and Methods section.

[0433] Example 5

[0434] AAT from multiple sources ( Figure 12a , Figure 12b ) or inhibitory compounds ( Figure 12c HeLa human cervical cancer cells overexpressing ACE2 were treated for 24 hours for a viral entry inhibition assay. Then, a lentiviral vector encoding a luciferase reporter gene and expressing the SARS-CoV-2 spike protein with the D614G mutation was added for 6 hours. Finally, the culture medium was changed, and the cells were cultured for another 3 days before measurement. Viral entry was measured by lentiviral-mediated luciferase signal (dark gray) and normalized using WST8-cell viability (shown as light gray). For all conditions, the concentrations of DMSO / PBS were normalized (buffered) for all conditions. All conditions were repeated three times; error bars represent standard deviation. For technical information, please refer to the Materials and Methods section.

[0435] Example 6

[0436] SARS-CoV-2 spike fusion assay. The testing principle is as follows: Figure 13 As shown. HeLa human cervical cancer cells overexpressing ACE2 and a small fragment of luciferase or HeLa human cervical cancer cells overexpressing SARS-CoV-2 spike protein and a large fragment of luciferase were mixed in equal amounts and at appropriate treatment concentrations. After 24 hours, cell fusion was measured by the amount of luciferase reporter signal. Luciferase signal was observed against a buffer control. Serum was diluted to 1 / 16 of the final concentration. For all conditions, the serum / PBS concentration was normalized (buffered) to normalize. All conditions were repeated three times, and the error bars represent the standard deviation (SPD). Figure 14 For technical information, please refer to the Materials and Methods section.

[0437] Example 7

[0438] Quantitative PCR analysis was performed to determine the copy number of proteases in A549 cells. Linear plasmids for each gene were used as controls to calculate the copy number (Figure 15a). Please refer to the Materials and Methods section for technical information.

[0439] Example 8

[0440] Quantitative PCR analysis was performed to determine the protein ACE2 in A549 cells. Figure 15b ) and TMPRSS2 ( Figure 15c The relative gene expression of ACE2 and TMPRSS2 was calculated. The Calu3 and Caco2 cell lines were used as references for ACE2 and TMPRSS2 expression, respectively. The Gapdh gene was used for normalization. Error bars represent standard deviations. Please refer to the Materials and Methods section for technical information.

[0441] Example 9

[0442] 50 μM of SARS-CoV-2 peptide, 1.76 ng / μL of recombinant cathepsin B protein, and 1 μM of AAT were incubated together for 45 minutes. Fluorescence was measured every minute in a UV spectrophotometer (excitation at 330 nm, detection at 390 nm) (Figure 16a). The Vmax value was determined by the slope of the trend line. The experiment was repeated twice. The error bar represents the standard deviation. For technical information, please refer to the Materials and Methods section.

[0443] Example 10

[0444] 50 μM of SARS-CoV-2 peptide, 1.76 ng / μL of recombinant cathepsin L protein, and 10 μM of AAT were incubated together for 45 minutes. Fluorescence was measured every minute in a UV spectrophotometer (excitation at 330 nm, emission detection at 390 nm) (Figure 16b). The Vmax value was determined by the slope of the trend line. The experiment was repeated twice. The error bar represents the standard deviation. For technical information, please refer to the Materials and Methods section.

[0445] Example 11

[0446] 50 μM of SARS-CoV-2 peptide, 6.4 nM of recombinant trypsin protein, and two concentrations of AAT (0.1 μM and 1 μM) were incubated together for 45 minutes. Fluorescence was measured every minute in a UV spectrophotometer (excitation at 330 nm, emission detection at 390 nm) (Figure 16c). The Vmax value was determined by the slope of the trend line. The experiment was repeated twice. The error bar represents the standard deviation. For technical information, please refer to the Materials and Methods section.

[0447] Example 12

[0448] 50 μM of SARS-CoV-2 peptide, 10 U / ml of furin recombinant protein, and 1 μM of AAT were incubated together for 45 minutes. Fluorescence was measured every minute in a UV spectrophotometer (excitation at 330 nm, detection at 390 nm) (Figure 16 d). The Vmax value was determined by the slope of the trend line. The experiment was repeated twice. The error bar represents the standard deviation. For technical information, please refer to the Materials and Methods section.

[0449] Example 13

[0450] 50 μM of SARS-CoV-2 peptide, 1.76 ng / μL of recombinant PCI protein, and several concentrations of AAT (1 μM, 10 μM, 40 μM, and 100 μM) were incubated together for 45 minutes. Fluorescence was measured every minute in a UV spectrophotometer (excitation at 330 nm, emission detection at 390 nm) (Figure 16e). The Vmax value was determined by the slope of the trend line. The experiment was repeated twice. The error bar represents the standard deviation. For technical information, please refer to the Materials and Methods section.

[0451] Example 14

[0452] 50 μM of SARS-CoV-2 peptide, 1.76 ng / μL of recombinant protein lysin, and several concentrations of AAT (1 μM, 10 μM, 40 μM, and 100 μM) were incubated together for 45 minutes. Fluorescence was measured every minute in a UV spectrophotometer (excitation at 330 nm, emission detection at 390 nm) (Figure 16 f). The Vmax value was determined by the slope of the trend line. The experiment was repeated twice. The error bar represents the standard deviation. For technical information, please refer to the Materials and Methods section.

[0453] Example 15

[0454] AAT inhibits TMPRSS2 protease activity. 30 μM Boc-QAR-AMC peptide, 0.5 μM TMPRSS2 recombinant protein, and 5 μM AAT were incubated together for 45 min. Fluorescence was measured every minute in a UV spectrophotometer (excitation at 380 nm, emission detection at 460 nm) (Figure 16 g). The Vmax value was determined by the slope of the trend line. The experiment was repeated twice. The error bar represents the standard deviation. For technical information, please refer to the Materials and Methods section.

[0455] Example 16

[0456] Incubate 25 μg / mL of DQ™ elastin substrate, 0.25 U / mL of porcine pancreatic elastase (ELA1), and several concentrations of AAT (10 nM, 50 nM, and 100 nM) together for 45 min. Fluorescence was measured every minute in a fluorescence reader (excitation at 485 nm, emission detection at 530 nm) (Figure 16 h). Vmax values ​​were determined by the slope of the trend line. Repeat twice. Error bars represent standard deviation. Refer to the Materials and Methods section for technical information.

[0457] Example 17

[0458] The substrate MeOSuc-AAPV-pNA, 2.2 uU / ul of purified human neutrophil elastase (ELA2), and several concentrations of AAT (1 nM and 10 nM) were incubated together for 45 min. Absorbance was measured every minute at a spectrophotometer (A405 nm) (Figure 16 i). The Vmax value was determined by the slope of the trend line over 20 minutes. The experiment was repeated twice. The error bar represents the standard deviation. For technical information, please refer to the Materials and Methods section.

[0459] Example 18

[0460] Titer measurements were performed using the Octet RED (Sartorius, Octet RED96) method, a protein A biosensor (Sartorius, Ref 18-5010; 18-5012), mouse Mc anti-hAAT IgG2A (abcam, ab116604), neutralization buffer (MBD; 150 mM 0.02% Tween 20, 1 mg / mL NaCl, BSA, PBS1X), and regeneration buffer (MBD; 10 mM glycine-HCl (pH 2)) in combination as follows: Figure 26 As shown. Plasma-derived AAT (Sigma-Aldrich, SRP6312) and recombinant AAT generated in CHO via the PL136 / PL137 library are compared (Figure 17).

[0461]

[0462] Example 19

[0463] On day 0, human microglia HMC3-MHCII LucCells were plated and activated with IFNγ on day 1 until day 2. Luciferase activity and cell viability were measured on day 4 (Fig. 18a). Activation was measured by MHCII-driven luciferase activity and normalized relative to cell viability. Luciferase activity under all conditions is expressed as a fold increase over untreated cell controls (Fig. 18b). All conditions were repeated three times; error bars represent standard deviation.

[0464] Example 20

[0465] On day 0, human microcolloid HMC3-MHCII Luc and HMC3-MHCII Luc Cell; Ubi AAT Cells were plated and activated with IFNγ on day 1 until day 2, with luciferase activity and cell viability measured on day 4. Plasma-derived AAT was applied to HMC3-MHCII cells from day 0 to day 4. Luc Cells (Fig. 19a). Activation was measured by the activity of MHCII-driven luciferase and normalized relative to cell viability. Luciferase activity under all conditions is expressed as a percentage of the IFNγ-activated control (Fig. 19b). All conditions were repeated three times; error bars represent standard deviation.

[0466] Example 21

[0467] On day 0, human microcolloid HMC3-MHCII Luc Cells were plated and exposed to IFNγ and / or IFNβ from day 1 to day 2, with luciferase activity and cell viability measured on day 4. Plasma-derived AAT was administered from day 0 to day 4. Figure 20a Activation was measured by the activity of MHCII-driven luciferase and normalized relative to cell viability. Luciferase activity under all conditions is expressed as a percentage of the IFNγ-activated control (Figure 20b). Columns of plasma-derived AAT (1 μM, 10 μM, 25 μM) were replicates of Example 20 for comparative purposes. All conditions were repeated three times, and the error bars represent standard deviations.

[0468] Example 22

[0469] Coomassie image caption: Coomassie-stained SDS-PAGE from multiple AAT sources. Reduced samples for analysis were prepared by mixing NuPage 4x LDS sample buffer (Life Technologies) and NuPage 10x sample reducing agent (Life Technologies) and incubating at 70°C for 10 minutes. For non-reduced samples, the reducing agent and heat incubation were omitted. 5 μg of protein was loaded into each lane. Samples were electrophoresed on 4–20% Mini-PROTEAN® precast gels (BioRad) containing TGS buffer. The gels were then fixed in fixation buffer (50% methanol + 10% acetic acid + 40% H2O) at room temperature for 30 minutes. Coomassie blue (Sigma Aldrich) was added to a final concentration of 0.25% and incubated for another 15 minutes. Finally, the gels were destained overnight after multiple washes in fixation buffer and imaged on a G:Box imager (Syngene). Figure 24 ).

[0470] Example 23

[0471] Expression of recombinant human AAT in HEK 293 cells. Based on SEQ ID NO: 46 for HEK293 or based on SEQ ID NO: 47 for HEK293T. For HEK293, from Figure 25g The vector generated rhAAT expression clones containing the SERPINA1_OHu22141C_pcDNA3.1(+) plasmid. The clones containing the plasmid were sequence validated, and sufficient quantities of the plasmid were prepared for transfection of HEK 293 cells (ATCC, Catalog # CRL-1573). HEK293 cells were transfected with the plasmid, and rhAAT expression and secretion into the culture medium were confirmed in three sets of 6-well plates using a commercially available ELISA kit (Thermo Fischer Scientific, Catalog # EH411RBX5). Simulated transfection cells and cells transfected with pCMV-Td Tomato and EGFP fluorescent labels were used as controls.

[0472] Key materials and reagents for generating rhAAT HEK 293 cells

[0473]

[0474] step

[0475] The production of rhAAT in HEK 293 cells occurs in two stages:

[0476] 1. Preparation of rhAAT-expressing cells.

[0477] 2. The generation of rhAAT.

[0478] Preparation of rhAAT-expressing cells

[0479] The preparation of rhAAT-expressing cells includes the following activities:

[0480] - Construction and validation of expression-ready plasmids

[0481] - Host cell transfection

[0482] - Generation of a (stable) library expressing rhAAT

[0483] -Clone Selection

[0484] Construction and validation of plasmids ready for expression

[0485] Based on the sequence shown in SEQ ID NO: 46, an rhAAT expression clone containing the SERPINA1_OHu22141C_pcDNA3.1(+) plasmid was prepared by Genscript Biotech (Piscataway, NJ).

[0486] The plasmid-containing clones were transported to RTI International (Research Triangle Park, NC) for sequence verification, and a sufficient quantity of plasmid was prepared for transfection of HEK 293 cells.

[0487] Transient transfection of host cells

[0488] HEK293 cells were transfected with the SERPINA1_OHu22141C_pcDNA3.1(+) plasmid, and rhAAT expression and secretion into the culture medium were confirmed in three groups of 6-well plates using a commercially available ELISA kit. Cells that were simulated for transfection and cells transfected with pCMV-TdTomato and EGFP fluorescent labels were used as controls.

[0489] The amount of reagents and plasmid DNA per well for each experiment

[0490]

[0491] Generation of a (stable) library expressing rhAAT

[0492] After confirming successful transient transfection, a stable library was generated in T-150 cells using antibiotic selection. Cells were maintained under antibiotic selection for up to 2 weeks to eliminate cells without plasmids. Subsequently, protein expression in the culture supernatant was tested using ELISA.

[0493] Prior to transfer, the merged cells were frozen at 80°C for further cell expansion and rhAAT production in shake flasks.

[0494] Cloning selection

[0495] Diluted cells were collected and transferred to 10-cm² culture dishes for the isolation of individual clones. Based on transgenic behavior, 3 to 6 clones were identified from 50 to 96 clones for subsequent confirmation of rhAAT expression by ELISA.

[0496] The generation of rhAAT

[0497] The production of rhAAT involves cell expansion and the generation of rhAAT in the cell stack, purification of rhAAT by affinity chromatography, and product concentration and formulation (buffer exchange) using Amicon Ultra 15, 10kDa tubes.

[0498] Cell expansion and the generation of rhAAT in the Cell Stack

[0499] Recombinant adherent-dependent HEK-293 cells were grown in culture-treated T-flasks and Cell Stack flasks in Dulbecco modified Eagles medium (DMEM, HyClone) supplemented with 10% fetal bovine serum (FBS, Gibco), penicillin-streptomycin (Gibco), and the selective antibiotic G418 sulfate (Gibco). Cultures were cultured in a humidified incubator at 37.0°C and 5% CO2, and harvested after being rotated at 2.5 rpm when grown in roller flasks.

[0500] Purification of rhAAT by affinity chromatography

[0501] The pH and conductivity of the clarified culture supernatant were tested, and titrated to 7.4 ± 0.1 with equilibration buffer containing 1M NaCl at 1M Tris (pH 7.4) and ± 5 mS / cm, respectively, as needed. After adjusting the pH and conductivity, the clarified supernatant was filtered through a 0.2 μm filter before purification.

[0502] Affinity Chromatography

[0503] The affinity chromatography column packed with rhAAT-selective resin was rinsed with 3CV of purified water and sterilized with 3CV of 0.5 M NaOH (holding for 30 min after 2CV), then rinsed again with 3CV of purified water and equilibrated with 10CV of 20 mM Tris, 150 mM NaCl buffer (pH 7.4). The rhAAT-selective column was loaded with the maximum volume of clear supernatant, calculated based on the rhAAT titer at the end of shake-flask culture, the volume of clear supernatant, and the maximum column loading capacity of 10 mg / mL resin. If necessary, the clear supernatant was cycled through the rhAAT-selective column multiple times to avoid resin overload. The loaded protein was washed with 4CV of 20 mM Tris, 150 mM NaCl buffer (pH 7.4) and rhAAT was eluted into a PETG collection bottle with 4CV of 20 mM Tris, 2 M MgCl buffer (pH 7.4). Strip the column with 4CV of PBS, pH 2.0 buffer, and equilibrate with 3CV of 20mM Tris, 150mM NaCl buffer (pH 7.4) before performing additional cycles, if necessary.

[0504] Example 24

[0505] Carrier PL136 (pCGS3_AAT_native_SP; Figure 25d (The original signal peptide enters the HindIII / XhoI restriction site (LC MCS)) and PL137 (pCGS3_AAT_SP5, Figure 25e (The signal peptide of SEQ ID NO:1 was obtained by using ATUM) SM (Optimized signal peptide by replacing amino acids 1-24 in Newark, California).

[0506] Using the proprietary DNA2.0 algorithm (GeneGPS® Expression Optimization Technology), https: / / www.dna20.com / services / genegps The coding sequence was codon-optimized and expressed in Chinese hamster ovary cells. A canonical kozak sequence (GCCGCCACC) was added before the start codon. HindIII and XhoI restriction sites were added at the 5' and 3' of the synthesized coding sequence.

[0507] The obtained DNA fragment was cloned into the vector pJ201. The clone pJ201_AAT_native_SP is provided. Figure 25b ) and pJ201_AAT_SP5 ( Figure 25c The complete plasmid map and sequence.

[0508] pCGS3_AAT_native_SP and pCGS3_AAT_SP5 (empty pCGS3 vector) were obtained according to the following cloning protocol. Figure 25f ):

[0509]

[0510] Fragment preparation:

[0511]

[0512]

[0513]

[0514] All digests were incubated at 37°C for 2 hours. The target fragment was separated by agarose gel electrophoresis (1.2% agarose gel). The fragment of the desired size was excised, purified by gel electrophoresis, and used for the following ligations:

[0515]

[0516] The ligation mixture (1 μl) was transformed into *E. coli* Stabl2 cells from Invitrogen. The transformed *E. coli* cells were cultured on LB agar Lennox containing 50 mg / L carbenicillin and free of animal components. *E. coli* colonies were transferred to 4 ml of LB broth Lennox containing 50 mg / L ampicillin and free of animal components and incubated overnight at 33°C and 300 rpm in a shaker incubator. Plasmid DNA was isolated from the *E. coli* cultures using a Qiagen BioRobot 9600 and a Nucleo Spin Robot-8 plasmid kit from Macherey-Nagel. The DNA was then sequenced using strand-specific sequencing primers covering the cloning site.

[0517] The sequences of the following clones were confirmed to be those of the expected PL136 (pCGS3_AAT_native_SP); Figure 25d ) and PL137 (pCGS3_AAT_SP5, Figure 25e The sequences are consistent. AAT obtained from PL136 and PL137 in CHO are merged.

[0518] Example 25

[0519] Gene synthesis and single-gene constructs

[0520] The rhAAT single-gene vector was constructed by subcloning the product gene into the vector pXC-17.4 (Lonza). Figure 25a ).

[0521] DNA amplification

[0522] Following the manufacturer's instructions, One Shot® Stbl3 chemocompetent E. coli cells (Life Technologies, C7373-03) were transformed with 1 μL of vector DNA using the heat shock method. Cells were plated on LB agar plates containing ampicillin (50 g / ml) (LB Broth Base, Select APS™, and Bacto-Agar, both from Becton Dickinson, 292438 and 214010, respectively) and incubated overnight at 37°C until bacterial colonies were clearly visible.

[0523] For Giga preparation, a single bacterial culture was used to inoculate the starter culture, which was then used to inoculate 1.0 L Plasmid Plus medium (Thomson, 446300) containing 50 µg ampicillin and incubated overnight at 37°C with shaking. Vector DNA was isolated using a QIAGEN Gigaprep system (QIAGEN, 12291). In all cases, DNA concentration was measured using a Nanodrop 1000 spectrophotometer (Thermo-Scientific) and adjusted to 1 mg / mL. DNA quality was assessed by measuring the absorbance ratio at 260 nm and 280 nm.

[0524] Routine culture of CHOK1SV GS-KO cells

[0525] CHOK1SV GS-KO cells were cultured in CD-CHO medium (Life Technologies, 10743-029) supplemented with 6 mM L-glutamine (Life Technologies, 25030-123). Cells were cultured in a shaking incubator at 36.5°C, 5% CO2, 85% humidity, and 140 rpm. Cells were routinely passaged every 3 to 4 days, seeded at 0.2 × 10⁶ cells / ml, and allowed to proliferate to ensure sufficient cells for transfection. Cells were discarded at passage 20.

[0526] Stable recombinant CHOK1SV GS-KO cells were cultured in CD-CHO medium supplemented with 50 μM MSX (L-methionine sulfoxide imide, Sigma-Aldrich, M5379) and SP4. Cells were cultured in a shaking incubator at 36.5°C, 5% CO2, 85% humidity, and 140 rpm. Cells were routinely passaged every 3 to 4 days, seeded at 0.2 × 10⁶ cells / ml, and proliferated to ensure sufficient cells for fed-batch overgrowth.

[0527] Stable mixed transfection of CHOK1SV GS-KO cells

[0528] The single-gene vector DNA plasmids used for transfection were prepared by linearization with PvuI, followed by ethanol precipitation and resuspending in EB buffer to a final concentration of 400 µg / ml. Transfection was performed by electroporation using Gene Pulse XCell. For each transfection, live cells were resuspended in preheated CD-CHO medium to 1.43 × 10⁷ cells / ml. 100 µl of linearized DNA at a concentration of 400 µg / ml was aliquoted into 0.4 cm gap electroporation cuvettes, and 700 µl of cell suspension was added. Cells and DNA from three cuvettes were electroporated at 300 V, 900 µF and immediately recovered into 30 ml of preheated CD-CHO supplemented with 10 ml / LSP4 (Lonza, BESP1076E) to produce a stable library. Transfectants were cultured in a shaking incubator at 36.5 °C, 5% CO₂, 85% humidity, and 140 rpm.

[0529] Three stable library transfections were established. Twenty-four hours post-transfection, the cultures were centrifuged and resuspended in preheated CD-CHO supplemented with 50 µM MSX and 10 ml / L SP4. Cell growth and viability were monitored periodically after transfection.

[0530] Transfectant culture is suitable when the viable cell density is > 0.6 × 10⁶ cells / ml. Seed cells at a final volume of 0.2 × 10⁶ cells / ml in 100 ml of CD-CHO medium supplemented with 50 µM MSX / 10 ml / L SP4 in a 500 ml aerated conical flask (Fisher Scientific (Corning), 10352742) and incubate at 36.5°C, 5% CO₂, 85% humidity, and 140 rpm in a shaking incubator. Monitor the cell culture and expand it once it has achieved exponential growth. Expand the culture to a 200 ml culture volume in 500 ml aerated conical flasks at a concentration of 0.2 × 10⁶ cells / ml in CD-CHO medium supplemented with 50 µM MSX / 10 ml / L SP4 and incubate under the above conditions (see Section 0). Then scale up the culture to the appropriate production volume.

[0531] Simplified fed-batch overgrowth

[0532] Cells were proliferated to a production rate of 2 L per product by seeding appropriate culture volumes at 0.2 × 10⁶ cells / mL into Lonza CM42 basal medium supplemented with 4 mL / L SPE from an established stable library. Production was established in 5 L (Generon, 931116) shake flasks and cultured in an incubator at 36.5 °C, 5% CO₂, 85% humidity, and 140 rpm. Cell counts and viability were monitored before feeding began on day 4 and periodically until culture was harvested on day 11. High doses of a mixture of Lonza proprietary feeds were administered on days 4 and 8.

[0533] Harvesting and Concentration of Production Cultures

[0534] The culture was harvested by centrifugation at 3000 rpm for 10 minutes and filtered through a 0.22 μm PES membrane to obtain a clear supernatant.

[0535] α-1 antitrypsin affinity chromatography

[0536] The clarified cell supernatant was purified using a 50 ml α-1 antitrypsin selective column (GE Healthcare). The column was equilibrated with 20 mM Tris and 150 mM NaCl (pH 7.4) before and after product application, and eluted with 20 mM Tris and 2 M MgCl2 (pH 7.4). The process was performed on an AKTA purifier at a rate of 10 ml / min. Fractions containing the product from the affinity chromatography eluent were combined and buffer-exchanged to 50 mM Tris and 75 mM NaCl (pH 8.0) via tangential flow filtration (TFF) using a Spectrum's KrosFlo TFF system with a 10 kDa MWCO3 (D02-E010-05-N).

[0537] Anion exchange chromatography

[0538] The combined, buffer-exchanged fractions were further purified at 10 ml / min using an AKTA purifier on a 25 ml CaptoQ column (5 x 5 ml columns connected in tandem) (GE Healthcare). The column was equilibrated with 50 mM Tris and 75 mM NaCl (pH 8.0) before and after product application. The product was eluted to 50 mM Tris and 1 M NaCl (pH 8.0) using a 10 CV linear gradient. The product-containing fractions from the anion exchange chromatography eluent were combined, diluted to 1 mg / ml, and subjected to mass analysis.

[0539] SE-HPLC

[0540] Reproducible samples were analyzed by SE-HPLC on an Agilent 1200 Series HPLC system using a Zorbax GF-250 9.4 mM ID⅓25 cm column (Agilent). 80 µL aliquots of 1 mg / mL sample (or stock solution concentration, if sample concentration <1 mg / mL) were injected and run at 1 mL / min for 15 min in 50 mM sodium phosphate, 150 mM sodium chloride, and 500 mM arginine (pH 6.0). Soluble aggregate levels were analyzed using Empower software. Signals generated by buffer components were analyzed by blank buffer injection and are omitted from the data analysis unless otherwise stated.

[0541] Product concentration

[0542] The purified product was concentrated to the target concentration of 25 mg / mL using a Vivaspin Turbo-15 centrifugal filtration unit with a molecular weight cutoff of 30 kDa (Sartorius, VS15T02).

[0543] References

[0544] sequence list <110> Atlas Bio Inc. <120> Treatment and / or prevention of diseases or syndromes related to viral infection <130> AD2955 PCT BS <160> 47 <170> BiSSAP 1.3.6 <210> 1 <211> 418 <212> PRT <213> Artificial Sequence <220> <223> α1-Antitrypsin (AAT) <400> 1 Met Pro Ser Ser Val Ser Trp Gly Ile Leu Leu Leu Ala Gly Leu Cys 1 5 10 15 Cys Leu Val Pro Val Ser Leu Ala Glu Asp Pro Gln Gly Asp Ala Ala 20 25 30 Gln Lys Thr Asp Thr Ser His His Asp Gln Asp His Pro Thr Phe Asn 35 40 45 Lys Ile Thr Pro Asn Leu Ala Glu Phe Ala Phe Ser Leu Tyr Arg Gln 50 55 60 Leu Ala His Gln Ser Asn Ser Thr Asn Ile Phe Phe Ser Pro Val Ser 65 70 75 80 Ile Ala Thr Ala Phe Ala Met Leu Ser Leu Gly Thr Lys Ala Asp Thr 85 90 95 His Asp Glu Ile Leu Glu Gly Leu Asn Phe Asn Leu Thr Glu Ile Pro 100 105 110 Glu Ala Gln Ile His Glu Gly Phe Gln Glu Leu Leu Arg Thr Leu Asn 115 120 125 Gln Pro Asp Ser Gln Leu Gln Leu Thr Thr Gly Asn Gly Leu Phe Leu 130 135 140 Ser Glu Gly Leu Lys Leu Val Asp Lys Phe Leu Glu Asp Val Lys Lys 145 150 155 160 Leu Tyr His Ser Glu Ala Phe Thr Val Asn Phe Gly Asp Thr Glu Glu 165 170 175 Ala Lys Lys Gln Ile Asn Asp Tyr Val Glu Lys Gly Thr Gln Gly Lys 180 185 190 Ile Val Asp Leu Val Lys Glu Leu Asp Arg Asp Thr Val Phe Ala Leu 195 200 205 Val Asn Tyr Ile Phe Phe Lys Gly Lys Trp Glu Arg Pro Phe Glu Val 210 215 220 Lys Asp Thr Glu Glu Glu Asp Phe His Val Asp Gln Val Thr Thr Val 225 230 235 240 Lys Val Pro Met Met Lys Arg Leu Gly Met Phe Asn Ile Gln His Cys 245 250 255 Lys Lys Leu Ser Ser Trp Val Leu Leu Met Lys Tyr Leu Gly Asn Ala 260 265 270 Thr Ala Ile Phe Phe Leu Pro Asp Glu Gly Lys Leu Gln His Leu Glu 275 280 285 Asn Glu Leu Thr His Asp Ile Ile Thr Lys Phe Leu Glu Asn Glu Asp 290 295 300 Arg Arg Ser Ala Ser Leu His Leu Pro Lys Leu Ser Ile Thr Gly Thr 305 310 315 320 Tyr Asp Leu Lys Ser Val Leu Gly Gln Leu Gly Ile Thr Lys Val Phe 325 330 335 Ser Asn Gly Ala Asp Leu Ser Gly Val Thr Glu Glu Ala Pro Leu Lys 340 345 350 Leu Ser Lys Ala Val His Lys Ala Val Leu Thr Ile Asp Glu Lys Gly 355 360 365 Thr Glu Ala Ala Gly Ala Met Phe Leu Glu Ala Ile Pro Met Ser Ile 370 375 380 Pro Pro Glu Val Lys Phe Asn Lys Pro Phe Val Phe Leu Met Ile Glu 385 390 395 400 Gln Asn Thr Lys Ser Pro Leu Phe Met Gly Lys Val Val Asn Pro Thr 405 410 415 Gln Lys <210> 2 <211> 44 <212> PRT <213> Artificial Sequence <220> <223> C-terminal AAT sequence 374-418 <400> 2 Met Phe Leu Glu Ala Ile Pro Met Ser Ile Pro Pro Glu Val Lys Phe 1 5 10 15 Asn Lys Pro Phe Val Phe Leu Met Ile Glu Gln Asn Thr Lys Ser Pro 20 25 30 Leu Phe Met Gly Lys Val Val Asn Pro Thr Gln Lys 35 40 <210> 3 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> A short cyclic peptide derived from the C-terminal sequence of α1-antitrypsin. Alpha1-Antitrypsin) <400> 3 Cys Pro Phe Val Phe Leu Met 1 5 <210> 4 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> A short cyclic peptide derived from the C-terminal sequence of α1-antitrypsin. Alpha1-Antitrypsin) <400> 4 Cys Pro Phe Val Phe Leu Glu 1 5 <210> 5 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> A short cyclic peptide derived from the C-terminal sequence of α1-antitrypsin. Alpha1-Antitrypsin) <400> 5 Cys Pro Phe Val Phe Leu Arg 1 5 <210> 6 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> A short cyclic peptide derived from the C-terminal sequence of α1-antitrypsin. Alpha1-Antitrypsin) <400> 6 Cys Pro Glu Val Phe Leu Met 1 5 <210> 7 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> HIV-TAT 48-57 peptide <400> 7 Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg 1 5 10 <210> 8 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> FHV-coat 35-49 peptide <400> 8 Arg Arg Arg Arg Asn Arg Thr Arg Arg Asn Arg Arg Arg Val Arg 1 5 10 15 <210> 9 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> HTLV‑II Rex 4‑16 peptide (HTLV‑II Rex 4‑16 peptide) <400> 9 Thr Arg Arg Gln Arg Thr Arg Arg Ala Arg Arg Asn Arg 1 5 10 <210> 10 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> BMV gag 7-25 peptide <400> 10 Lys Met Thr Arg Ala Gln Arg Arg Ala Ala Ala Arg Arg Asn Arg Trp 1 5 10 15 Thr Ala Arg <210> 11 <211> 11 <212> PRT <213> Viruses <220> <223> Fluorogenic peptides derived from SARS‑CoV spike <400> 11 His Thr Val Ser Leu Leu Arg Ser Thr Ser Gln 1 5 10 <210> 12 <211> 11 <212> PRT <213> Viruses <220> <223> Fluorogenic peptides derived from the SARS-CoV-2 spike protein. <400> 12 Thr Asn Ser Pro Arg Arg Ala Arg Ser Val Ala 1 5 10 <210> 13 <211> 7394 <212> DNA <213> Artificial Sequence <220> <223> pCDH-CMV-MCS-EF1α-Puro lentiviral vector (pCDH-CMV-MCS-EF1α-Puro lentivector) <400> 13 acgcgtgtag tctttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca 60 acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta 120 180 attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc 240 tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta 300 agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact 360 ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg 420 cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct 480 tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaaatttt 540 gactagcgga ggctagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 600 aattagatcg cgatgggaaa aaattcggtt aaggccaggg ggaaagaaaa aatataaatt 660 aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 720 agaaacatca gaaggctgta gacaaatact gggacagcta caaccatccc ttcagacagg 780 atcagagaa cttagatcat tatatatac agtagcaacc ctctattgtg tgcatcaaag 840 gagagata aagahaacca aggaagcttt agagagata gaggagagc aaaaaaaaag 900 taagaccacc gcacagcaag cggccactga tcttcagacc tggagga gatatgaggg 960 acaattgag aagtgatta tataatata aagtagtaa attgaacca tggagtag 1020 cacccaccaa ggcaaagaga agagtggtgc aggagaaaa agagcagtg ggaataggag 1080 ctttgttcct tgggttctg ggagcagcag gaagcactat gggcgcagcg tcaatgacgc 1140 tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttgctga 1200 gggctattga ggcgcacag catctgttgc aactcacagt ctggggcatc aagcagctcc 1260 aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 1320 gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gatgctagt tggagtaata 1380 aatctctgga acgatttgg aatcacacga cctggatgga gtgggacaga gaattaca 1440 attack cttaatacac tccttaattg aagaatcgca aaaccagca gaaagaatg 1500 aaaaagaattt attggaatta gataaatggg caagttttgtg gatttggtttt aacaataaca 1560 attggctgtg gtatataaaa ttattcataa tgagtagg aggctgta ggtttaagaa 1620 tagttttgc tgtactttct atagtgaata gagttaggca gggatattca ccattatcgt 1680 ttcagaccca cctcccaacc ccgagggac ccgacaggcc cgaaggaata gagagaag 1740 gtggagagag agacagagac agatccattc gattagtgaa cggatctcga cggtatcggt 1800 taacttttaa aagaaaggg gggattgggg ggtacagtgc agggaaga atagtagaca 1860 tatagcaac agacatacaaactaagaat tacaaaaaaaaaa ttcaaattt 1920 tatcgattac tagtattg cccagtacat gaccttatgg gactttccta cttggcagta 1980 catctacgta ttagtcatcg ctattaccat ggtgatgcgg tttggcagt acatcaatgg 2040 gcgtggatag cggtttgact cacggggatt tccaagtctc cacccattg acgtcaatgg 2100 gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca actccgcccc 2160 attgacgcaa atgggcggta ggcgtgtacg gtgggaggtt tatataagca gagctcgttt 2220 agtgaaccgt cagatcgcct ggagacgcca tccacgctgt tttgacctcc atagaagatt 2280 ctagagctag cgaattcgaa tttaaatcgg atccgcggcc gcaaggatct gcgatcgctc 2340 cggtgcccgt cagtgggcag agcgcacatc gcccacagtc cccgagaagt tggggggagg 2400 ggtcggcaat tgaacgggtg cctagagaag gtggcgcggg gtaaactggg aaagtgatgt 2460 cgtgtactgg ctccgccttt ttcccgaggg tgggggagaa ccgtatataa gtgcagtagt 2520 cgccgtgaac gttctttttc gcaacgggtt tgccgccaga acacagctga agcttcgagg 2580 ggctcgcatc tctccttcac gcgcccgccg ccctacctga ggccgccatc cacgccggtt 2640 gagtcgcgtt ctgccgcctc ccgcctgtgg tgcctcctga actgcgtccg ccgtctaggt 2700 aagtttaaag ctcaggtcga gaccgggcct ttgtccggcg ctcccttgga gcctacctag 2760 actcagccgg ctctccacgc tttgcctgac cctgcttgct caactctacg tctttgtttc 2820 gttttctgtt ctgcgccgtt acagatccaa gctgtgaccg gcgcctacga tatgaccgag 2880 tacaagccca cggtgcgcct cgccacccgc gacgacgtcc ccagggccgt acgcaccctc 2940 gccgccgcgt tcgccgacta ccccgccacg cgccacaccg tcgatccgga ccgccacatc 3000 gagcgggtca ccgagctgca agaactcttc ctcacgcgcg tcgggctcga catcggcaag 3060 gtgtgggtcg cggacgacgg cgccgcggtg gcggtctgga ccacgccgga gagcgtcgaa 3120 gcgggggcgg tgttcgccga gatcggcccg cgcatggccg agttgagcgg ttcccggctg 3180 gccgcgcagc aacagatgga aggcctcctg gcgccgcacc ggcccaagga gcccgcgtgg 3240 ttcctggcca ccgtcggcgt ctcgcccgac caccagggca agggtctggg cagcgccgtc 3300 gtgctccccg gagtggaggc ggccgagcgc gccggggtgc ccgccttcct ggagacctcc 3360 gcgccccgca acctcccctt ctacgagcgg ctcggcttca ccgtcaccgc cgacgtcgag 3420 gtgcccgaag gaccgcgcac ctggtgcatg acccgcaagc ccggtgcctg acaatcaacc 3480 tctggattac aaaatttgtg aaagattgac tggtattctt aactatgttg ctccttttac 3540 gctatgtgga tacgctgctt taatgccttt gtatcatgct attgcttccc gtatggcttt 3600 cattttctcc tccttgtata aatcctggtt gctgtctctt tatgaggagt tgtggcccgt 3660 tgtcaggcaa cgtggcgtgg tgtgcactgt gtttgctgac gcaaccccca ctggttgggg 3720 cattgccacc acctgtcagc tcctttccgg gactttcgct ttccccctcc ctattgccac 3780 ggcggaactc atcgccgcct gccttgcccg ctgctggaca ggggctcggc tgttgggcac 3840 tgacaattcc gtggtgttgt cggggaaatc atcgtccttt ccttggctgc tcgcctgtgt 3900 tgccacctgg attctgcgcg ggacgtcctt ctgctacgtc ccttcggccc tcaatccagc 3960 ggaccttcct tcccgcggcc tgctgccggc tctgcggcct cttccgcgtc ttcgccttcg 4020 ccctcagacg agtcggatct ccctttgggc cgcctccccg cctggtacct ttaagaccaa 4080 tgacttacaa ggcagctgta gatcttagcc actttttaaa agaaaagggg ggactggaag 4140 ggctaattca ctcccaacga agataagatc tgctttttgc ttgtactggg tctctctggt 4200 tagaccagat ctgagcctgg gagctctctg gctaactagg gaacccactg cttaagcctc 4260 aataaagctt gccttgagtg cttcaagtag tgtgtgcccg tctgttgtgt gactctggta 4320 actagagatc cctcagaccc ttttagtcag tgtggaaaat ctctagcagt agtagttcat 4380 gtcatcttat tattcagtat ttataacttg caaagaaatg aatatcagag agtgagagga 4440 acttgtttat tgcagcttat aatggttaca aataaagcaa tagcatcaca aatttcacaa 4500 ataaagcatt tttttcactg cattctagtt gtggtttgtc caaactcatc aatgtatctt 4560 atcatgtctg gctctagcta tcccgcccct aactccgccc atcccgcccc taactccgcc 4620 cagttccgcc cattctccgc cccatggctg actaattttt tttatttatg cagaggccga 4680 ggccgcctcg gcctctgagc tattccagaa gtagtgagga ggcttttttg gaggcctaga 4740 cttttgcaga gaccaaattc gtaatcatgt catagctgtt tcctgtgtga aattgttatc 4800 cgctcacaat tccacacaac atacgagccg gaagcataaa gtgtaaagcc tggggtgcct 4860 aatgagtgag ctaactcaca ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa 4920 acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta 4980 ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc 5040 gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca ggggataacg 5100 caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt 5160 tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa 5220 gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct 5280 ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc 5340 cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt tcggtgtagg 5400 tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct 5460 tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag 5520 cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga 5580 agtggtggcc taactacggc tacactagaa ggacagtatt tggtatctgc gctctgctga 5640 agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa accaccgctg 5700 gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag 5760 aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag 5820 ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatg agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc agtgctgcaa 6060 tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga agtagtagta agtagttcgc cagttaatag tttgcgcaac gttgttgcca 6240. ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc agctccggtt 6300 cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg gttagctcct 6360. tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc atggttatgg 6420 cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc atcattggaa 6600 aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc agttcgatgt 6660 aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc gtttctgggt 6720 gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt 6780 gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca 6840 tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat 6900 ttccccgaaa agtgccacct gacgtctaag aaaccattat tatcatgaca ttaacctata 6960 aaaataggcg tatcacgagg ccctttcgtc tcgcgcgttt cggtgatgac ggtgaaaacc 7020 tctgacacat gcagctcccg gagacggtca cagcttgtct gtaagcggat gccgggagca 7080 gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggctgg cttaactatg 7140 cggcatcaga gcagattgta ctgagagtgc accatatgcg gtgtgaaata ccgcacagat 7200 gcgtaaggag aaaataccgc atcaggcgcc attcgccatt caggctgcgc aactgttggg 7260 aagggcgatc ggtgcgggcc tcttcgctat tacgccagct ggcgaaaggg ggatgtgctg 7320 caaggcgatt aagttgggta acgccagggt tttcccagtc acgacgttgt aaaacgacgg 7380 ccagtgccaa gctg 7394 <210> 14 <211> 7193 <212> DNA <213> Artificial Sequence <220> <223> pCDH-CMV-MCS-EF1α-Blast lentivector <400> 14 acgcgtgtag tcttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca 60 acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta 120 cgatcgtgcc ttattaggaa ggcaacagac gggtctgaca tggattggac gaaccactga 180 attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc 240 tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta 300 agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact 360 ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg 420 cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct 480 tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaatttt 540 gactagcgga gggtagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 600 aattagatcg cgatgggaa aaattcggtt aaggccaggg ggaaagaaaaataatt 660 aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 720 agaaacatca gaaggctgta gaaaatact gggacagcta caccaccc ttcagacagg 780 atcagagaa cttagatcat tatatatac agtagcaacc ctctattgtg tgcatcaaag 840 gagagata aagahaacca aggaagcttt agagagata gaggagagc aaaaaaaaag 900 taagaccacc gcacagcaag cggccactga tcttcagacc tggagga gatatgaggg 960 acaattgag aagtgatta tataatata aagtagtaa attgaacca tggagtag 1020 cacccaccaa ggcaaagaga agagtggtgc aggagaaaa agagcagtg ggaataggag 1080 ctttgttcct tgggttctg ggagcagcag gaagcactat gggcgcagcg tcaatgacgc 1140 tgacggtaca ggccagacaa ttatgtctg gtatagtgca gcagcagaac aatttgctga 1200 gggctattga ggcgcaacag catctgttgc aactcacagt ctggggcatc aagcagctcc 1260 aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 1320 gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gaatgctagt tggagtaata 1380 aatctctgga acagatttgg aatcacacga cctggatgga gtgggacaga gaaattaaca 1440 attacacaag cttaatacac tccttaattg aagaatcgca aaaccagcaa gaaaagaatg 1500 aacaagaatt attggaatta gataaatggg caagtttgtg gaattggttt aacataacaa 1560 attggctgtg gtatataaa ttatcataa tgatagtagg aggcttggta ggtttaagaa 1620 tagtttttgc tgtactttct atagtgaata gagttaggca gggatattca ccattatcgt 1680 ttcagaccca cctcccaacc ccgaggggac ccgacaggcc cgaaggaata gaagaagaag 1740 gtggagagag agacagagac agatccattc gattagtgaa cggatctcga cggtatcggt 1800 taacttttaa aagaaaaggg gggattgggg ggtacagtgc aggggaaaga atagtagaca 1860 taatagcaac agacatacaa actaaagaat tacaaaaaca aattacaaaa ttcaaaattt 1920 tatcgattac tagtattatg cccagtacat gaccttatgg gactttccta cttggcagta 1980 catctacgta ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt acatcaatgg 2040 gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg acgtcaatgg 2100 gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca actccgcccc 2160 attgacgcaa atgggcggta ggcgtgtacg gtgggaggtt tatataagca gagctcgttt 2220 agtgaaccgt cagatcgcct ggagacgcca tccacgctgt tttgacctcc atagaagatt 2280 ctagagctag cgaattcgaa tttaaatcgg atccgcggcc gcaaggatct gcgatcgctc 2340 cggtgcccgt cagtgggcag agcgcacatc gcccacagtc cccgagaagt tgggggagg 2400 ggtcggcaat tgaacgggtg cctagagaag gtggcgcggg gtaaactggg aaagtgatgt 2460 cgtgtactgg ctccgccttt ttcccgaggg tggggagaa ccgtatataa gtgcagtagt 2520 cgccgtgaac gttctttttc gcaacgggtt tgccgccaga acacagctga agcttcgagg 2580 ggctcgcatc tctccttcac gcgcccgccg ccctacctga ggccgccatc cacgccggtt 2640 gagtcgcgtt ctgccgcctc ccgcctgtgg tgcctcctga actgcgtccg ccgtctaggt 2700 aagtttaaag ctcaggtcga gaccgggcct ttgtccggcg ctcccttgga gcctacctag 2760 actcagccgg ctctccacgc tttgcctgac cctgcttgct caactctacg tctttgtttc 2820 gttttctgtt ctgcgccgtt acagatccaa gctgtgaccg gcgcctacga tatggccaag 2880 cctttgtctc aagaagaatc caccctcatt gaaagagcaa cggctacaat caacagcatc 2940 cccatctctg aagactacag cgtcgccagc gcagctctct ctagcgacgg ccgcatcttc 3000 actggtgtca atgtatatca ttttactggg ggaccttgtg cagaactcgt ggtgctgggc 3060 actgctgctg ctgcggcagc tggcaacctg acttgtatcg tcgcgatcgg aaatgagaac 3120 aggggcatct tgagcccctg cggacggtgc cgacaggtgc ttctcgatct gcatcctggg 3180 atcaaagcca tagtgaagga cagtgatgga cagccgacgg cagttgggat tcgtgaattg 3240 ctgccctctg gttatgtgtg ggagggctaa caatcaacct ctggattaca aaatttgtga 3300 aagattgact ggtattctta actatgttgc tccttttacg ctatgtggat acgctgcttt 3360 aatgcctttg tatcatgcta ttgcttcccg tatggctttc attttctcct ccttgtataa 3420 atcctggttg ctgtctcttt atgaggagtt gtggcccgtt gtcaggcaac gtggcgtggt 3480 gtgcactgtg tttgctgacg caacccccac tggttggggc attgccacca cctgtcagct 3540 cctttccggg actttcgctt tccccctccc tattgccacg gcggaactca tcgccgcctg 3600 ccttgcccgc tgctggacag gggctcggct gttgggcact gacaattccg tggtgttgtc 3660 ggggaaatca tcgtcctttc cttggctgct cgcctgtgtt gccacctgga ttctgcgcgg 3720 gacgtccttc tgctacgtcc cttcggccct caatccagcg gaccttcctt cccgcggcct 3780 gctgccggct ctgcggcctc ttccgcgtct tcgccttcgc cctcagacga gtcggatctc 3840 cctttgggcc gcctccccgc ctggtacctt taagaccaat gacttacaag gcagctgtag 3900 atcttagcca ctttttaaaa gaaaaggggg gactggaagg gctaattcac tcccaacgaa 3960 gataagatct gctttttgct tgtactgggt ctctctggtt agaccagatc tgagcctggg 4020 agctctctgg ctaactaggg aacccactgc ttaagcctca ataaagcttg ccttgagtgc 4080 ttcaagtagt gtgtgcccgt ctgttgtgtg actctggtaa ctagagatcc ctcagaccct 4140 tttagtcagt gtggaaaatc tctagcagta gtagttcatg tcatcttatt attcagtatt 4200 tataacttgc aaagaaatga atatcagaga gtgagaggaa cttgtttatt gcagcttata 4260 atggttacaa ataaagcaat agcatcacaa atttcacaaa taaagcattt ttttcactgc 4320 attctagttg tggtttgtcc aaactcatca atgtatctta tcatgtctgg ctctagctat 4380 cccgccccta actccgccca tcccgcccct aactccgccc agttccgccc attctccgcc 4440 ccatggctga ctaatttttt ttatttatgc agaggccgag gccgcctcgg cctctgagct 4500 attccagaag tagtgaggag gcttttttgg aggcctagac ttttgcagag accaaattcg 4560 taatcatgtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca 4620 tacgagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagc taactcacat 4680 taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt 4740 aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct 4800 cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa 4860 aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa 4920 aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc 4980 tccgcccccc tgacgagcat cacaaaaaatc gacgctcaag tcagaggtgg cgaaacccga 5040 caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc 5100 cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt 5160 ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctggggct 5220 gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg 5280 agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta 5340 gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct 5400 acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa 5460 gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt 5520 gcaagcagca gattacgc agaaaaaaag gatctcaaga agatcctttg atcttttcta 5580 cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat 5640 caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa 5700 gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct 5760 cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta 5820 cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct 5880 caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg 5940 gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa 6000 gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt 6060 cacgctcgtc gtttggtatg gcttcattca gctccggttc caacgatca aggcgagtta 6120 catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca 6180 gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca tcattggaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa 6540. atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac attttgaat gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg acgtctaaga aaccattatt atcatgacat taacctataa aaataggcgt atcacgaggc cctttcgtct cgcgcgtttc ggtgatgacg gtgaaaacct ctgacacatg cagctcccgg 6840. agcggtcac agcttgtctg tagcggatg ccggggagcag acaagcccgt cagggcgcgt 6900 cagcgggtgt tggcgggtgt cggggctggc ttaactatgc ggcatcagag cagattgtac 6960 tgagagtgca ccatatgcgg tgtgaaatac cgcacagatg cgtaaggaga aaataccgca 7020 tcaggcgcca ttcgccattc aggctgcgca actgttggga agggcgatcg gtgcgggcct 7080 cttcgctatt acgccagctg gcgaaagggg gatgtgctgc aaggcgatta agttgggtaa 7140 cgccagggtt ttcccagtca cgacgttgta aaacgacggc cagtgccaag ctg 7193 <210> 15 <211> 8159 <212> DNA <213> Artificial Sequence <220> <223> pCG1_SCoV2-S plasmid <400> 15 gaattcgagc tcgccccgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 60 acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 120 ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 180 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 240 ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 300 tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc 360 ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg agttgtttt 420 ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa 480 tgggcggtag gcgtgtacgg tgggaggtct atataagcag agctcgttta gtgaaccgtc 540 agatcgcctg gagacgccat ccacgctgtt ttgacctcca tagagacac cgggaccgat 600 ccagcctccg ggggatcgat cccccgatcc tgagaacttc agggtgagtt tggggaccct 660 tgattgttct ttctttttcg ctattgtaaa attcatgtta tatggagggg gcaaagtttt 720 cagggtgttg tttagaatgg gaagatgtcc cttgtatcac catggaccct catgataatt 780 ttgtttcttt cactttctac tctgttgaca accattgtct cctcttattt tcttttcatt 840 ttctgtaact ttttcgttaa actttagctt gcatttgtaa cgaattttta aattcacttt 900 tgtttatttg tcagattgta agtactttct ctaatcactt ttttttcaag gcaatcaggg 960 tatattatat tgtacttcag cacagtttta gagaacaatt gttataatta aatgataagg 1020 tagaatattt ctgcatataa attctggctg gcgtggaaat attcttattg gtagaaacaa 1080 ctacatcctg gtcatcatcc tgcctttctc tttatggtta caatgatata cactgtttga 1140 gatgaggata aaatactctg agtccaaacc gggcccctct gctaaccatg ttcatgcctt 1200 cttctttttc ctacagctcc tgggcaacgt gctggttatt gtgctgtctc atcatttttgg 1260 caaagaattg tatacgact cactataggg cgaattcgga tccgccacca tgttcgtgtt 1320 tctggtgctg ctgcctctgg tgtccagcca gtgtgtgaac ctgaccacaa gaacccagct 1380 gcctccagcc tacaccaaca gctttaccag aggcgtgtac taccccgaca aggtgttcag 1440 atccagcgtg ctgcactcta cccaggacct gttcctgcct ttcttcagca acgtgacctg 1500 gttccacgcc atccacgtgt ccggcaccaa tggcaccaag agattcgaca accccgtgct 1560 gcccttcaac gacggggtgt actttgccag caccgagaag tccaacatca tcagaggctg 1620 gatcttcggc accacactgg acagcaagac ccagagcctg ctgatcgtga acaacgccac 1680 caacgtggtc atcaaagtgt gcgagttcca gttctgcaac gaccccttcc tgggcgtcta 1740 ctatcacaag aacaacaaga gctggatgga aagcgagttc cgggtgtaca gcagcgccaa 1800 caactgcacc ttcgagtacg tgtcccagcc tttcctgatg gacctggaag gcaagcaggg 1860 caacttcaag aacctgcgcg agttcgtgtt caagaacatc gacggctact tcaagatcta 1920 cagcaagcac acccctatca acctcgtgcg ggatctgcct cagggcttct ctgctctgga 1980 acccctggtg gatctgccca tcggcatcaa catcacccgg tttcagacac tgctggccct 2040 gcacagaagc tacctgacac ctggcgatag cagcagcgga tggacagctg gtgccgccgc 2100 ttactatgtg ggctacctgc agcctagaac cttcctgctg aagtacaacg agaacggcac 2160 catcaccgac gccgtggatt gtgcccttga tcctctgagc gagacaaagt gcaccctgaa 2220 gtccttcacc gtggaaaagg gcatctacca gaccagcaac ttccgggtgc agcccaccga 2280 atccatcgtg cggttcccca atatcaccaa tctgtgcccc ttcggcgagg tgttcaatgc 2340 caccagattc gcctctgtgt acgcctggaa ccggaagcgg atcagcaatt gcgtggccga 2400 ctactccgtg ctgtacaact ccgccagctt cagcaccttc aagtgctacg gcgtgtcccc 2460 taccaagctg aacgacctgt gcttcacaaa cgtgtacgcc gacagcttcg tgatccgggg 2520 agatgaagtg cggcagattg cccctggaca gacaggcaag atcgccgact acaactacaa 2580 gctgcccgac gacttcaccg gctgtgtgat tgcctggaac agcaacaacc tggactccaa 2640 agtcggcggc aactacaatt acctgtaccg gctgttccgg aagtccaatc tgaagccctt 2700 cgagcgggac atctccaccg agatctatca ggccggcagc accccttgta acggcgtgga 2760 aggcttcaac tgctacttcc cactgcagtc ctacggcttt cagcccacaa atggcgtggg 2820 ctatcagccc tacagagtgg tggtgctgag cttcgaactg ctgcatgccc ctgccacagt 2880 gtgcggccct aagaaaagca ccaatctcgt gaagaacaaa tgcgtgaact tcaacttcaa 2940 cggcctgacc ggcaccggcg tgctgacaga gagcaacaag aagttcctgc cattccagca 3000 3060 cctggacatc accccttgca gcttcggcgg agtgtctgtg atcacccctg gcaccaacac 3120 cagcaatcag gtggcagtgc tgtaccagga cgtgaactgt accgaagtgc ccgtggccat 3180 tcacgccgat cagctgacac ctacatggcg ggtgtactcc accggcagca atgtgtttca 3240 gaccagagcc ggctgtctga tcggagccga gcacgtgaac aatagctacg agtgcgacat 3300 ccccatcggc gctggcatct gtgccagcta ccagacacag acaacagcc ccagacgggc 3360 cagatctgtg gccagccaga gcatcattgc ctacacaatg tctctgggcg ccgagaacag 3420 cgtggcctac tccaacaact ctatcgctat ccccaccaac ttcaccatca gcgtgaccac 3480 agagatcctg cctgtgtcca tgaccaagac cagcgtggac tgcaccatgt acatctgcgg 3540 cgattccacc gagtgctcca acctgctgct gcagtacggc agcttctgca cccagctgaa 3600 tagagccctg acagggatcg ccgtggaaca ggacaagaac acccaagagg tgttcgccca 3660 agtgaagcag atctacaaga cccctcctat caaggacttc ggcggcttca atttcagcca 3720 gattctgccc gatcctagca agcccagcaa gcggagcttc atcgaggacc tgctgttcaa 3780 caaagtgaca ctggccgacg ccggcttcat caagcagtat ggcgattgtc tgggcgacat 3840 tgccgccagg gatctgattt gcgcccagaa gtttaacgga ctgacagtgc tgccaccact 3900 gctgaccgat gagatgatcg cccagtacac atctgccctg ctggccggca caatcacaag 3960 cgggctggaca tttggagctg gcgccgctct gcagatcccc tttgctatgc agatggccta 4020 ccggttcaac ggcatcggag tgacccagaa tgtgctgtac gagaccaga agctgatcgc 4080 caaccagttc aacagcgcca tcggcaagat ccaggacagc ctgagcagca cagcaagcgc 4140 cctgggaaag ctgcaggacg tggtcaacca gaatgcccag gcactgaaca ccctggtcaa 4200 gcagctgtcc tccaacttcg gcgccatcag ctctgtgctg aacgatatcc tgagcagact 4260 ggacaaggtg gaagccgagg tgcagatcga cagactgatc accggaaggc tgcagtccct 4320 gcagacctac gttacccagc agctgatcag agccgccgag attagagcct ctgccaatct 4380 ggccgccacc aagatgtctg agtgtgtgct gggccagagc aagagagtgg acttttgcgg 4440 caagggctac cacctgatga gcttccctca gtctgcccct cacggcgtgg tgtttctgca 4500 cgtgacatac gtgcccgctc aagagaagaa tttcaccacc gctccagcca tctgccacga 4560 cggcaaagcc cactttccta gagaaggcgt gttcgtgtcc aacggcaccc attggttcgt 4620 gacccagcgg aacttctacg agccccagat catcaccacc gacaacacct tcgtgtctgg 4680 caactgcgac gtcgtgatcg gcattgtgaa caataccgtg tacgaccctc tgcagcccga 4740 gctggacagc ttcaaagagg aactggataa gtactttaag aaccacacaa gccccgacgt 4800 ggacctgggc gatatcagcg gaatcaatgc cagcgtcgtg aacatccaga aagagatcga 4860 ccgggctgaac gaggtggcca agaatctgaa cgagagcctg atcgacctgc aagaactggg 4920 gaagtacgag footcatca agtggccctg gtacatctgg ctgggcttta tcgccggact 4980 gattgccatc gtgatggtca caatcatgct gtgttgcatg accagctgct gtagctgcct 5040 gaagggctgt tgtagctgtg gcagctgctg caagttcgac gaggacgatt ctgagcccgt 5100 gctgaagggc gtgaaactgc actacaccta atctagagtc gactgtttaa acctgcaggc 5160 atgcaagctg atctttttcc ctctgccaaa aattatgggg acatcatgaa gccccttgag 5220 catctgactt ctggctaata aaggaaaattt attttcattg caatagtgtg ttggaatttt 5280 ttgtgtctct cactcggaag gacatatggg agggcaaatc atttaaaaca tcagaatgag 5340 tatttggttt agagtttggc aacatatgcc atatgctggc tgccatgaac aaaggtggct 5400 ataaagaggt catcagtata tgaaacagcc ccctgctgtc cattccttat tccatagaaa 5460 agccttgact tgaggttaga tttttttat attttgtttt gtgtttttt tttctttaac 5520 atccctaaaa ttttccttac atgttttact agccagattt ttcctcctct cctgactact 5580 cccagtcata gctgtccctc ttctctttag aactcgagga gctttttgca aaagcctagg 5640 cctccaaaaa agcctcctca ctacttctgg aatagctcag aggccgaggc ggcctcggcc 5700 tctgcataaa taaaaaaaat tagtcagcca tggggcggag aatgggcgga actgggcgga 5760 gttaggggcg ggatgggcgg agttaggggc gggactatgg ttgctggacta attgagactg 5820 cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg ctcttccgct 5880 tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac 5940 tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga 6000 gcaaaaggcc agcaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat 6060 aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac 6120 ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct 6180 gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg 6240 ctttctcaat gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg 6300 ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt 6360 cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg 6420 attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac 6480 ggctacacta gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga 6540 aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggtttttt 6600 gtttgcaagc agcagattac gcgcagaaa aaaggatctc aagaagatcc tttgatcttt 6660 tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga 6720 ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc 6780 taaagtatat atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct 6840 atctcagcga tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata 6900 actacgatac gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca 6960 cgctcaccgg ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga 7020 agtggtcctg caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga 7080 gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg ccattgctac aggcatcgtg 7140 gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga 7200 gttacatgat cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt 7260 gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct 7320 cttactgtca tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca 7380 ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat acgggataat 7440 accgcgccac atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga 7500 aaactctcaa ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc 7560 aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg 7620 caaaatgccg caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc 7680 cttttcaat attattgaag catttatcag ggttattgtc tcatgagcgg atacatattt 7740 gaatgtattt agaaaaataa acaaataggg gttccgcgca catttccccg aaaacgtctt 7800 caagctgcct cgcgcgttc ggtgatgacg gtgaaaacct ctgacacatg cagctcccgg 7860 agacggtcac agcttgtctg taagcggatg ccgggagcag acaagcccgt cagggcgcgt 7920 cagcgggtgt tggcgggtgt cggggcgcag ccatgaccca gtcacgtagc gatagcggag 7980 ttggcttaac tatgcggcat cagagcagat tgtactgaga gtgcaccata tcgacgctct 8040 cccttatgcg actcctgcat taggaagcag cccagtagta ggttgaggcc gttgagcacc 8100 gccgccgcaa ggaatggtgc tggcttatcg aaattaatcg actcactata gggagaccc 8159 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> G614 Spike primer 1 <400> 16 gcgtgaactg taccgaagtg 20 <210> 17 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> G614 Spike primer 2 <400> 17 cctggtacag cactgcc 17 <210> 18 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Truncated SARS-CoV2-Spike primer 1 <400> 18 agcgaattcg gatccgcc 18 <210> 19 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Truncated SARS-CoV2-Spike primer 2 <400> 19 acagtcgact ctagattagc agcagctgcc acag 34 <210> 20 <211> 8159 <212> DNA <213> Artificial Sequence <220> <223> plasmids encoding Spike G614 Full length(FL) <400> 20 gaattcgagc tcgccccgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 60 acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 120 ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 180 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 240 ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 300 tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc 360 ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt 420 ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa 480 tgggcggtag gcgtgtacgg tgggaggtct atataagcag agctcgttta gtgaaccgtc 540 agatcgcctg gagacgccat ccacgctgtt ttgacctcca tagaagacac cgggaccgat 600 ccagcctccg ggggatcgat cccccgatcc tgagaacttc agggtgagtt tggggaccct 660 tgattgttct ttctttttcg ctattgtaaa attcatgtta tatggagggg gcaaagtttt 720 cagggtgttg tttagaatgg gaagatgtcc cttgtatcac catggaccct catgataatt 780 ttgtttcttt cactttctac tctgttgaca accattgtct cctcttattt tcttttcatt 840 ttctgtaact ttttcgttaa actttagctt gcatttgtaa cgaattttta aattcacttt 900 tgttattg tcagattgta agtactttct ctaatcactt ttttttcaag gcaatcaggg 960 tatattatat tgtacttcag cacagtttta gagaacaatt gttataatta aatgataagg 1020 tagaatattt ctgcatataa attctggctg gcgtggaaat attcttattg gtagaaacaa 1080 ctacatcctg gtcatcatcc tgcctttctc tttatggtta caatgatata cactgtttga 1140 gatgaggata aaatactctg agtccaaacc gggcccctct gctaaccatg ttcatgcctt 1200 cttctttttc ctacagctcc tgggcaacgt gctggttatt gtgctgtctc atcatttttgg 1260 caaagaattg taatacgact cactataggg cgaattcgga tccgccacca tgttcgtgtt 1320 tctggtgctg ctgcctctgg tgtccagcca gtgtgtgaac ctgaccacaa gaacccagct 1380 gcctccagcc tacaccaaca gctttaccag aggcgtgtac taccccgaca aggtgttcag 1440 atccagcgtg ctgcactcta cccaggacct gttcctgcct ttcttcagca acgtgacctg 1500 gttccacgcc atccacgtgt ccggcaccaa tggcaccaag agattcgaca accccgtgct 1560 gcccttcaac gacggggtgt actttgccag caccgagaag tccaacatca tcagaggctg 1620 gatcttggc accacactgg acagcaagac ccagagcctg ctgatcgtga acaacgccac 1680 caacgtggtc atcaaagtgt gcgagttcca gttctgcaac gaccccttcc tgggcgtcta 1740 ctatcacaag aacaacaaga gctggatgga aagcgagttc cgggtgtaca gcagcgccaa 1800 caactgcacc ttcgagtacg tgtcccagcc tttcctgatg gacctggaag gcaagcaggg 1860 caacttcaag aacctgcgcg agttcgtgtt caagaacatc gacggctact tcaagatcta 1920 cagcaagcac acccctatca acctcgtgcg ggatctgcct cagggcttct ctgctctgga 1980 acccctggtg gatctgccca tcggcatcaa catcacccgg tttcagacac tgctggccct 2040 gcacagaagc tacctgacac ctggcgatag cagcagcgga tggacagctg gtgccgccgc 2100 ttactatgtg ggctacctgc agcctagaac cttcctgctg aagtacaacg agaacggcac 2160 catcaccgac gccgtggatt gtgcccttga tcctctgagc gagacaaagt gcaccctgaa 2220 gtccttcacc gtggaaaagg gcatctacca gaccagcaac ttccgggtgc agcccaccga 2280 atccatcgtg cggttcccca atatcaccaa tctgtgcccc ttcggcgagg tgttcaatgc 2340 caccagattc gcctctgtgt acgcctggaa ccggaagcgg atcagcaatt gcgtggccga 2400 ctactccgtg ctgtacaact ccgccagctt cagcaccttc aagtgctacg gcgtgtcccc 2460 taccaagctg aacgacctgt gcttcacaaa cgtgtacgcc gacagcttcg tgatccgggg 2520 agatgaagtg cggcagattg cccctggaca gacaggcaag atcgccgact acaactacaa 2580 gctgcccgac gacttcaccg gctgtgtgat tgcctggaac agcaacaacc tggactccaa 2640 agtcggcggc aactacaatt acctgtaccg gctgttccgg aagtccaatc tgaagccctt 2700 cgagcgggac atctccaccg agatctatca ggccggcagc accccttgta acggcgtgga 2760 aggcttcaac tgctacttcc cactgcagtc ctacggcttt cagcccacaa atggcgtggg 2820 ctatcagccc tacagagtgg tggtgctgag cttcgaactg ctgcatgccc ctgccacagt 2880 gtgcggccct aagaaaagca ccaatctcgt gaagaacaaa tgcgtgaact tcaacttcaa 2940 cggcctgacc ggcaccggcg tgctgacaga gagcaacaag aagttcctgc cattccagca 3000 3060 cctggacatc accccttgca gcttcggcgg agtgtctgtg atcacccctg gcaccaacac 3120 cagcaatcag gtggcagtgc tgtaccaggg cgtgaactgt accgaagtgc ccgtggccat 3180 tcacgccgat cagctgacac ctacatggcg ggtgtactcc accggcagca atgtgtttca 3240 gaccagagcc ggctgtctga tcggagccga gcacgtgaac aatagctacg agtgcgacat 3300 ccccatcggc gctggcatct gtgccagcta ccagacacag acaacagcc ccagacgggc 3360 cagatctgtg gccagccaga gcatcattgc ctacacaatg tctctgggcg ccgagaacag 3420 cgtggcctac tccaacaact ctatcgctat ccccaccaac ttcaccatca gcgtgaccac 3480 agagatcctg cctgtgtcca tgaccaagac cagcgtggac tgcaccatgt acatctgcgg 3540 cgattccacc gagtgctcca acctgctgct gcagtacggc agcttctgca cccagctgaa 3600 tagagccctg acagggatcg ccgtggaaca ggacaagaac acccaagagg tgttcgccca 3660 agtgaagcag atctacaaga cccctcctat caaggacttc ggcggcttca atttcagcca 3720 gattctgccc gatcctagca agcccagcaa gcggagcttc atcgaggacc tgctgttcaa 3780 caaagtgaca ctggccgacg ccggcttcat caagcagtat ggcgattgtc tgggcgacat 3840 tgccgccagg gatctgattt gcgcccagaa gtttaacgga ctgacagtgc tgccaccact 3900 gctgaccgat gagatgatcg cccagtacac atctgccctg ctggccggca caatcacaag 3960 cgggctggaca tttggagctg gcgccgctct gcagatcccc tttgctatgc agatggccta 4020 ccggttcaac ggcatcggag tgacccagaa tgtgctgtac gagaccaga agctgatcgc 4080 caaccagttc aacagcgcca tcggcaagat ccaggacagc ctgagcagca cagcaagcgc 4140 cctgggaaag ctgcaggacg tggtcaacca gaatgcccag gcactgaaca ccctggtcaa 4200 gcagctgtcc tccaacttcg gcgccatcag ctctgtgctg aacgatatcc tgagcagact 4260 ggacaaggtg gaagccgagg tgcagatcga cagactgatc accggaaggc tgcagtccct 4320 gcagacctac gttacccagc agctgatcag agccgccgag attagagcct ctgccaatct 4380 ggccgccacc aagatgtctg agtgtgtgct gggccagagc aagagagtgg acttttgcgg 4440 caagggctac cacctgatga gcttccctca gtctgcccct cacggcgtgg tgtttctgca 4500 cgtgacatac gtgcccgctc aagagaagaa tttcaccacc gctccagcca tctgccacga 4560 cggcaaagcc cactttccta gagaaggcgt gttcgtgtcc aacggcaccc attggttcgt 4620 gacccagcgg aacttctacg agccccagat catcaccacc gacaacacct tcgtgtctgg 4680 caactgcgac gtcgtgatcg gcattgtgaa caataccgtg tacgaccctc tgcagcccga 4740 gctggacagc ttcaaagagg aactggataa gtactttaag aaccacacaa gccccgacgt 4800 ggacctgggc gatatcagcg gaatcaatgc cagcgtcgtg aacatccaga aagagatcga 4860 ccgggctgaac gaggtggcca agaatctgaa cgagagcctg atcgacctgc aagaactggg 4920 gaagtacgag footcatca agtggccctg gtacatctgg ctgggcttta tcgccggact 4980 gattgccatc gtgatggtca caatcatgct gtgttgcatg accagctgct gtagctgcct 5040 gaagggctgt tgtagctgtg gcagctgctg caagttcgac gaggacgatt ctgagcccgt 5100 gctgaagggc gtgaaactgc actacaccta atctagagtc gactgtttaa acctgcaggc 5160 atgcaagctg atctttttcc ctctgccaaa aattatgggg acatcatgaa gccccttgag 5220 catctgactt ctggctaata aaggaaaattt attttcattg caatagtgtg ttggaatttt 5280 ttgtgtctct cactcggaag gacatatggg agggcaaatc atttaaaaca tcagaatgag 5340 tatttggttt agagtttggc aacatatgcc atatgctggc tgccatgaac aaaggtggct 5400 ataaagaggt catcagtata tgaaacagcc ccctgctgtc cattccttat tccatagaaa 5460 agccttgact tgaggttaga ttttttttat attttgtttt gtgtttttt tttctttaac 5520 atccctaaaa ttttccttac atgttttact agccagattt ttcctcctct cctgactact 5580 cccagtcata gctgtccctc ttctctttag aactcgagga gctttttgca aaagcctagg 5640 cctccaaaaa agcctcctca ctacttctgg aatagctcag aggccgaggc ggcctcggcc 5700 tctgcataaa taaaaaaaat tagtcagcca tggggcggag aatgggcgga actgggcgga 5760 gttaggggcg ggatgggcgg agttaggggc gggactatgg ttgctggacta attgagactg 5820 cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg ctcttccgct 5880 tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac 5940 tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga 6000 gcaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat 6060 aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac 6120 ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct 6180 gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg 6240 ctttctcaat gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg 6300 ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt 6360 cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg 6420 attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac 6480 ggctacacta gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga 6540 aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggtttttt 6600 gtttgcaagc agcagattac gcgcagaaa aaaggatctc aagaagatcc tttgatcttt 6660 tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga 6720 tttcaaaaa ggatcttcac ctagatcctt ttaaattaaa aatgaagtttt taaatcaatc 6780 taaagtatat atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct 6840 atctcagcga tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata 6900 actacgatac gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca 6960 cgctcaccgg ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga 7020 agtggtcctg caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga 7080 gtaagtagtt cgccagttaa tagttgcgc aacgttgttg ccattgctac aggcatcgtg 7140 gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga 7200 gttacatgat cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt 7260 gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct 7320 cttactgtca tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca 7380 ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat acgggataat 7440 accgcgccac atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga 7500 aaactctcaa ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc 7560 aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg 7620 caaaatgccg caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc 7680 cttttcaat attattgaag catttatcag ggttattgtc tcatgagcgg atacatattt 7740 gaatgtattt agaaaaataa acaaataggg gttccgcgca catttccccg aaaacgtctt 7800 caagctgcct cgcgcgttc ggtgatgacg gtgaaaacct ctgacacatg cagctcccgg 7860 agacggtcac agcttgtctg taagcggatg ccgggagcag acaagcccgt cagggcgcgt 7920 cagcgggtgt tggcgggtgt cggggcgcag ccatgaccca gtcacgtagc gatagcggag 7980 ttggcttaac tatgcggcat cagagcagat tgtactgaga gtgcaccata tcgacgctct 8040 cccttatgcg actcctgcat taggaagcag cccagtagta ggttgaggcc gttgagcacc 8100 gccgccgcaa ggaatggtgc tggcttatcg aaattaatcg actcactata gggagaccc 8159 <210> 21 <211> 8102 <212> DNA <213> Artificial Sequence <220> <223> Plasmids encoding Spike D614 DeltaCter <400> 21 gaattcgagc tcgccccgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 60 acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 120 ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 180 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 240 ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 300 tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc 360 ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg agttgtttt 420 ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa 480 tgggcggtag gcgtgtacgg tgggaggtct atataagcag agctcgttta gtgaaccgtc 540 agatcgcctg gagacgccat ccacgctgtt ttgacctcca tagagacac cgggaccgat 600 ccagcctccg ggggatcgat cccccgatcc tgagaacttc agggtgagtt tggggaccct 660 tgattgttct ttctttttcg ctattgtaaa attcatgtta tatggagggg gcaaagtttt 720 cagggtgttg tttagaatgg gaagatgtcc cttgtatcac catggaccct catgataatt 780 ttgtttcttt cactttctac tctgttgaca accattgtct cctcttattt tcttttcatt 840 ttctgtaact ttttcgttaa actttagctt gcatttgtaa cgaattttta aattcacttt 900 tgttattg tcagattgta agtactttct ctaatcactt ttttttcaag gcaatcaggg 960 tatattatat tgtacttcag cacagtttta gagaacaatt gttataatta aatgataagg 1020 tagaatattt ctgcatataa attctggctg gcgtggaaat attcttattg gtagaaacaa 1080 ctacatcctg gtcatcatcc tgcctttctc tttatggtta caatgatata cactgtttga 1140 gatgaggata aaatactctg agtccaaacc gggcccctct gctaaccatg ttcatgcctt 1200 cttctttttc ctacagctcc tgggcaacgt gctggttatt gtgctgtctc atcatttttgg 1260 caaagaattg tatacgact cactataggg cgaattcgga tccgccacca tgttcgtgtt 1320 tctggtgctg ctgcctctgg tgtccagcca gtgtgtgaac ctgaccacaa gaacccagct 1380 gcctccagcc tacaccaaca gctttaccag aggcgtgtac taccccgaca aggtgttcag 1440 atccagcgtg ctgcactcta cccaggacct gttcctgcct ttcttcagca acgtgacctg 1500 gttccacgcc atccacgtgt ccggcaccaa tggcaccaag agattcgaca accccgtgct 1560 gcccttcaac gacggggtgt actttgccag caccgagaag tccaacatca tcagaggctg 1620 gatcttcggc accacactgg acagcaagac ccagagcctg ctgatcgtga acaacgccac 1680 caacgtggtc atcaaagtgt gcgagttcca gttctgcaac gaccccttcc tgggcgtcta 1740 ctatcacaag aacaacaaga gctggatgga aagcgagttc cgggtgtaca gcagcgccaa 1800 caactgcacc ttcgagtacg tgtcccagcc tttcctgatg gacctggaag gcaagcaggg 1860 caacttcaag aacctgcgcg agttcgtgtt caagaacatc gacggctact tcaagatcta 1920 cagcaagcac acccctatca acctcgtgcg ggatctgcct cagggcttct ctgctctgga 1980 acccctggtg gatctgccca tcggcatcaa catcacccgg tttcagacac tgctggccct 2040 gcacagaagc tacctgacac ctggcgatag cagcagcgga tggacagctg gtgccgccgc 2100 ttactatgtg ggctacctgc agcctagaac cttcctgctg aagtacaacg agaacggcac 2160 catcaccgac gccgtggatt gtgcccttga tcctctgagc gagacaaagt gcaccctgaa 2220 gtccttcacc gtggaaaagg gcatctacca gaccagcaac ttccgggtgc agcccaccga 2280 atccatcgtg cggttcccca atatcaccaa tctgtgcccc ttcggcgagg tgttcaatgc 2340 caccagattc gcctctgtgt acgcctggaa ccggaagcgg atcagcaatt gcgtggccga 2400 ctactccgtg ctgtacaact ccgccagctt cagcaccttc aagtgctacg gcgtgtcccc 2460 taccaagctg aacgacctgt gcttcacaaa cgtgtacgcc gacagcttcg tgatccgggg 2520 agatgaagtg cggcagattg cccctggaca gacaggcaag atcgccgact acaactacaa 2580 gctgcccgac gacttcaccg gctgtgtgat tgcctggaac agcaacaacc tggactccaa 2640 agtcggcggc aactacaatt acctgtaccg gctgttccgg aagtccaatc tgaagccctt 2700 cgagcgggac atctccaccg agatctatca ggccggcagc accccttgta acggcgtgga 2760 aggcttcaac tgctacttcc cactgcagtc ctacggcttt cagcccacaa atggcgtggg 2820 ctatcagccc tacagagtgg tggtgctgag cttcgaactg ctgcatgccc ctgccacagt 2880 gtgcggccct aagaaaagca ccaatctcgt gaagaacaaa tgcgtgaact tcaacttcaa 2940 cggcctgacc ggcaccggcg tgctgacaga gagcaacaag aagttcctgc cattccagca 3000 3060 cctggacatc accccttgca gcttcggcgg agtgtctgtg atcacccctg gcaccaacac 3120 cagcaatcag gtggcagtgc tgtaccagga cgtgaactgt accgaagtgc ccgtggccat 3180 tcacgccgat cagctgacac ctacatggcg ggtgtactcc accggcagca atgtgtttca 3240 gaccagagcc ggctgtctga tcggagccga gcacgtgaac aatagctacg agtgcgacat 3300 ccccatcggc gctggcatct gtgccagcta ccagacacag acaacagcc ccagacgggc 3360 cagatctgtg gccagccaga gcatcattgc ctacacaatg tctctgggcg ccgagaacag 3420 cgtggcctac tccaacaact ctatcgctat ccccaccaac ttcaccatca gcgtgaccac 3480 agagatcctg cctgtgtcca tgaccaagac cagcgtggac tgcaccatgt acatctgcgg 3540 cgattccacc gagtgctcca acctgctgct gcagtacggc agcttctgca cccagctgaa 3600 tagagccctg acagggatcg ccgtggaaca ggacaagaac acccaagagg tgttcgccca 3660 agtgaagcag atctacaaga cccctcctat caaggacttc ggcggcttca atttcagcca 3720 gattctgccc gatcctagca agcccagcaa gcggagcttc atcgaggacc tgctgttcaa 3780 caaagtgaca ctggccgacg ccggcttcat caagcagtat ggcgattgtc tgggcgacat 3840 tgccgccagg gatctgattt gcgcccagaa gtttaacgga ctgacagtgc tgccaccact 3900 gctgaccgat gagatgatcg cccagtacac atctgccctg ctggccggca caatcacaag 3960 cggctggaca tttggagctg gcgccgctct gcagatcccc tttgctatgc agatggccta 4020 ccggttcaac ggcatcggag tgacccagaa tgtgctgtac gagaaccaga agctgatcgc 4080 caaccagttc aacagcgcca tcggcaagat ccaggacagc ctgagcagca cagcaagcgc 4140 cctgggaaag ctgcaggacg tggtcaacca gaatgcccag gcactgaaca ccctggtcaa 4200 gcagctgtcc tccaacttcg gcgccatcag ctctgtgctg aacgatatcc tgagcagact 4260 ggacaaggtg gaagccgagg tgcagatcga cagactgatc accggaaggc tgcagtccct 4320 gcagacctac gttacccagc agctgatcag agccgccgag attagagcct ctgccaatct 4380 ggccgccacc aagatgtctg agtgtgtgct gggccagagc aagagagtgg acttttgcgg 4440 caagggctac cacctgatga gcttccctca gtctgcccct cacggcgtgg tgtttctgca 4500 cgtgacatac gtgcccgctc aagagaagaa tttcaccacc gctccagcca tctgccacga 4560 cggcaaagcc cactttccta gagaaggcgt gttcgtgtcc aacggcaccc attggttcgt 4620 gacccagcgg aacttctacg agccccagat catcaccacc gacaacacct tcgtgtctgg 4680 caactgcgac gtcgtgatcg gcattgtgaa caataccgtg tacgaccctc tgcagcccga 4740 gctggacagc ttcaaagagg aactggataa gtactttaag aaccacacaa gccccgacgt 4800 ggacctgggc gatatcagcg gaatcaatgc cagcgtcgtg aacatccaga aagagatcga 4860 ccgggctgaac gaggtggcca agaatctgaa cgagagcctg atcgacctgc aagaactggg 4920 gaagtacgag footcatca agtggccctg gtacatctgg ctgggcttta tcgccggact 4980 gattgccatc gtgatggtca caatcatgct gtgttgcatg accagctgct gtagctgcct 5040 gaagggctgt tgtagctgtg gcagctgctg ctaatctaga gtcgactgtt taaacctgca 5100 ggcatgcaag ctgatctttt tccctctgcc aaaaattatg gggacatcat gaagcccctt 5160 gagcatctga cttctggcta ataaaggaaa tttattttca ttgcaatagt gtgttggaat 5220 tttttgtgtc tctcactcgg aggacatat gggagggcaa atcatttaaa acatcagaat 5280 gagtatttgg tttagagttt ggcaacatat gccatatgct ggctgccatg aacaaaggtg 5340 gctataaaga ggtcatcagt atatgaaaca gccccctgct gtccattcct tattccatag 5400 aaaagccttg acttgaggtt agattttttt tatattttgt tttgtgttat ttttttcttt 5460 aacatcccta aaattttcct tacatgtttt actagccaga tttttcctcc tctcctgact 5520 actcccagtc atagctgtcc ctcttctctt atgaactcga ggagcttttt gcaaaagcct 5580 aggcctccaa aaaagcctcc tcactacttc tggaatagct cagaggccga ggcggcctcg 5640 gcctctgcat aaataaaaa aattagtcag ccatggggcg gagaatgggc ggaactgggc 5700 ggagttaggg gcgggatggg cggagttagg ggcgggacta tggttgctga ctaattgaga 5760 ctgcattaat gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc 5820 gcttcctcgc tcactgactc gctccgctcg gtcgttcggc tgcggcgagc ggtatcagct 5880 cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg 5940 tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc 6000 cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga 6060 aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct 6120 cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg 6180 gcgctttctc aatgctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag 6240 ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat 6300 cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac 6360 aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac 6420 tacggctaca ctagaaggac agtatttggt atctgcgctc tgctgaagcc agttaccttc 6480 ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt 6540 tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc 6600 ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg 6660 agattatcaa aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca 6720 atctaaagta tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca 6780 cctatctcag cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag 6840 ataactacga tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagac 6900 ccacgctcac cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc 6960 agaagtggtc ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct 7020 agagtaagta gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc 7080 gtggtgtcac gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg 7140 cgagttacat gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc 7200 gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat 7260 tctcttactg tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag 7320 tcattctgag aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat 7380 aataccgcgc cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg 7440 cgaaaaactct caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca 7500 cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga 7560 aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc 7620 ttcctttttc aatattattg aagcatttat cagggttatt gtctcatgag cggatacata 7680 tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaacgt 7740 cttcaagctg cctcgcgcgt ttcggtgatg acggtgaaaa cctctgacac atgcagctcc 7800 cggagacggt cacagcttgt ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg 7860 cgtcagcggg tgttggcggg tgtcggggcg cagccatgac ccagtcacgt agcgatagcg 7920 gagttggctt aactatgcgg catcagagca gattgtactg agagtgcacc atatcgacgc 7980 tctcccttat gcgactcctg cattaggaag cagcccagta gtaggttgag gccgttgagc 8040 accgccgccg caaggaatgg tgctggctta tcgaaattaa tcgactcact atagggagac 8100 cc 8102 <210> 22 <211> 8102 <212> DNA <213> Artificial Sequence <220> <223> plasmids Spike G614 DeltaCter <400> 22 gaattcgagc tcgccccgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 60 acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 120 ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 180 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 240 ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 300 tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc 360 ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt 420 ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa 480 tgggcggtag gcgtgtacgg tgggaggtct atataagcag agctcgttta gtgaaccgtc 540 agatcgcctg gagacgccat ccacgctgtt ttgacctcca tagaagacac cgggaccgat 600 ccagcctccg ggggatcgat cccccgatcc tgagaacttc agggtgagtt tggggaccct 660 tgattgttct ttctttttcg ctattgtaaa attcatgtta tatggagggg gcaaagtttt 720 cagggtgttg tttagaatgg gaagatgtcc cttgtatcac catggaccct catgataatt 780 ttgtttcttt cactttctac tctgttgaca accattgtct cctcttattt tcttttcatt 840 ttctgtaact ttttcgttaa actttagctt gcatttgtaa cgaattttta aattcacttt 900 tgttattg tcagattgta agtactttct ctaatcactt ttttttcaag gcaatcaggg 960 tatattatat tgtacttcag cacagtttta gagaacaatt gttataatta aatgataagg 1020 tagaatattt ctgcatataa attctggctg gcgtggaaat attcttattg gtagaaacaa 1080 ctacatcctg gtcatcatcc tgcctttctc tttatggtta caatgatata cactgtttga 1140 gatgaggata aaatactctg agtccaaacc gggcccctct gctaaccatg ttcatgcctt 1200 cttctttttc ctacagctcc tgggcaacgt gctggttat gtgctgtctc atcattttgg 1260 caaagaattg taatacgact cactataggg cgaattcgga tccgccacca tgttcgtgtt 1320 tctggtgctg ctgcctctgg tgtccagcca gtgtgtgaac ctgaccacaa gaacccagct 1380 gcctccagcc tacaccaaca gctttaccag aggcgtgtac taccccgaca aggtgttcag 1440 atccagcgtg ctgcactcta cccaggacct gttcctgcct ttcttcagca acgtgacctg 1500 gttccacgcc atccacgtgt ccggcaccaa tggcaccaag agattcgaca accccgtgct 1560 gcccttcaac gacggggtgt actttgccag caccgagaag tccaacatca tcagaggctg 1620 gatcttggc accacactgg acagcaagac ccagagcctg ctgatcgtga acaacgccac 1680 caacgtggtc atcaaagtgt gcgagttcca gttctgcaac gaccccttcc tgggcgtcta 1740 ctatcacaag aacaacaaga gctggatgga aagcgagttc cgggtgtaca gcagcgccaa 1800 caactgcacc ttcgagtacg tgtcccagcc tttcctgatg gacctggaag gcaagcaggg 1860 caacttcaag aacctgcgcg agttcgtgtt caagaacatc gacggctact tcaagatcta 1920 cagcaagcac acccctatca acctcgtgcg ggatctgcct cagggcttct ctgctctgga 1980 acccctggtg gatctgccca tcggcatcaa catcacccgg tttcagacac tgctggccct 2040 gcacagaagc tacctgacac ctggcgatag cagcagcgga tggacagctg gtgccgccgc 2100 ttactatgtg ggctacctgc agcctagaac cttcctgctg aagtacaacg agaacggcac 2160 catcaccgac gccgtggatt gtgcccttga tcctctgagc gagacaaagt gcaccctgaa 2220 gtccttcacc gtggaaaagg gcatctacca gaccagcaac ttccgggtgc agcccaccga 2280 atccatcgtg cggttcccca atatcaccaa tctgtgcccc ttcggcgagg tgttcaatgc 2340 caccagattc gcctctgtgt acgcctggaa ccggaagcgg atcagcaatt gcgtggccga 2400 ctactccgtg ctgtacaact ccgccagctt cagcaccttc aagtgctacg gcgtgtcccc 2460 taccaagctg aacgacctgt gcttcacaaa cgtgtacgcc gacagcttcg tgatccgggg 2520 agatgaagtg cggcagattg cccctggaca gacaggcaag atcgccgact acaactacaa 2580 gctgcccgac gacttcaccg gctgtgtgat tgcctggaac agcaacaacc tggactccaa 2640 agtcggcggc aactacaatt acctgtaccg gctgttccgg aagtccaatc tgaagccctt 2700 cgagcgggac atctccaccg agatctatca ggccggcagc accccttgta acggcgtgga 2760 aggcttcaac tgctacttcc cactgcagtc ctacggcttt cagcccacaa atggcgtggg 2820 ctatcagccc tacagagtgg tggtgctgag cttcgaactg ctgcatgccc ctgccacagt 2880 gtgcggccct aagaaaagca ccaatctcgt gaagaacaaa tgcgtgaact tcaacttcaa 2940 cggcctgacc ggcaccggcg tgctgacaga gagcaacaag aagttcctgc cattccagca 3000 3060 cctggacatc accccttgca gcttcggcgg agtgtctgtg atcacccctg gcaccaacac 3120 cagcaatcag gtggcagtgc tgtaccaggg cgtgaactgt accgaagtgc ccgtggccat 3180 tcacgccgat cagctgacac ctacatggcg ggtgtactcc accggcagca atgtgtttca 3240 gaccagagcc ggctgtctga tcggagccga gcacgtgaac aatagctacg agtgcgacat 3300 ccccatcggc gctggcatct gtgccagcta ccagacacag acaacagcc ccagacgggc 3360 cagatctgtg gccagccaga gcatcattgc ctacacaatg tctctgggcg ccgagaacag 3420 cgtggcctac tccaacaact ctatcgctat ccccaccaac ttcaccatca gcgtgaccac 3480 agagatcctg cctgtgtcca tgaccaagac cagcgtggac tgcaccatgt acatctgcgg 3540 cgattccacc gagtgctcca acctgctgct gcagtacggc agcttctgca cccagctgaa 3600 tagagccctg acagggatcg ccgtggaaca ggacaagaac acccaagagg tgttcgccca 3660 agtgaagcag atctacaaga cccctcctat caaggacttc ggcggcttca atttcagcca 3720 gattctgccc gatcctagca agcccagcaa gcggagcttc atcgaggacc tgctgttcaa 3780 caaagtgaca ctggccgacg ccggcttcat caagcagtat ggcgattgtc tgggcgacat 3840 tgccgccagg gatctgattt gcgcccagaa gtttaacgga ctgacagtgc tgccaccact 3900 gctgaccgat gagatgatcg cccagtacac atctgccctg ctggccggca caatcacaag 3960 cgggctggaca tttggagctg gcgccgctct gcagatcccc tttgctatgc agatggccta 4020 ccggttcaac ggcatcggag tgacccagaa tgtgctgtac gagaccaga agctgatcgc 4080 caaccagttc aacagcgcca tcggcaagat ccaggacagc ctgagcagca cagcaagcgc 4140 cctgggaaag ctgcaggacg tggtcaacca gaatgcccag gcactgaaca ccctggtcaa 4200 gcagctgtcc tccaacttcg gcgccatcag ctctgtgctg aacgatatcc tgagcagact 4260 ggacaaggtg gaagccgagg tgcagatcga cagactgatc accggaaggc tgcagtccct 4320 gcagacctac gttacccagc agctgatcag agccgccgag attagagcct ctgccaatct 4380 ggccgccacc aagatgtctg agtgtgtgct gggccagagc aagagagtgg acttttgcgg 4440 caagggctac cacctgatga gcttccctca gtctgcccct cacggcgtgg tgtttctgca 4500 cgtgacatac gtgcccgctc aagagaagaa tttcaccacc gctccagcca tctgccacga 4560 cggcaaagcc cactttccta gagaaggcgt gttcgtgtcc aacggcaccc attggttcgt 4620 gacccagcgg aacttctacg agccccagat catcaccacc gacaacacct tcgtgtctgg 4680 caactgcgac gtcgtgatcg gcattgtgaa caataccgtg tacgaccctc tgcagcccga 4740 gctggacagc ttcaaagagg aactggataa gtactttaag aaccacacaa gccccgacgt 4800 ggacctgggc gatatcagcg gaatcaatgc cagcgtcgtg aacatccaga aagagatcga 4860 ccggctgaac gaggtggcca agaatctgaa cgagagcctg atcgacctgc aagaactggg 4920 gaagtacgag cagtacatca agtggccctg gtacatctgg ctgggcttta tcgccggact 4980 gattgccatc gtgatggtca caatcatgct gtgttgcatg accagctgct gtagctgcct 5040 gaagggctgt tgtagctgtg gcagctgctg ctaatctaga gtcgactgtt taaacctgca 5100 ggcatgcaag ctgatctttt tccctctgcc aaaaattatg gggacatcat gaagcccctt 5160 gagcatctga cttctggcta ataaaggaaa tttattttca ttgcaatagt gtgttggaat 5220 ttttgtgtc tctcactcgg aaggacatat gggagggcaa atcatttaaa acatcagaat 5280 gagtatttgg tttagagttt ggcaacatat gccatatgct ggctgccatg aacaaaggtg 5340 gctataaaga ggtcatcagt atatgaaaca gccccctgct gtccattcct tattccatag 5400 aaaagccttg acttgaggtt agattttttt tatattttgt tttgtgttat ttttttcttt 5460 aacatcccta aaatttcct tacatgtttt actagccaga ttttcctcc tctcctgact 5520 actcccagtc atagctgtcc ctcttctctt atgaactcga ggagcttttt gcaaaagcct 5580 aggcctccaa aaaagcctcc tcactacttc tggaatagct cagaggccga ggcggcctcg 5640 gcctctgcat aaataaaaaa aattagtcag ccatggggcg gagaatgggc ggaactgggc 5700 ggagttaggg gcgggatggg cggagttagg ggcgggacta tggttgctga ctaattgaga 5760 ctgcattaat gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc 5820 gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct 5880 cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg 5940 tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc 6000 cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga 6060 aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct 6120 cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg 6180 gcgctttctc aatgctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag 6240 ctgggctgtg tgcacgacc cccgttcag cccgaccgct gcgccttatc cggtaactat 6300 cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac 6360 aggattagca gagcgaggta tgtaggcggt gctacagagt tctgaagtg gtggcctaac 6420 tacggctaca ctagaaggac agtatttggt atctgcgctc tgctgaagcc agttaccttc 6480 ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt 6540 tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaga tcctttgatc 6600 tttctacgg gtctgacgc tcagtggaac gaaaaccc gttaaggat ttggtcatg 6660 agatttaca aaaggatctt cacctagatc cttttaattt aaaaatgaag ttttaatca 6720 atctaagta tatgagta aacttggtct vakagttacc atgcttaat cagtgaggca 6780 cctatctcag cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag 6840 ataactacga tacgggagg cttaccatct ggccccagtg ctgcaatgat accgcgagac 6900 ccacgctcac cggctccaga tttatcagca ataaccagc cagccggaag ggccgagcgc 6960 agaagtggtc ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct 7020 7080 gtggtgtcac gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg 7140 cgagttacat gatcccccat gttgtgcaaa aaagcggtta gctccttgg tcctccgatc 7200 gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat 7260 tctcttactg tcatgccatc cgtaagatgc tttctgtga ctggtgagta ctcaaccaag 7320 tcattctgag aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat 7380 aataccgcgc cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg 7440 cgaaaaactct caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca 7500 cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga 7560 aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc 7620 ttcctttttc aatattattg aagcatttat cagggttatt gtctcatgag cggatacata 7680 tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaacgt 7740 cttcaagctg cctcgcgcgt ttcggtgatg acggtgaaaa cctctgacac atgcagctcc 7800 cggagacggt cacagcttgt ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg 7860 cgtcagcggg tgttggcggg tgtcggggcg cagccatgac ccagtcacgt agcgatagcg 7920 gagttggctt aactatgcgg catcagagca gattgtactg agagtgcacc atatcgacgc 7980 tctcccttat gcgactcctg cattaggaag cagcccagta gtaggttgag gccgttgagc 8040 accgccgccg caaggaatgg tgctggctta tcgaaattaa tcgactcact atagggagac 8100 cc 8102 <210> 23 <211> 4337 <212> DNA <213> Artificial Sequence <220> <223> plasmids encoding empty vector <400> 23 gaattcgagc tcgccccgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 60 acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 120 ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 180 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 240 ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 300 tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc 360 ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg agttgtttt 420 ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa 480 tgggcggtag gcgtgtacgg tgggaggtct atataagcag agctcgttta gtgaaccgtc 540 agatcgcctg gagacgccat ccacgctgtt ttgacctcca tagagacac cgggaccgat 600 ccagcctccg ggggatcgat cccccgatcc tgagaacttc agggtgagtt tggggaccct 660 tgattgttct ttctttttcg ctattgtaaa attcatgtta tatggagggg gcaaagtttt 720 cagggtgttg tttagaatgg gaagatgtcc cttgtatcac catggaccct catgataatt 780 ttgtttcttt cactttctac tctgttgaca accattgtct cctcttattt tcttttcatt 840 ttctgtaact ttttcgttaa actttagctt gcatttgtaa cgaattttta aattcacttt 900 tgttattg tcagattgta agtactttct ctaatcactt ttttttcaag gcaatcaggg 960 tatattatat tgtacttcag cacagtttta gagaacaatt gttataatta aatgataagg 1020 tagaatattt ctgcatataa attctggctg gcgtggaaat attcttattg gtagaaacaa 1080 ctacatcctg gtcatcatcc tgcctttctc tttatggtta caatgatata cactgtttga 1140 gatgaggata aaatactctg agtccaaacc gggcccctct gctaaccatg ttcatgcctt 1200 cttctttttc ctacagctcc tgggcaacgt gctggttatt gtgctgtctc atcatttttgg 1260 caaagaattg tatacgact cactataggg cgaattcgga tccgccacct ctagagtcga 1320 ctgtttaaac ctgcaggcat gcaagctgat cttttccct ctgccaaaaa ttatggggac 1380 atcatgaagc cccttgagca tctgacttct ggctaataaa ggaaattat tttcattgca 1440 atagtgtgtt ggaattttt gtgtctctca ctcggaagga catatgggag ggcaaatcat 1500 ttaaaacatc agaatgagta tttggtttag agtttggcaa catatgccat atgctggctg 1560 ccatgaacaa aggtggctat aaagaggtca tcagtatatg aaacagcccc ctgctgtcca 1620 ttccttattc catagaaaag ccttgacttg aggttagatt ttttttatat tttgttttgt 1680 gttatttttt tctttaacat ccctaaaatt ttccttacat gttttactag ccagattttt 1740 cctcctctcc tgactactcc cagtcatagc tgtccctctt ctcttatgaa ctcgaggagc 1800 tttttgcaaa agcctaggcc tccaaaaaag cctcctcact acttctggaa tagctcagag 1860 gccgaggcgg cctcggcctc tgcataaata aaaaaaatta gtcagccatg gggcggagaa 1920 tgggcggaac tgggcggagt taggggcggg atgggcggag ttaggggcgg gactatggtt 1980 gctgactaat tgagactgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt 2040 attgggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg 2100 cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac 2160 gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg 2220 ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca 2280 agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc 2340 tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc 2400 ccttcgggaa gcgtggcgct ttctcaatgc tcacgctgta ggtatctcag ttcggtgtag 2460 gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc 2520 ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca 2580 gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg 2640 aagtggtggc ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg 2700 aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct 2760 ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa 2820 gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa 2880 gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa 2940 tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc 3000 ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga 3060 ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca 3120 atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc 3180 ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat 3240 tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc 3300 attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt 3360 tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc 3420 ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg 3480 gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt 3540 gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg 3600 gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga 3660 aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg 3720 taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg 3780 tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt 3840 tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc 3900 atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca 3960 tttccccgaa aacgtcttca agctgcctcg cgcgtttcgg tgatgacggt gaaaacctct 4020 gacacatgca gctcccggag acggtcacag cttgtctgta agcggatgcc gggagcagac 4080 aagccccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggcgcagcc atgacccagt 4140 cacgtagcga tagcggagtt ggcttaacta tgcggcatca gagcagattg tactgagagt 4200 gcaccatatc gacgctctcc cttatgcgac tcctgcatta ggaagcagcc cagtagtagg 4260 ttgaggccgt tgagcaccgc cgccgcaagg aatggtgctg gcttatcgaa attaatcgac 4320 tcactatagg gagaccc 4337 <210> 24 <211> 9893 <212> DNA <213> Artificial Sequence <220> <223> Vector for ACE2 transduction <400> 24 acgcgtgtag tcttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca 60 acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta 120 cgatcgtgcc ttattaggaa ggcaacagac gggtctgaca tggattggac gaaccactga 180 attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc 240 tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta 300 agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact 360 ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg 420 cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct 480 tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaaatttt 540 gactagcgga ggctagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 600 aattagatcg cgatgggaaa aaattcggtt aaggccaggg ggaaagaaaa aatataaatt 660 aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 720 agaaacatca gaaggctgta gaaaatact gggacagcta caccaccc ttcagacagg 780 atcagagaa cttagatcat tatatatac agtagcaacc ctctattgtg tgcatcaaag 840 gagagata aagahaacca aggaagcttt agagagata gaggagagc aaaaaaaaag 900 taagaccacc gcacagcaag cggccactga tcttcagacc tggagga gatatgaggg 960 acaattgag aagtgatta tataatata aagtagtaa attgaacca tggagtag 1020 cacccaccaa ggcaaagaga agagtggtgc aggagaaaa agagcagtg ggaataggag 1080 ctttgttcct tgggttctg ggagcagcag gaagcactat gggcgcagcg tcaatgacgc 1140 tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttgctga 1200 gggctattga ggcgcacag catctgttgc aactcacagt ctggggcatc aagcagctcc 1260 aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 1320 gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gatgctagt tggagtaata 1380 aatctctgga acagatttgg aatcacacga cctggatgga gtgggacaga gaaattaaca 1440 attacacaag cttaatacac tccttaattg aagaatcgca aaaccagcaa gaaaagaatg 1500 aacaagaatt attggaatta gataaatggg caagtttgtg gaattggttt aacataacaa 1560 attggctgtg gtatataaa ttatcataa tgatagtagg aggcttggta ggtttaagaa 1620 tagtttttgc tgtactttct atagtgaata gagttaggca gggatattca ccattatcgt 1680 ttcagaccca cctcccaacc ccgaggggac ccgacaggcc cgaaggaata gaagaagaag 1740 gtggagagag agacagagac agatccattc gattagtgaa cggatctcga cggtatcggt 1800 taacttttaa aagaaaaggg gggattgggg ggtacagtgc aggggaaaga atagtagaca 1860 taatagcaac agacatacaa actaaagaat tacaaaaaca aattacaaaa ttcaaaattt 1920 tatcgattac tagtattatg cccagtacat gaccttatgg gactttccta cttggcagta 1980 catctacgta ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt acatcaatgg 2040 gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg acgtcaatgg 2100 gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca actccgcccc 2160 attgacgcaa atgggcggta ggcgtgtacg gtgggaggtt tatataagca gagctcgttt 2220 agtgaaccgt cagatcgcct ggagacgcca tccacgctgt ttgacctcc atagaagatt 2280 ctagagctag cgttaaact taagcttggt accgagctcg gatccactag tccagtgtgg 2340 tggaattctg cagatatcca gcacagtggc ggccgctcga gattcaagc tcttcctggc 2400 tccttctcag ccttgttgct gtactgctg ctcagtccac cattgaggaa caggccaaga 2460 cattttgga caagtttaac cacgaagccg aagacctgtt ctatchagt tcacttgctt 2520 cttggaatta taacaccaat attactgaag agaatgtcca aaacatgaat atgctgggg 2580 acaaatggtc tgcctttta aaggaacagt ccacacttgc ccaaatgtat ccactacaag 2640 aaattcagaa tctcacagtc aagctcagc tgcagcct tcagcaaat gggtcttcag 2700 tgctctcaga agacagagc aaacggttga acacaatct aaatacaatg agcaccatct 2760 acagtactgg aaagtttgt acccagata atccacaaga atgcttatta cttgaaccag 2820 gtttgaatga ataatggca aacagtttag actacaatga gaggctctgg gcttgggaaa 2880 gctggagatc tgaggtcggc aagcagctga ggccattata tgaagagtat gtggtcttga 2940 aaaatgagat ggcagagca atcattatg aggactatgg ggattattgg agaggact 3000 atgaagtaaa tggggtagat ggctatgact acagccgcgg ccagttgatt gaagattgtgg 3060 aacatacctt tgagagatt aaaccattat atgaacatct tcatgcctat gtgaggca 3120 agttgatgaa tgcctatcct tcctatatca gtccaattgg atgcctccct gctcatttgc 3180 ttggtgatat gtggggtaga tttggacaa atctgtactc tttgacagtt ccctttggac 3240 agaaaccaaa catagatgtt actgatgcaa tggtggacca ggcctgggat gcacagagaa 3300 tattcagga ggccgagaag ttcttgtat ctgttggtct tcctaatatg actcaggat 3360 tctgggaaaa ttccatgcta acggacccag gaatgttca gaaagcagtc tgccatccca 3420 cagcttggga cctggggaag ggcgacttca ggatccttat gtgcacaag gtgacaatgg 3480 acgacttcct gandagctcat catgagatgg ggcatatcca gtatgatatg gcatatgctg 3540 caaaccttt tctgctaaga aatggagcta atgaaggatt ccatgaagct gttgggggaaa 3600 tcatgtcact ttctgcagcc acacctaagc atttaaaatc cattggtctt ctgtcacccg 3660 attttcaaga agacaatgaa acagaaataa acttcctgct caaacaagca ctcacgattg 3720 ttgggactct gccatttact tacatgttag agaagtggag gtggatggtc tttaaagggg 3780 aaattcccaa agaccagtgg atgaaaaagt ggtgggagat gaagcgagag atagttgggg 3840 tggtggaacc tgtgccccat gatgaaacat actgtgaccc cgcatctctg ttccatgttt 3900 ctaatgatta ctcattcatt cgatattaca caaggaccct ttaccaattc cagtttcaag 3960 aagcactttg tcaagcagct aaacatgaag gccctctgca caaatgtgac atctcaaact 4020 4080 ccctagcatt ggaaaatgtt gtaggagcaa agaacatgaa tgtaaggcca ctgctcaact 4140 actttgagcc cttattacc tggctgaaag accagaacaa gaattctttt gtgggatgga 4200 4260 ctcttggaga taaagcatat gaatggaacg acaatgaaat gtacctgttc cgatcatctg 4320 ttgcatatgc tatgaggcag tactttttaa aagtaaaaa tcagatgatt ctttttgggg 4380 aggaggatgt gcgagtggct aatttgaaac caagaatctc ctttaatttc tttgtcactg 4440 cacctaaaaa tgtgtctgat atcattccta gaactgaagt tgaaaaggcc atcaggatgt 4500 cccggagccg tatcaatgat gctttccgtc tgaatgacaa cagcctagag tttctgggga 4560 tacagccaac acttggacct cctaaccagc cccctgtttc catatggctg attgtttttg 4620 gagttgtgat gggagtgata gtggttggca ttgtcatcct gatcttcact gggatcagag 4680 atcggaagaa gaaaaataaa gcaagaagtg gagaaaatcc ttatgcctcc atcgatatta 4740 gcaaggaga aaataatcca ggattccaaa acactgatga tgttcagacc tccttttagc 4800 ccaaatcgga tccgcggccg caaggatctg cgatcgctcc ggtgcccgtc agtgggcaga 4860 gcgcacatcg cccacagtcc ccgagaagtt ggggggaggg gtcggcaatt gaacgggtgc 4920 ctagagaagg tggcgcgggg taaactggga aagtgatgtc gtgtactggc tccgccttt 4980 tcccgagggt gggggagaac cgtatataag tgcagtagtc gccgtgaacg ttctttttcg 5040 caacgggttt gccgccagaa cacagctgaa gcttcgaggg gctcgcatct ctccttcacg 5100 cgcccgccgc cctacctgag gccgccatcc acgccggttg agtcgcgttc tgccgcctcc 5160 cgcctgtggt gcctcctgaa ctgcgtccgc cgtctaggta agtttaaagc tcaggtcgag 5220 accgggcctt tgtccggcgc tcccttggag cctacctaga ctcagccggc tctccacgct 5280 ttgcctgacc ctgcttgctc aactctacgt ctttgtttcg ttttctgttc tgcgccgtta 5340 cagatccaag ctgtgaccgg cgcctacgat atgaccgagt acaagcccac ggtgcgcctc 5400 gccacccgcg acgacgtccc cagggccgta cgcaccctcg ccgccgcgtt cgccgactac 5460 cccgccacgc gccacaccgt cgatccggac cgccacatcg agcgggtcac cgagctgcaa 5520 gaactcttcc tcacgcgcgt cgggctcgac atcggcaagg tgtgggtcgc ggacgacggc 5580 gccgcggtgg cggtctggac cacgccggag agcgtcgaag cgggggcggt gttcgccgag 5640 atcggcccgc gcatggccga gttgagcggt tcccggctgg ccgcgcagca acagatggaa 5700 ggcctcctgg cgccgcaccg gcccaaggag cccgcgtggt tcctggccac cgtcggcgtc 5760 tcgcccgacc accagggcaa gggtctgggc agcgccgtcg tgctccccgg agtggaggcg 5820 gccgagcgcg ccggggtgcc cgccttcctg gagacctccg cgccccgcaa cctccccttc 5880 tacgagcggc tcggcttcac cgtcaccgcc gacgtcgagg tgcccgaagg accgcgcacc 5940 tggtgcatga cccgcaagcc cggtgcctga caatcaacct ctggattaca aaatttgtga 6000 aagattgact ggtattctta actatgttgc tccttttacg ctatgtggat acgctgcttt 6060 aatgcctttg tatcatgcta ttgcttcccg tatggctttc attttctcct ccttgtataa 6120 atcctggttg ctgtctcttt atgaggagtt gtggcccgtt gtcaggcaac gtggcgtggt 6180 gtgcactgtg tttgctgacg caacccccac tggttggggc attgccacca cctgtcagct 6240 cctttccggg actttcgctt tccccctccc tattgccacg gcggaactca tcgccgcctg 6300 ccttgcccgc tgctggacag gggctcggct gttgggcact gacaattccg tggtgttgtc 6360 ggggaaatca tcgtcctttc cttggctgct cgcctgtgtt gccacctgga ttctgcgcgg 6420 gacgtccttc tgctacgtcc cttcggccct caatccagcg gaccttcctt cccgcggcct 6480 gctgccggct ctgcggcctc ttccgcgtct tcgccttcgc cctcagacga gtcggatctc 6540 cctttgggcc gcctccccgc ctggtacctt taagaccaat gacttacaag gcagctgtag 6600 atcttagcca ctttttaaaa gaaaaggggg gactggaagg gctaattcac tcccaacgaa 6660 gataagatct gctttttgct tgtactgggt ctctctggtt agaccagatc tgagcctggg 6720 agctctctgg ctaactaggg aacccactgc ttaagcctca ataaagcttg ccttgagtgc 6780 ttcaagtagt gtgtgcccgt ctgttgtgtg actctggtaa ctagagatcc ctcagaccct 6840 tttagtcagt gtggaaaatc tctagcagta gtagttcatg tcatcttatt attcagtatt 6900 tataacttgc aaagaaatga atatcagaga gtgagaggaa cttgtttatt gcagcttata 6960 atggttacaa ataaagcaat agcatcacaa atttcacaaa taaagcattt ttttcactgc 7020 attctagttg tggtttgtcc aaactcatca atgtatctta tcatgtctgg ctctagctat 7080 cccgccccta actccgccca tcccgcccct aactccgccc agttccgccc attctccgcc 7140 ccatggctga ctaatttttt ttatttatgc agaggccgag gccgctcgg cctctgagct 7200 attccagaag tagtgaggag gcttttttgg aggcctagac ttttgcagag accaaattcg 7260 taatcatgtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca 7320 tacgagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagc taactcacat 7380 taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt 7440 aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct 7500 cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa 7560 aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa 7620 aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc 7680 tccgcccccc tgacgagcat cacaaaaaatc gacgctcaag tcagaggtgg cgaaacccga 7740 caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc 7800 cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt 7860 ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgtcgctcc aagctgggct 7920 gtgtgcacga accccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg 7980 agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta 8040 gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct 8100 acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa 8160 gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt 8220 gcaagcagca gattacgc agaaaaaaag gatctcaaga agatcctttg atcttttcta 8280 cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat 8340 caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa 8400 gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct 8460 cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta 8520 cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct 8580 caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt 8760 cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta 8820. catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca 8880 gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca tcattggaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat 9360 gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg 9420 acgtctaaga aaccattatt atcatgacat taacctataa aaataggcgt atcacgaggc 9480 cctttcgtct cgcgcgtttc ggtgatgacg gtgaaaacct ctgacacatg cagctcccgg 9540 agacggtcac agcttgtctg taagcggatg ccgggagcag acaagcccgt cagggcgcgt 9600 cagcgggtgt tggcgggtgt cggggctggc ttaactatgc ggcatcagag cagattgtac 9660 tgagagtgca ccatatgcgg tgtgaaatac cgcacagatg cgtaaggaga aaataccgca 9720 tcaggcgcca ttcgccattc aggctgcgca actgttggga agggcgatcg gtgcgggcct 9780 cttcgctatt acgccagctg gcgaaagggg gatgtgctgc aaggcgatta agttgggtaa 9840 cgccagggtt ttcccagtca cgacgttgta aaacgacggc cagtgccaag ctg 9893 <210> 25 <211> 8668 <212> DNA <213> Artificial Sequence <220> <223> Vector for TMPRSS2 transduction <400> 25 acgcgtgtag tcttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca 60 acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta 120 cgatcgtgcc ttattaggaa ggcaacagac gggtctgaca tggattggac gaaccactga 180 attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc 240 tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta 300 agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact 360 ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg 420 cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct 480 tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaaatttt 540 gactagcgga ggctagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 600 aattagatcg cgatgggaaa aaattcggtt aaggccaggg ggaaagaaaa aatataaatt 660 aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 720 agaaacatca gaaggctgta gaaaatact gggacagcta caccaccc ttcagacagg 780 atcagagaa cttagatcat tatatatac agtagcaacc ctctattgtg tgcatcaaag 840 gagagata aagahaacca aggaagcttt agagagata gaggagagc aaaaaaaaag 900 taagaccacc gcacagcaag cggccactga tcttcagacc tggagga gatatgaggg 960 acaattgag aagtgatta tataatata aagtagtaa attgaacca tggagtag 1020 cacccaccaa ggcaaagaga agagtggtgc aggagaaaa agagcagtg ggaataggag 1080 ctttgttcct tgggttctg ggagcagcag gaagcactat gggcgcagcg tcaatgacgc 1140 tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttgctga 1200 gggctattga ggcgcacag catctgttgc aactcacagt ctggggcatc aagcagctcc 1260 aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 1320 gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gatgctagt tggagtaata 1380 aatctctgga acagatttgg aatcacacga cctggatgga gtgggacaga gaaattaaca 1440 attacacaag cttaatacac tccttaattg aagaatcgca aaaccagcaa gaaaagaatg 1500 aacaagaatt attggaatta gataaatggg caagtttgtg gaattggttt aacataacaa 1560 attggctgtg gtatataaa ttatcataa tgatagtagg aggcttggta ggtttaagaa 1620 tagtttttgc tgtactttct atagtgaata gagttaggca gggatattca ccattatcgt 1680 ttcagaccca cctcccaacc ccgaggggac ccgacaggcc cgaaggaata gaagaagaag 1740 gtggagagag agacagagac agatccattc gattagtgaa cggatctcga cggtatcggt 1800 taacttttaa aagaaaaggg gggattgggg ggtacagtgc aggggaaaga atagtagaca 1860 taatagcaac agacatacaa actaaagaat tacaaaaaca aattacaaaa ttcaaaattt 1920 tatcgattac tagtattatg cccagtacat gaccttatgg gactttccta cttggcagta 1980 catctacgta ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt acatcaatgg 2040 gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg acgtcaatgg 2100 gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca actccgcccc 2160 attgacgcaa atgggcggta ggcgtgtacg gtgggaggtt tatataagca gagctcgttt 2220 agtgaaccgt cagatcgcct ggagacgcca tccacgctgt ttgacctcc atagaagatt 2280 ctagagctag cgtttaaact taaggccacc atggctttga accaggctc accaccagct 2340 attggacctt actatgaaaa ccatggactc caaccggaaa acccctatcc cgcacagccc 2400 actgtgtcc cccactgtcta cgaggtgcat ccggctcagt actacccgtc cccgtgccc 2460 cagtacgccc cgagggtcct gacgcaggct tccaccccg tcgtctccc gcagcccaaa 2520 tcccatccg ggacagtgtg cacccaag actaagaag cactgtgcat caccttgacc 2580 ctggggacct tcctcgtggg agctgcgctg gccgctggcc tactctggaa gttcatgggc 2640 agcaagtgct caactctgg gatagagtgc gactcctcag gtacctgcat caaccctct 2700 aactggtgtg atggcgtgtc acactgcccc ggcggggagg acgagaatcg gtgtgttcgc 2760 cttacggac siaacttcat ccttcaggtg tactcatc agaggagtc ctggcacct 2820 gtgtgccaag acgactggaa cgagaactac gggcgggcgg cctgcaggga catgggctat 2880 aagaataatt tttactctag ccaaggaata gtggatgaca gcggatccac cagctttatg 2940 aaactgaaca caagtgccgg caatgtcgat atctataaaa aactgtacca cagtgatgcc 3000 tgttcttcaa aagcagtggt ttctttacgc tgtatagcct gcggggtcaa cttgaactca 3060 agccgccaga gcaggattgt gggcggcgag agcgcgctcc cgggggcctg gccctggcag 3120 gtcagcctgc acgtccagaa cgtccacgtg tgcggaggct ccatcatcac ccccgagtgg 3180 atcgtgacag ccgcccactg cgtggaaaaa cctcttaaca atccatggca ttggacggca 3240 tttgcgggga ttttgagaca atctttcatg ttctatggag ccggatacca agtagaaaaa 3300 gtgatttctc atccaaatta tgactccaag accaagaaca atgacattgc gctgatgaag 3360 ctgcagaagc ctctgacttt caacgaccta gtgaaaccag tgtgtctgcc caacccaggc 3420 atgatgctgc agccagaaca gctctgctgg atttccgggt ggggggccac cgaggagaaa 3480 gggaagacct cagaagtgct gaacgctgcc aaggtgcttc tcattgagac acagagatgc 3540 aacagcagat atgtctatga caacctgatc acaccagcca tgatctgtgc cggcttcctg 3600 caggggaacg tcgattcttg ccagggtgac agtggagggc ctctggtcac ttcgaagaac 3660 aatatctggt ggctgatagg ggatacaagc tggggttctg gctgtgccaa agcttacaga 3720 ccaggagtgt acgggaatgt gatggtattc acggactgga tttatcgaca aatgagggca 3780 gacggctaag cggccgcaag gatctgcgat cgctccggtg cccgtcagtg ggcagagcgc 3840 acatcgccca cagtccccga gaagttgggg ggaggggtcg gcaattgaac gggtgcctag 3900 agaaggtggc gcggggtaaa ctgggaaagt gatgtcgtgt actggctccg cctttttccc 3960 gagggtgggg gagaaccgta tataagtgca gtagtcgccg tgaacgttct ttttcgcaac 4020 gggtttgccg ccagaacaca gctgaagctt cgaggggctc gcatctctcc ttcacgcgcc 4080 cgccgcccta cctgaggccg ccatccacgc cggttgagtc gcgttctgcc gcctcccgcc 4140 tgtggtgcct cctgaactgc gtccgccgtc taggtaagtt taaagctcag gtcgagaccg 4200 ggcctttgtc cggcgctccc ttggagccta cctagactca gccggctctc cacgctttgc 4260 ctgaccctgc ttgctcaact ctacgtcttt gtttcgtttt ctgttctgcg ccgttacaga 4320 tccaagctgt gaccggcgcc tacgatatgg ccaagccttt gtctcaagaa gaatccaccc 4380 tcattgaaag agcaacggct acaatcaaca gcatccccat ctctgaagac tacagcgtcg 4440 ccagcgcagc tctctctagc gacggccgca tcttcactgg tgtcaatgta tatcatttta 4500 ctgggggacc ttgtgcagaa ctcgtggtgc tgggcactgc tgctgctgcg gcagctggca 4560 acctgacttg tatcgtcgcg atcggaaatg agaacagggg catcttgagc ccctgcggac 4620 ggtgccgaca ggtgcttctc gatctgcatc ctgggatcaa agccatagtg aaggacagtg 4680 atggacagcc gacggcagtt gggattcgtg aattgctgcc ctctggttat gtgtgggagg 4740 gctaacaatc aacctctgga ttacaaaatt tgtgaaagat tgactggtat tcttaactat 4800 gttgctcctt ttacgctatg tggatacgct gctttaatgc ctttgtatca tgctattgct 4860 tcccgtatgg ctttcatttt ctcctccttg tataaatcct ggttgctgtc tctttatgag 4920 gagttgtggc ccgttgtcag gcaacgtggc gtggtgtgca ctgtgtttgc tgacgcaacc 4980 cccactggtt ggggcattgc caccacctgt cagctccttt ccgggacttt cgctttcccc 5040 ctccctattg ccacggcgga actcatcgcc gcctgccttg cccgctgctg gacaggggct 5100 cggctgttgg gcactgacaa ttccgtggtg ttgtcgggga aatcatcgtc ctttccttgg 5160 ctgctcgcct gtgttgccac ctggattctg cgcgggacgt ccttctgcta cgtcccttcg 5220 gccctcaatc cagcggacct tccttcccgc ggcctgctgc cggctctgcg gcctcttccg 5280 cgtcttcgcc ttcgccctca gacgagtcgg atctcccttt gggccgcctc cccgcctggt 5340 acctttaaga ccaatgactt acaaggcagc tgtagatctt agccactttt taaaagaaaa 5400 ggggggactg gaagggctaa ttcactccca acgaagataa gatctgcttt ttgcttgtac 5460 tgggtctctc tggttagacc agatctgagc ctgggagctc tctggctaac tagggaaccc 5520 actgcttaag cctcaataaa gcttgccttg agtgcttcaa gtagtgtgtg cccgtctgtt 5580 gtgtgactct ggtaactaga gatccctcag acccttttag tcagtgtgga aaatctctag 5640 cagtagtagt tcatgtcatc ttattattca gtatttataa cttgcaaaga aatgaatatc 5700 agagagtgag aggaacttgt ttattgcagc ttataatggt tacaaataaa gcaatagcat cacaaatttc acaaataag catttttttc actgcattct agttgtggtt tgtccaaact 5880. catcaatgta tcttatcatg tctggctcta gctatcccgc ccctaactcc gcccatcccg cccctaactc cgcccagttc cgcccattct ccgccccatg gctgactaat tttttttatt 5940 tatgcagagg ccgaggccgc ctcggcctct gagctattcc agaagtagtg aggaggcttt 6000 tttggaggcc tagacttttg cagagaccaa attcgtaatc atgtcatagc tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatacga gccggaagca taagtgtaa agcctggggt gcctaatgag tgagctaact cacattaatt gcgttgcgct cactgcccgc 6180. tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac gcgcggggag aggcggtttg cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt 6300. cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcagga agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa 6480 aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt 6540 tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct 6600 gtccgcctt ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct 6660 cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc 6720 cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt 6780 atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc 6840 tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat 6900 ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa 6960 acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa 7020 aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga 7080 aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct 7140 tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga 7200 cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc 7260 catagttgcc tgactccccg tcgtgtagat aactacgata cgggaggct taccatctgg 7320 ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat 7380 aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat 7440 ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg 7500 caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc 7560 attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa 7620 agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc 7680 actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt 7740 ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag 7800 ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt 7860 gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag 7920 atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac 7980 cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc 8040 gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca 8100 gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aaaatagg 8160 ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc taagaaacca ttattatcat 8220 gacattaacc tataaaaata ggcgtatcac gaggcccttt cgtctcgcgc gttcggtga 8280 tgacggtgaa aacctctgac acatgcagct cccggagacg gtcacagctt gtctgtaagc 8340 ggatgccggg agcagacaag cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg 8400 ctggcttaac tatgcggcat cagagcagat tgtactgaga gtgcaccata tgcggtgtga 8460 aataccgcac agatgcgtaa ggaaaata ccgcatcagg cgccattcgc cattcaggct 8520 gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa 8580 agggggatgt gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg 8640 ttgtaaaacg acggccagtg ccaagctg 8668 <210> 26 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> ACE2 forward primer <400> 26 cattggagca agtgttggat ctt 23 <210> 27 <211> twenty two <212> DNA <213> Artificial Sequence <220> < <213> ACE2 reverse primer <400> 27 gagctaatgc atgccattct ca 22 <210> 28 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> TMPRSS2 forward primer <400> 28 cacggactgg atttatcgac aa 22 <210> 29 <211> twenty one <212> DNA <213> Artificial Sequence <220> < <213> TMPRSS2 reverse primer <400> 29 cgtcaaggac gaagaccatg t 21 <210> 30 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 30 gcacaagagg aagagagaga cc 22 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> < <213> GAPDH reverse primer <400> 31 aggggagatt cagtgtggtg 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Furin Forward <400> 32 ggaacatgac agctgcaact 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Furin Reverse <400> 33 tcgtcacgat ctgcttctca 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Catepsin L Forward <400> 34 tagaggcaca gtggaccaag 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Catepsin L Reverse <400> 35 atggccattg tgaagctgtg 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Catepsin B Forward <400> 36 tctctgaccg gatctgcatc 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Catepsin B Reverse <400> 37 tcacagggag ggatggagta 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PC1 Forward <400> 38 gcgtgcctga gaagaaagag 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PC1 Reverse <400> 39 atcccgttct ctttcagcca 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Trypsin forward <400> 40 aagtgtgaag cctcctaccc 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Trypsin Reverse <400> 41 ggtgtagact ccaggcttgt 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Matriptase Forward <400> 42 cccaacaacc agcatgtgaa 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Matriptase Reverse <400> 43 actggagtcg taggagaggt 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Matriptase Forward <400> 44 agaacgtcct gctcatcaca 20 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Matriptase Reverse <400> 45 tgtgcagtca atgttgggtg 20 <210> 46 <211> 6623 <212> DNA <213> Artificial Sequence <220> <223> HEK293 AAT Vector <400> 46 gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60 ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120 cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180 ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240 gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300 tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360 cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420 attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480 atcatatgcc aagtacgcccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540 atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600 tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660 actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720 aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780 gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840 ctgcttactg gcttatcgaa attaatacga ctcactatag ggagaccacaa gctggctagc 900 gtttaaactt aagcttgcca ccatgccgtc ttctgtctcg tggggcatcc tcctgctggc 960 aggcctgtgc tgcctggtcc ctgtctccct ggctgaggat ccccagggag atgctgccca 1020 gaacagat acatcccacc atgatcagga tcacccaacc ttcaacaaga tcacccccaa 1080 cctggctgag ttcgcttca gcctataccg ccagctggca caccagtcca acagcaccaa 1140 tatcttcttc tccccagtga gcatcgctac agcctttgca atgctctccc tggggaccaa 1200 ggctgacact cacgaatgaaa tcctggaggg cctgaatttc aacctcacgg agattccgga 1260 ggctcagatc catgaaggct tccaggaact cctccgtacc ctcaaccagc cagacagcca 1320 gctccagctg accaccggca atggcctgtt cctcagcgag ggcctgaagc tagtggataa 1380 gtttttggag gatgttaaaa agttgtacca ctcagaagcc ttcactgtca acttcgggga 1440 caccgaagag gccaagaaac agatcaacga ttacgtggag aagggtactc aagggaaaat 1500 tgtggatttg gtcaaggagc ttgacagaga cacagttttt gctctggtga attacatctt 1560 ctttaaaggc aaatgggaga gaccctttga agtcaaggac accgaggaag aggacttcca 1620 cgtggaccag gtgaccaccg tgaaggtgcc tatgatgaag cgtttaggca tgtttaacat 1680 ccagcactgt aagaagctgt ccagctgggt gctgctgatg aaatacctgg gcaatgccac 1740 cgccatcttc ttcctgcctg atgaggggaa actacagcac ctggaaaatg aactcaccca 1800 cgatatcatc accaagttcc tggaaaatga agacagaagg tctgccagct tacatttacc 1860 caaactgtcc attactggaa cctatgatct gaagagcgtc ctgggtcaac tgggcatcac 1920 taaggtcttc agcaatgggg ctgacctctc cggggtcaca gaggaggcac ccctgaagct 1980 ctccaaggcc gtgcataagg ctgtgctgac catcgacgag aaagggactg aagctgctgg 2040 ggccatgttt ttagaggcca tacccatgtc tatccccccc gaggtcaagt tcaacaaacc 2100 ctttgtcttc ttaatgattg aacaaaatac caagtctccc ctcttcatgg gaaaagtggt 2160 gaatcccacc caaaaataac tcgagtctag agggcccgtt taaacccgct gatcagcctc 2220 gactgtgcct tctagttgcc agccatctgt tgtttgcccc tcccccgtgc cttccttgac 2280 cctggaaggt gccactccca ctgtcctttc ctaataaaat gaggaaattg catcgcattg 2340 tctgagtagg tgtcattcta ttctgggggg tggggtgggg caggacagca agggggagga 2400 ttgggaagac aatagcaggc atgctgggga tgcggtgggc tctatggctt ctgaggcgga 2460 aagaaccagc tggggctcta gggggtatcc ccacgcgccc tgtagcggcg cattaagcgc 2520 ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt gccagcgccc tagcgcccgc 2580 tcctttcgct ttcttccctt cctttctcgc cacgttcgcc ggctttcccc gtcaagctct 2640 aaatcggggg ctccctttag ggttccgatt tagtgcttta cggcacctcg accccaaaaa 2700 acttgattag ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg tttttcgccc 2760 tttgacgttg gagtccacgt tctttaatag tggactcttg ttccaaactg gaacaacact 2820 caaccctatc tcggtctatt cttttgattt ataagggatt ttgccgattt cggcctattg 2880 gttaaaaaat gagctgattt aacaaaaatt taacgcgaat taattctgtg gaatgtgtgt cagttagggt gtggaaagtc cccaggctcc ccagcaggca gaagtatgca aagcatgcat ctcaattagt cagcaaccag gtgtggaag tccccaggct ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc atagtcccgc ccctaactcc gcccatcccg cccctaactc cgcccagttc cgcccattct ccgccccatg gctgactaat tttttttatt 3180 tatgcagagg ccgaggccgc ctctgcctct gagctattcc agaagtagtg aggaggcttt 3240 tttggaggcc tagcttttg caaaaagctc ccggggagctt gtatatccat tttcggatct 3300. gatcaagaga caggatgagg atcgtttcgc atgattgaac aagatggatt gcacgcaggt tctccggccg cttgggtgga gaggctattc ggctatgact gggcacaaca gacaatcggc tgctctgatg ccgccgtgtt ccggctgtca gcgcaggggc gcccggttct ttttgtcaag 3480 accgacctgt ccggtgccct gaatgaactg caggacgagg cagcgcggct atcgtggctg gccacgacgg gcgttccttg cgcagctgtg ctcgacgttg tcactgaagc gggaagggac 3600 tggctgctat tgggcgaagt gccggggcag gatctcctgt catctcacct tgctcctgcc 3660 gagaaagtat ccatcatggc tgatgcaatg cggcggctgc atacgcttga tccggctacc 3720 tgcccattcg accaccaagc gaaacatcgc atcgagcgag cacgtactcg gatggaagcc 3780 ggtcttgtcg atcaggatga tctggacgaa gagcatcagg ggctcgcgcc agccgaactg 3840 ttcgccaggc tcaaggcgcg catgcccgac ggcgaggatc tcgtcgtgac ccatggcgat 3900 gcctgcttgc cgaatatcat ggtggaaaat ggccgctttt ctggattcat cgactgtggc 3960 cggctgggtg tggcggaccg ctatcaggac atagcgttgg ctacccgtga tattgctgaa 4020 gagcttggcg gcgaatgggc tgaccgcttc ctcgtgcttt acggtatcgc cgctcccgat 4080 tcgcagcgca tcgccttcta tcgccttctt gacgagttct tctgagcggg actctggggt 4140 tcgaaatgac cgaccaagcg acgcccaacc tgccatcacg agatttcgat tccaccgccg 4200 ccttctatga aaggttgggc ttcggaatcg ttttccggga cgccggctgg atgatcctcc 4260 agcgcgggga tctcatgctg gagttcttcg cccaccccaa cttgtttatt gcagcttata 4320 atggttacaa ataaagcaat agcatcacaa atttcacaaa taaagcattt ttttcactgc 4380 attctagttg tggtttgtcc aaactcatca atgtatctta tcatgtctgt ataccgtcga 4440 cctctagcta gagcttggcg taatcatggt catagctgtt tcctgtgtga aattgttatc 4500 cgctca...

Claims

1. Use of the composition in the preparation of a medicament for treating and / or preventing SARS-CoV-2 infection in subjects in need, said composition comprising a therapeutically effective amount of α1-antitrypsin protein.

2. The use according to claim 1, wherein the subject in need has at least one selected from the group consisting of: i) Lower levels of endogenous α1-antitrypsin before or during viral infection compared to at least one asymptomatic or mildly symptomatic subject during viral infection. ii) Higher levels of at least one spike protein initiating protease before or during viral infection compared to at least one asymptomatic or mildly symptomatic subject during viral infection. iii) Angiotensin-converting enzyme 2 (ACE2) receptor levels were higher in subjects prior to or during viral infection compared to at least one subject who was asymptomatic or had mild symptoms during viral infection. iv) Interferon-γ (IFN-γ) levels in subjects who were previously infected or were infected with the virus compared to at least one subject who was asymptomatic or had mild symptoms during the viral infection.

3. The use according to claim 2, wherein the lower endogenous α1-antitrypsin level prior to or during viral infection is caused by α1-antitrypsin deficiency.

4. The use according to claim 2, wherein the spike protein initiating protease is selected from at least one of the following groups: transmembrane protease serine isoform 2 (TMPRSS2), transmembrane protease isoform 6 (TMPRSS6), cathepsin L, cathepsin B, proprotein convertase 1, trypsin, elastase, neutrophil elastase, proteolytic enzyme, and furin protease.

5. The use according to claim 2, wherein the higher level of at least one spike protein initiating protease is caused by age and / or genetic predisposition.

6. The use according to claim 2, wherein the elevated ACE2 receptor level is caused by at least one selected from the group consisting of infection, inflammation, age, and / or genetic predisposition.

7. The use according to claim 2, wherein the higher IFN-γ level is caused by at least one selected from the group consisting of infection, inflammation, age, and genetic predisposition.

8. The use according to claim 2, wherein the subject in need has i) Lower levels of endogenous α1-antitrypsin, and ii) Higher levels of at least one spike protein initiating protease.

9. The use according to claim 2, wherein the subject in need has i) Lower levels of endogenous α1-antitrypsin, and iii) Higher ACE2 receptor levels.

10. The use according to claim 2, wherein the subject in need has i) Lower levels of endogenous α1-antitrypsin, and iv) Higher levels of interferon-γ.

11. The use according to claim 10, wherein the higher IFN-γ level is caused by at least one disease or condition selected from the group consisting of: α1-antitrypsin deficiency, liver disease, diabetes, obesity, and / or cardiovascular disease.

12. The use according to claim 2, wherein the subject in need has i) Lower levels of endogenous α1-antitrypsin, ii) Higher levels of at least one spike protein initiating protease, and iii) Higher ACE2 receptor levels and / or iv) Higher IFN-γ levels.

13. The use according to claim 1, wherein the α1-antitrypsin protein is extracted from human plasma.

14. The use according to claim 1, wherein the α1-antitrypsin protein is recombinant α1-antitrypsin.

15. The use according to claim 14, wherein the α1-antitrypsin protein is as shown in SEQ ID NO:

1.

16. The use according to claim 1, wherein the composition further comprises a pharmaceutically acceptable excipient or carrier.

17. The use according to claim 1, wherein the composition further comprises a nucleoside analog, a protease inhibitor, an immunosuppressant, an antibiotic, an antibody or fragment thereof against a viral structural component, interferon beta, and / or a vaccine.

18. The use according to claim 17, wherein the immunosuppressant is thalidomide or tocilizumab.

19. The use according to claim 11, wherein the liver disease is non-alcoholic fatty liver disease.